Silencing the lncRNA NORAD inhibits EMT of head and neck squamous cell carcinoma stem cells via miR 26a 5p

Molecular Medicine REPORTS 24: 743, 2021

            Silencing the lncRNA NORAD inhibits EMT of head and
            neck squamous cell carcinoma stem cells via miR‑26a‑5p
                              WEIMING HU1*, YONG ZHAO2*, LIZHONG SU1, ZULIANG WU1,
                                  WENJING JIANG1, XIAOZE JIANG1 and MING LIU3

                   1
                   Department of Otorhinolaryngology, Zhejiang Provincial People's Hospital, People's Hospital of
                   Hangzhou Medical College, Hangzhou, Zhejiang 310014; 2Department of Otorhinolaryngology,
                                XIXI Hospital of Hangzhou; 3Department of Otorhinolaryngology,
                                   Zhejiang Hospital, Hangzhou, Zhejiang 310012, P.R. China

                                       Received July 22, 2020; Accepted December 3, 2020

                                                  DOI: 10.3892/mmr.2021.12383

Abstract. Cancer stem cells are closely associated with tumor      the expression of epithelial cell markers and decreased the
metastasis or recurrence. According to previous literature         expression of interstitial cell markers in HNSCC stem cells.
reports, microRNA (miR)‑26a has an inhibitory effect on            miR‑26a‑5p was a downstream gene of NORAD, and knock‑
head and neck squamous cell carcinoma (HNSCC), and the             down of miR‑26a‑5p partially offset the regulatory effect of
long non‑coding RNA (lncRNA) non‑coding RNA activated              siNORAD on HNSCC stem cells. Collectively, the present
by DNA damage (NORAD) has been found to interact with              study demonstrated that NORAD knockdown attenuated
miR‑26a‑5p. The present study aimed to investigate the             the migration, invasion and EMT of HNSCC stem cells via
regulation and mechanism of NORAD and miR‑26a‑5p in the            miR‑26a‑5p.
epithelial‑mesenchymal transition (EMT) of HNSCC stem
cells. An ALDEFLUOR stem cell detection kit, a flow cytom‑         Introduction
eter, a self‑renewal ability test and western blotting were used
to sort and identify HNSCC stem cells. The ENCORI website          Head and neck squamous cell carcinoma (HNSCC) accounts
and a dual‑luciferase assay were used to assess the relationship   for ~6% of systemic malignancies, and there are ~600,000 new
between genes. The mRNA and protein expression levels of           cases and 350,000 mortalities worldwide each year (1,2). The
NORAD, miR‑26a‑5p and EMT‑related genes were detected              past decade has seen an improved survival of patients with
via reverse transcription‑quantitative PCR and western blot‑       HNSCC due to the application of new drugs and treatments;
ting. Functional experiments (MTT assay, flow cytometry,           however, the overall survival rate has remained almost
wound healing assay and Transwell assay) were conducted to         unchanged (3). The main reason for treatment failure is distant
analyze the effects of NORAD and miR‑26a‑5p on HNSCC               metastasis or local recurrence of the tumor (4).
stem cells. The successfully sorted aldehyde dehydrogenase             In recent years, previous studies both in China and abroad
(ALDH)+ cells had a self‑renewal capacity and displayed            have reported that the existence of stem cells is the main
upregulated expression levels of CD44, Oct‑4 and Nanog.            cause of tumor metastasis and recurrence (5). Stem cells are a
NORAD knockdown, achieved using small interfering (si)             group of cell subpopulations that self‑renewal, differentiation
RNA, downregulated the expression levels of tumor markers          and passage abilities (6). These cells have been discovered
in ALDH+ cells. siNORAD inhibited cell vitality, migra‑            and confirmed to be present in numerous blood tumors and
tion and invasion, as well as promoted apoptosis, increased        solid tumors, such as leukemia, prostate cancer, breast cancer
                                                                   and head and neck tumors, amongst others (7‑9). In labora‑
                                                                   tory and clinical studies, these cells demonstrated tolerance
                                                                   to traditional therapies, including surgery, radiotherapy and
                                                                   chemotherapy (10). The identification of tumor stem cell
Correspondence to: Dr Ming Liu, Department of Otorhinolar‑
                                                                   biomarkers may help to develop individualized chemotherapy
yngology, Zhejiang Hospital, 12 Lingyin Road, Xihu, Hangzhou,
Zhejiang 310012, P.R. China
                                                                   drugs for targeted treatment of tumor stem cells.
E‑mail: liuming_ml1@163.com                                            CD44, aldehyde dehydrogenase (ALDH), Oct‑4 and Nanog
                                                                   have all been proved to be useful for the isolation and identi‑
*
    Contributed equally                                            fication of tumor stem cells in HNSCC (11). Chen et al (12)
                                                                   revealed that ALDH1+ and CD44+ cells collected from patients
Key words: head and neck squamous cell carcinoma, stem             with HNSCC can resist radiation therapy and maintain tumor
cells, epithelial‑mesenchymal transition, long non‑coding RNA,     stem‑like properties in HNSCC cells, serving a vital role in
non‑coding RNA activated by DNA damage, microRNA‑26a‑5p            tumor maintenance and growth. Moreover, Prince et al (13)
                                                                   reported that cells exhibiting low levels of ALDH can induce
                                                                   tumors with the same morphology and heterogeneity as the

2                                    HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

primary tumor, and cells with high expression of ALDH can            into a single‑cell suspension and inoculated into a culture plate
be passaged in animal models (13,14). These characteristics          at a density of 1,000 cells/ml. After 5‑7 days of culture, the
are consistent with the nature of tumor stem cells, thus indi‑       morphology of the cell microspheres was imaged using a light
cating that ALDH is a highly selective and specific marker for       microscope (magnification, x100). Cells that could form cell
HNSCC stem cells.                                                    microspheres again were considered to be self‑renewing.
    According to the literature, microRNA (miRNA/miR)‑26a
serves a role in multiple diseases (15,16). In animal experiments,   Cell transfection. To investigate the function of NORAD
miR‑26a has been shown to inhibit the release of inflammatory        in the development of HNSCC stem cells, NORAD over‑
factors and the activation of the NF‑κ B pathway by targeting        expression and small interfering (si)RNA (siNORAD,
transient receptor potential cation channel subfamily C              5'‑AATAGAATGAAGACCAACCGC‑3') vectors were trans‑
member 3, thereby slowing the progression of atherosclerosis         fected into H357 and HSC‑3 cells, and empty vector negative
in mice (17). In bladder cancer, miR‑26a inhibits cell invasion      control (NC) and siNC (5'‑GCGCGATAGCGCGAATATA‑3')
by acting on the high mobility group AT‑hook 1 protein (18).         were introduced as the NC. Subsequently, miR‑26a‑5p was
miR‑26a can also act on its direct target gene fibroblast            identified as a potential downstream target of NORAD using
growth factor 9 to inhibit the proliferation and migration of        ENCORI software (http://starbase.sysu.edu.cn/index.php).
gastric cancer cells (19). Furthermore, studies have reported        The effects of miR‑26a‑5p expression on the tumor growth
that miR‑26a has an inhibitory effect on HNSCC (20), while           were measured via the transfection of miR‑26a‑5p inhibitor
the long non‑coding (lnc)RNA non‑coding RNA activated                (I, 5'‑UUCUCCGAACGUGUCACGUTT‑3') (2 µg) or inhib‑
by DNA damage (NORAD) has been found to interact with                itor control (IC, 5'‑CAGUACUUUUGUGUAGUACAA‑3')
miR‑26a through bioinformatics, and exert a cancer‑promoting         (2 µg) using Lipofectamine™ 2000 reagent (Invitrogen;
effect in various tumors (21).                                       Thermo Fisher Scientific, Inc.) at room temperature for 15 min.
    Therefore, the aim of the present study was to investigate       After 48 h of incubation, the subsequent experiments were
whether NORAD affects the proliferation, apoptosis, migra‑           conducted. To verify the effects of the relationship between
tion, invasion and epithelial‑mesenchymal transition (EMT) of        NORAD and miR‑26a‑5p on the development of HNSCC
HNSCC cells by inhibiting the expression of miR‑26a.                 stem cells, miR‑26a‑5p I was applied for co‑transfection
                                                                     with siNORAD in H357 and HSC‑3 cells. All experiments
Materials and methods                                                in vitro contain six groups, including Blank, siNORAD‑siNC,
                                                                     siNORAD, IC, I and siNORAD+I groups.
Cells and culture. As recommended by the manufacturer,
H357 cell lines (cat. no. 06092004) purchased from The               Western blotting. Western blot analysis was conducted as
European Collection of Authenticated Cell Cultures were              previously described (24). Total protein extraction from
cultured in a 37˚C, 5% CO2 environment in DMEM:F12                   HNSCC stem cells was performed before and after transfec‑
medium (cat. no. 30‑2006) containing 2 mM glutamine                  tion. Specifically, cells in the logarithmic growth phase were
(cat. no. 30‑2214), 10% FBS (cat. no. 30‑2020; all from the          chosen, and after removal of the culture medium in the cell
American Type Culture Collection), and 0.5 µg/ml sodium              culture dish, the cells were washed three times with 4˚C
hydrocortisone succinate (cat. no. 125‑04‑2; Pure Chemistry          pre‑chilled PBS solution for ~5 min each time. After the PBS
Scientific, Inc.). HSC‑3 cell lines (cat. no. JCRB0623)              solution was exhausted, RIPA lysis buffer (cat. no. C05‑01001;
were purchased from the Japanese Collection of Research              BIOSS) was added and incubated on ice for 30 min to fully lyse
Bioresources Cell Bank, and cultured in Eagle's minimum              the cells. Then, the cells were scraped off with a cell spatula,
essential medium (cat. no. 30‑2003) with 10% newborn calf            and transferred into a 1.5‑ml EP tube together with the lysate,
serum (cat. no. 16010; both Gibco; Thermo Fisher Scientific,         followed by 10 min of centrifugation at 4˚C and 2,000 x g. After
Inc.).                                                               centrifugation, the supernatant was collected into an EP tube
    ALDH‑ cells and ALDH+ cells from H357 and HSC‑3                  and was directly used in western blot analysis. Protein concen‑
cell lines were sorted and identified using an ALDEFLUOR             tration was determined using a BCA protein assay kit (Bio‑Rad
stem cell detection kit (cat. no. 01700; Stemcell Technologies,      Laboratories, Inc.). The specific steps of the western blotting,
Inc.), according to the manufacturer's instructions, and a flow      namely gel preparation, electrophoresis, membrane transfer
cytometer (FACScan; BD Biosciences) with BD CellQuest Pro            (PVDF membrane; cat. no. IPVH00010; EMD Millipore),
software V5.1 (BD Biosciences) (22).                                 blocking (buffer; cat. no. 37565, Thermo Fisher Scientific,
                                                                     Inc.), incubation with primary antibodies for 24 h at 4˚C) and
Self‑renewal ability assay. ALDH‑ cells and ALDH+ cells              with secondary antibodies for 1 h at room temperature, and
were cultured in common cell culture flasks in DMEM                  luminescence (ECL luminous fluid; cat. no. WBKlS0100;
containing 10% FBS. Cells in the logarithmic growth phase            EMD Millipore; gel imaging system; Tanon 2500; Beijing
were selected, digested and then resuspended in serum‑free           Solarbio Science & Technology Co., Ltd.), were performed to
medium containing 10 ng/ml EGF and 10 ng/ml basic fibro‑             obtain the results.
blast growth factor. Subsequently, the cells were seeded in a            All antibodies in this study were purchased from
low‑adhesion 6‑well plate at a density of 2,500 cells/ml. After      Abcam, and were as follows: CD44 (cat. no. ab157107;
3 days of culture, 50% of the culture medium was renewed.            81 kDa; 1:2,000); Oct‑4 (cat. no. ab181557; 45 kDa; 1:1,000);
The self‑renewal capacity of the cells was evaluated using the       Nanog (cat. no. ab109250; 37 kDa; 1:1,000); MMP‑2
method described in the study by Ghods et al (23). The cell          (cat. no. ab97779; 74 kDa; 1:1,000); MMP‑9 (cat. no. ab38898;
microspheres were collected using a 40‑µm filter, dispersed          92 kDa; 1:1,000); E‑cadherin (cat. no. ab40772; 97 kDa:

Molecular Medicine REPORTS 24: 743, 2021                                                   3

1:10,000); N‑cadherin (cat. no. ab18203; 100 kDa; 1:10,000);            37˚C. Then, the center of the 6‑well plate was scratched with
vimentin (cat. no. ab92547; 54 kDa; 1:1,000); GAPDH                     a 200‑µl sterile tip, with even force applied. The floating cells
(cat. no. ab181602; 36 kDa; 1:10,000); and Goat Anti‑Rabbit             were washed with PBS and cultured in a serum‑free medium.
lgG H&L (HRP‑conjugated; cat. no. ab205718; 1:2,000).                   Images were captured under an inverted microscope (magni‑
                                                                        fication, x100; CKX53; Olympus Corporation) at 0 and 48 h
Lentivirus transfection. NORAD was cloned into a pCDNA3                 after scratching to observe the healing of cell scratches and
plasmid (Invitrogen; Thermo Fisher Scientific, Inc.). The               to compare the healing rate of each group, which was calcu‑
construction of NORAD overexpression and NC lentivirus                  lated with the measurement values of the scratch distances
vectors, and the packaging of lentiviruses were all conducted           of five randomly selected points. In total, three parallel holes
by Shanghai GenePharma Co., Ltd. The sorted ALDH+/‑ HNSCC               were made in each group of cells, and the experiment was
cells (1x103 cell) were seeded on a 96‑well plate for 24 h of           repeated three times.
regular culture. Then, when reaching 70% confluence, ALDH‑
cells were infected with viruses (MOI, 10), and ALDH+ cells             Transwell assay. The cell suspension was resuspended in a prepared
were transfected with 10 µg siNORAD or NORAD overex‑                    24‑well plate invasion chamber (cat. no. 3455‑024‑01; Cultrex;
pression vector. The transfection of cells was carried out using        R&D Systems, Inc.) at a density of 5x104 cells/ml. The upper
Lipofectamine 3000. After 48 h, subsequent experimentations             chamber surface was coated with Matrigel (cat. no. 354234;
were carried out.                                                       Corning, Inc.). About 10,000 cells were seeded into the upper
                                                                        chamber of the inserts supplemented with 70 µl serum‑free
Cell viability assay. An MTT cell proliferation and cyto‑               DMEM. Then, 750 µl DMEM containing 10% FBS was
toxicity assay kit (cat. no. C0009; Beyotime Institute                  added as a chemical attractant to the lower chamber of the
of Biotechnology) was used to determine the effects of                  24‑well plate. The cell suspension was incubated for 48 h. At
siNORAD and miR‑26a‑5p I on the viability of HNSCC stem                 the end of the incubation, the chamber was removed and the
cells. According to the experimental requirements, HNSCC                non‑invasive cells in the upper chamber were wiped off with
stem cells (1x104 cells/ml) were cultured at 37˚C for 24, 48            a sterile cotton swab. Invasive cells were stained with Giemsa
and 72 h. Subsequently, 10 µl MTT solution was added to each            stain (cat. no. G5637; Sigma‑Aldrich; Merck KGaA) at room
well, and the incubation was continued at 37 ˚C for 4 h. Next,          temperature for 10 min, and the number of transmembrane
100 µl formazan lysis solution was added to each well. After            cells, which were randomly selected from each field, was
mixing, the cells were incubated at 37˚C for 3‑4 h to dissolve          counted under an inverted light microscope (magnifica‑
formazan. The absorbance was measured at 570 nm using an                tion, x250) for each membrane.
iMark microplate reader (Bio‑Rad Laboratories, Inc.).
                                                                        Target gene prediction and verification. The binding relation‑
Apoptosis assay. An Annexin V‑FITC Apoptosis Detection                  ship between NORAD and miR‑26a‑5p was predicted using
kit (cat. no. C1062M; Beyotime Institute of Biotechnology)              the Encyclopedia of RNA Interactomes website (http://star‑
was used to analyze the apoptosis of HNSCC stem cells.                  base.sysu.edu.cn/).
Specifically, after 48 h of transfection, the collected cell micro‑         The binding relationship between NORAD and miR‑26a‑5p
spheres were digested with trypsin and pipetted into a single           was verified using a dual luciferase assay according to the
cell suspension. Then, the cell suspension was centrifuged at           following experimental steps: Luciferase reporter gene vectors
1,000 x g for 5 min at room temperature and the supernatant             (pmirGLO; cat. no. E1330; Promega Corporation) containing
was discarded. Next, 195 µl Annexin V‑FITC binding solution             NORAD wild‑type or mutant sequences were constructed.
was added to gently resuspend the cells. Subsequently, 5 µl             After screening positive clones and sequencing, the recombi‑
Annexin V‑FITC and 10 µl PI staining solution were added                nant luciferase reporter gene vector was extracted, and then
in sequence, and the cells were incubated at room tempera‑              co‑transfected with 200 ng miR‑26a‑5p I or IC into HNSCC
ture (20‑25˚C) for 10‑20 min in the dark, and then placed               stem cells using Lipofectamine 2000 reagent (Invitrogen;
in an ice bath. A flow cytometer (CytoFLEX V2‑B4‑R2;                    Thermo Fisher Scientific, Inc.), according to the manufacturer's
Beckman Coulter, Inc.) and Kaluza analysis V2.0 software                instructions, for 48 h at 37˚C. After transfection for 36 h, the
(Beckman Coulter, Inc.) were used to detect the amount of               dual‑luciferase system (cat. no. D0010‑100T; Beijing Solarbio
apoptosis (percentage of early apoptotic cells + percentage of          Science & Technology Co., Ltd.) and a detector (GloMax 20/20;
late apoptotic cells) in each group.                                    Promega Corporation) were used to analyze the fluorescence
                                                                        intensity of the reporter gene. Luciferase activity of genes was
Wound healing assay. HNSCC stem cells of different groups               normalized to that of Renilla luciferase.
were collected separately. After digestion, the supernatant
was discarded and the cell suspension was subjected to                  Reverse transcription‑quantitative (RT‑q)PCR. To detect the
centrifugation at 1,600 x g for 20 min at room temperature.             expression levels of NORAD, miR‑26a‑5p and EMT‑related
Then, the cells were resuspended in their respective culture            genes, TRIzol® reagent (cat. no. 15596018; Invitrogen;
solutions and subsequently pipetted into a single cell suspen‑          Thermo Fisher Scientific, Inc.) was used to extract mRNA and
sion (3x105 cells/ml). Next, the cell suspension was seeded on a        miRNA, according to the manufacturer's instructions, and a
6‑well cell culture plate, so that the cells could reach the state of   NanoDrop system (cat. no. ND‑LITE‑PR; NanoDrop;
monolayer adherent growth and attain nearly 100% confluence             Thermo Fisher Scientific, Inc.) was used to determine RNA
the next day. When the cells adhered to the well, serum‑free            concentration and purity. The RNA was then used to generate
cell culture medium was added to culture the cells overnight at         cDNA using a reverse transcription kit (OneStep RT‑PCR kit;

4                                        HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

Figure 1. Isolation and identification of tumor stem cells from HNSCC cell lines. (A) Flow cytometry was used to sort ALDH‑ and ALDH+ cells from HNSCC
cell lines H357 and HSC‑3. (B) ALDH+ cells suspended in serum‑free medium formed cell microspheres (magnification, x100). (C) Protein expression levels
of ALDH in control, ALDH‑ and ALDH+ cells were detected using western blotting, (D) and the results were semiquantified. (E) Western blotting results
of the (F) expression levels of tumor stem cell marker genes CD44, Oct‑4 and Nanog in ALDH‑ and ALDH+ H357 cells. (G) Western blotting results of the
(H) expression levels of tumor stem cell marker genes CD44, Oct‑4 and Nanog in ALDH‑ and ALDH+ HSC‑3 cells. *P

Molecular Medicine REPORTS 24: 743, 2021                                             5

Thermo Fisher Scientific, Inc.) and a PCR Bio‑Rad Chromo 4         overexpression plasmid (P

6                                         HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

Figure 2. Overexpression and knockdown of NORAD affects the expression levels of stem cell markers in H357 and HSC‑3 cell lines. Transfection efficiencies
of (A) overexpression and (B) siRNA vector were measured using reverse transcription‑quantitative PCR. (C) Western blotting was used to detect the effect
of NORAD overexpression on the expression levels of CD44, Oct‑4 and Nanog in from H357 ALDH‑ cells. (D) Relative protein expression levels in H357
ALDH‑ cells. (E) Western blotting was used to detect the effect of NORAD overexpression on the expression levels of CD44, Oct‑4 and Nanog in HSC‑3
ALDH‑ cells. (F) Relative protein expression levels in HSC‑3 ALDH‑ cells. (G) Western blotting was used to detect the effect of NORAD knockdown on the
expression levels of CD44, Oct‑4 and Nanog in H357 ALDH+ cells. (H) Relative protein expression levels in H357 ALDH+ cells. (I) Western blotting was used
to detect the effect of NORAD knockdown on the expression levels of CD44, Oct‑4 and Nanog in HSC‑3 ALDH+ cells. (J) Relative protein expression levels
in HSC‑3 ALDH+ cells. GAPDH was used as a control. ^^^P

Molecular Medicine REPORTS 24: 743, 2021                                                                  7

Figure 3. NORAD knockdown affects the tumor characteristics of HNSCC tumor stem cells. (A) siNORAD inhibited the viability of HNSCC tumor stem
cells, which was detected using a MTT assay. (B) Results of the (C) flow cytometry, which was used to detect the effect of lncRNA NORAD silencing on the
apoptosis of HNSCC tumor stem cells. (D) A wound healing assay was used to measure the (E) cell migration rate of the Blank, siNORAD‑NC and siNORAD
groups; magnification, x100. (F) Cell invasion rate of each group was measured using a (G) Transwell assay; magnification, x250). *P

8                                           HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

Figure 4. lncRNA NORAD targeted to miR‑26a‑5p regulates the viability and apoptosis of tumor stem cells in HNSCC. (A) The Encyclopedia of RNA
Interactomes website (http://starbase.sysu.edu.cn/) predicted, and (B) the dual luciferase report assay verified the targeting relationship between lncRNA NORAD
and miR‑26a‑5p. Reverse transcription‑quantitative PCR was used to determine the expression levels of (C) lncRNA NORAD and (D) miR‑26a‑5p in the Blank,
siNORAD‑siNC, siNORAD, IC, I and siNORAD+I groups. (E) Viability of tumor stem cells in each group was detected using the MTT method. (F) miR‑26a‑5p
partially offset the effect of siNORAD on apoptosis, as determined via (G) flow cytometry. *P

Molecular Medicine REPORTS 24: 743, 2021                                                                9

Figure 5. Long non‑coding RNA NORAD knockdown decreases the migration and invasion of tumor stem cells via miR‑26a‑5p in HNSCC. Wound healing
assay results from (A) H357 and (B) HSC‑3 cells indicating the migration distances of the Blank, siNORAD‑siNC, siNORAD, IC, I and siNORAD+I groups;
magnification, x100. (C) Relative migration rates are presented as bar diagrams. (D) Number of invasive tumor stem cells in each group was determined using
Transwell assays in (E) H357 and (F) HSC‑3 cells; magnification, x250). *P

10                                         HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

Figure 6. lncRNA NORAD knockdown attenuates the expression of EMT-related proteins in HNSCC tumor stem cells via miR-26a-5p. (A) Western blot
analysis was used to detect the expression of MMP-2, MMP-9, E-cadherin, N-cadherin and Vimentin, and (B) relative protein expression is presented as bar
diagrams in H357 cells. Reverse transcription-quantitative PCR was used to determine the mRNA expression of MMP-2, MMP-9, E-cadherin, N-cadherin
and Vimentin in (C) H357 and (D) HSC-3 cells. (E) Western blot analysis was used to detect the expression of MMP-2, MMP-9, E-cadherin, N-cadherin and
Vimentin, and (F) relative protein expression is presented as bar diagrams in HSC-3 cells. *P

Molecular Medicine REPORTS 24: 743, 2021                                                  11

     With the development and application of microarray chips         cells, the effects of miR‑26a‑5p overexpression on the EMT
and other technologies, the number of expression profiles             progression of cancer cells require further investigation.
of HNSCC‑related non‑coding RNAs is increasing (30).                      In conclusion, the present study demonstrated that
Abnormally expressed miRNA can not only be used for                   NORAD interfered with the malignant phenotype and EMT
early diagnosis of HNSCC, but also have certain guiding               of HNSCC stem cells by inhibiting miR‑26a‑5p. The present
significance for tumor metastasis and prognostic monitoring,          research provides a novel insight into the molecular regula‑
which may provide novel ideas for targeted therapy (31). For          tory network of HNSCC stem cells, but these findings should
example, overexpression of miR‑96‑5p leads to increased               be further clarified in in vivo experiments and in additional
cell migration and radiation resistance and chemotherapy              downstream pathway studies.
resistance in HNSCC cells by targeting PTEN to activate
the PI3K/Akt/mTOR signaling pathway (32). Furthermore,                Acknowledgements
Liu et al (33) identified 128 abnormally expressed miRNAs in
HNSCC tissues, and suggested that hsa‑miR‑383, hsa‑miR‑615            Not applicable.
and hsa‑miR‑877 may be used as diagnostic markers.
     As for miR‑26a, which was the primary focus of the present       Funding
study, research on this miRNA has achieved certain results;
for example, it has been suggested that miR‑26a may have a            This work was supported by the Zhejiang Provincial
role as a biomarker for small extracellular vesicles and as a         Department of Medicine and Health Project (grant
modulator of excitatory neurotransmission (34,35). However,           no. 2018247374) and the Zhejiang Traditional Chinese
with regards to HNSCC, especially on the regulation of stem           Medicine Science and Technology Plan Project (grant
cell stemness and epithelial‑mesenchymal function, there is           no. 201823105013221).
still a lack of relevant research. The latest report revealed that
miR‑26a overexpression inhibited cell migration via PAK1 and          Availability of data and materials
suppressed tumor formation in tongue squamous cell carci‑
noma (36). The present study demonstrated that miR‑26a‑5p             The analyzed data sets generated during the study are avail‑
silencing promoted cell viability, invasion and migration,            able from the corresponding author on reasonable request.
which is in line with previous results (37). Unlike the previous
study, however, the present study found that the upstream target      Authors' contributions
gene of miR‑26a‑5p may be lncRNA NORAD, according to the
prediction of bioinformatics, suggesting that NORAD mediates          Substantial contributions to conception and design: WH
the stemness of HNSCC stem cells via miR‑26a‑5p.                      and YZ. Data acquisition, data analysis and interpretation:
     A previous study revealed that NORAD was abnormally              LS, ZW, WJ, XJ and ML. Drafting the article or critically
expressed in gastric cancer samples, and miR‑214 interfered           revising it for important intellectual content: WH and YZ.
with the proliferation of gastric cancer cells (38). In the current   All authors agreed to be accountable for all aspects of the
study, as expected, knockdown of NORAD significantly                  work in ensuring that questions related to the accuracy or
downregulated the expression levels of stem cell markers, and         integrity of the work are appropriately investigated and
siRNA‑targeted NORAD had a significant regulatory effect              resolved. All authors read and approved the final manuscript.
on the biological characteristics of HNSCC tumor stem cells.
Furthermore, the miR‑26a‑5p I counteracted the effect of              Ethics approval and consent to participate
siNORAD on HNSCC tumor stem cells.
     EMT is an important cause of tumor metastasis, and               Not applicable.
increasing evidence has shown that EMT and stem cells are
also closely related (39). May et al (40) reported that when          Patient consent for publication
EMT occurs in human breast epithelial cells, there will be
the subsequent high expression of stem cell‑related factors.          Not applicable.
Moreover, a study of patients with pancreatic cancer found
that the occurrence of EMT is often accompanied by the                Competing interests
activation of stem cell‑related channels (41). A previous study
has also reported that, compared with primary tumor cells,            The authors declare that they have no competing interests.
the expression levels of EMT‑related markers in stem cells
are significantly increased. Furthermore, these markers are           References
downregulated in epithelial cells but have increased expres‑
sion in mesenchymal cells (42). EMT not only promotes the              1. Svider PF, Blasco MA, Raza SN, Shkoukani M, Sukari A,
metastasis and invasion of tumor cells, but also affects the              Yoo GH, Folbe AJ, Lin HS and Fribley AM: Head and Neck
                                                                          Cancer. Otolaryngol Head Neck Surg 156: 10‑13, 2017.
drug resistance and enrichment of stem cells (43). The present         2. Mendez LC, Moraes FY, Poon I and Marta GN: The
results also suggested that NORAD regulated the expression                management of head and neck tumors with high technology
levels of EMT‑related proteins in stem cells via miR‑26a‑5p.              radiation therapy. Expert Rev Anticancer Ther 16: 99‑110, 2016.
                                                                       3. Solomon B, Young RJ and Rischin D: Head and neck squamous
     However, there is a limitation to the present study.                 cell carcinoma: Genomics and emerging biomarkers for
Although it was demonstrated that the miR‑26a‑5p I could                  immunomodulatory cancer treatments. Semin Cancer Biol 52:
notably promote the migration and invasion of HNSCC stem                  228‑240, 2018.

12                                     HU et al: MECHANISM OF NORAD AND miR‑26a‑5p IN HNSCC

 4. Mermod M, Tolstonog G, Simon C and Monnier Y: Extracapsular         25. Livak KJ and Schmittgen TD: Analysis of relative gene expression
    spread in head and neck squamous cell carcinoma: A systematic           data using real‑time quantitative PCR and the 2(‑Delta Delta
    review and meta‑analysis. Oral Oncol 62: 60‑71, 2016.                   C(T)) Method. Methods 25: 402‑408, 2001.
 5. Chang JC: Cancer stem cells: Role in tumor growth, recurrence,      26. Zhang H and Guo H: Long non‑coding RNA NORAD induces
    metastasis, and treatment resistance. Medicine (Baltimore) 95           cell proliferation and migration in prostate cancer. J Int Med
    (Suppl 1): S20‑S25, 2016.                                               Res 47: 3898‑3904, 2019.
 6. Nandy SB and Lakshmanaswamy R: Cancer Stem Cells and                27. Yu SY, Peng H, Zhu Q, Wu YX, Wu F, Han CR, Yan B, Li Q
    Metastasis. Prog Mol Biol Transl Sci 151: 137‑176, 2017.                and Xiang HG: Silencing the long noncoding RNA NORAD
 7. Zhou H and Xu R: Leukemia stem cells: The root of chronic               inhibits gastric cancer cell proliferation and invasion by the
    myeloid leukemia. Protein Cell 6: 403‑412, 2015.                        RhoA/ROCK1 pathway. Eur Rev Med Pharmacol Sci 23:
 8. Leão R, Domingos C, Figueiredo A, Hamilton R, Tabori U                  3760‑3770, 2019.
    and Castelo‑Branco P: Cancer Stem Cells in Prostate Cancer:         28. Huo H, Tian J, Wang R, Li Y, Qu C and Wang N: Long
    Implications for Targeted Therapy. Urol Int 99: 125‑136, 2017.          non‑coding RNA NORAD upregulate SIP1 expression to
 9. Curtarelli RB, Gonçalves JM, Dos Santos LGP, Savi MG, Nör JE,           promote cell proliferation and invasion in cervical cancer.
    Mezzomo LAM and Rodríguez Cordeiro MM: Expression of Cancer             Biomed Pharmacother 106: 1454‑1460, 2018.
    Stem Cell Biomarkers in Human Head and Neck Carcinomas: A           29. Toledo‑Guzmán ME, Hernández MI, Gómez‑Gallegos ÁA and
    Systematic Review. Stem Cell Rev Rep 14: 769‑784, 2018.                 Ortiz‑Sánchez E: ALDH as a Stem Cell Marker in Solid Tumors.
10. Dawood S, Austin L and Cristofanilli M: Cancer stem cells:              Curr Stem Cell Res Ther 14: 375‑388, 2019.
    Implications for cancer therapy. Oncology (Williston Park) 28:      30. Sannigrahi MK, Sharma R, Panda NK and Khullar M: Role of
    1101‑1107, 1110, 2014.                                                  non‑coding RNAs in head and neck squamous cell carcinoma: A
11. Peitzsch C, Nathansen J, Schniewind SI, Schwarz F and                   narrative review. Oral Dis 24: 1417‑1427, 2018.
    Dubrovska A: Cancer Stem Cells in Head and Neck Squamous            31. Zou AE, Zheng H, Saad MA, Rahimy M, Ku J, Kuo SZ,
    Cell Carcinoma: Identification, Characterization and Clinical           Honda TK, Wang‑Rodriguez J, Xuan Y, Korrapati A, et al:
    Implications. Cancers (Basel) 11: E616, 2019.                           The non‑coding landscape of head and neck squamous cell
12. Chen YC, Chen YW, Hsu HS, Tseng LM, Huang PI, Lu KH,                    carcinoma. Oncotarget 7: 51211‑51222, 2016.
    Chen DT, Tai LK, Yung MC, Chang SC, et al: Aldehyde dehy‑           32. Vahabi M, Pulito C, Sacconi A, Donzelli S, D'Andrea M,
    drogenase 1 is a putative marker for cancer stem cells in head          Manciocco V, Pellini R, Paci P, Sanguineti G, Strigari L, et al:
    and neck squamous cancer. Biochem Biophys Res Commun 385:               miR‑96‑5p targets PTEN expression affecting radio‑chemo‑
    307‑313, 2009.                                                          sensitivity of HNSCC cells. J Exp Clin Cancer Res 38: 141,
13. Prince MEP, Zhou L, Moyer JS, Tao H, Lu L, Owen J, Etigen M,            2019.
    Zheng F, Chang AE, Xia J, et al: Evaluation of the immuno‑          33. Liu C, Yu Z, Huang S, Zhao Q, Sun Z, Fletcher C, Jiang Y and
    genicity of ALDH(high) human head and neck squamous cell                Zhang D: Combined identification of three miRNAs in serum as
    carcinoma cancer stem cells in vitro. Oral Oncol 59: 30‑42, 2016.       effective diagnostic biomarkers for HNSCC. EBioMedicine 50:
14. Ailles L and Prince M: Cancer stem cells in head and neck               135‑143, 2019.
    squamous cell carcinoma. Methods Mol Biol 568: 175‑193, 2009.       34. Tormo E, Adam‑Artigues A, Ballester S, Pineda B, Zazo S,
15. Li J, Liang Y, Lv H, Meng H, Xiong G, Guan X, Chen X, Bai Y             González‑Alonso P, Albanell J, Rovira A, Rojo F, Lluch A, et al:
    and Wang K: miR‑26a and miR‑26b inhibit esophageal squamous             The role of miR‑26a and miR‑30b in HER2+ breast cancer
    cancer cell proliferation through suppression of c‑MYC pathway.         trastuzumab resistance and regulation of the CCNE2 gene. Sci
    Gene 625: 1‑9, 2017.                                                    Rep 7: 41309, 2017.
16. Cabello P, Pineda B, Tormo E, Lluch A and Eroles P: The             35. Lafourcade CA, Fernández A, Ramírez JP, Corvalán K,
    Antitumor Effect of Metformin Is Mediated by miR‑26a in                 Carrasco MÁ, Iturriaga A, Bátiz LF, Luarte A and Wyneken U:
    Breast Cancer. Int J Mol Sci 17: E1298, 2016.                           A Role for mir‑26a in Stress: A Potential sEV Biomarker and
17. Feng M, Xu D and Wang L: miR‑26a inhibits atherosclerosis               Modulator of Excitatory Neurotransmission. Cells 9: E1364,
    progression by targeting TRPC3. Cell Biosci 8: 4, 2018.                 2020.
18. Lin Y, Chen H, Hu Z, Mao Y, Xu X, Zhu Y, Xu X, Wu J, Li S,          36. Wei Z, Chang K, Fan C and Zhang Y: miR‑26a/miR‑26b represses
    Mao Q, et al: miR‑26a inhibits proliferation and motility in            tongue squamous cell carcinoma progression by targeting PAK1.
    bladder cancer by targeting HMGA1. FEBS Lett 587: 2467‑2473,            Cancer Cell Int 20: 82, 2020.
    2013.                                                               37. Li Y, Wang P, Wu LL, Yan J, Pang XY and Liu SJ:
19. Deng M, Tang HL, Lu XH, Liu MY, Lu XM, Gu YX, Liu JF                    miR‑26a‑5p Inhibit Gastric Cancer Cell Proliferation and
    and He ZM: miR‑26a suppresses tumor growth and metastasis               Invasion Through Mediated Wnt5a. OncoTargets Ther 13:
    by targeting FGF9 in gastric cancer. PLoS One 8: e72662, 2013.          2537‑2550, 2020.
20. Fukumoto I, Kikkawa N, Matsushita R, Kato M, Kurozumi A,            38. Tao W, Li Y, Zhu M, Li C and Li P: lncRNA NORAD Promotes
    Nishikawa R, Goto Y, Koshizuka K, Hanazawa T, Enokida H, et al:         Proliferation And Inhibits Apoptosis Of Gastric Cancer By
    Tumor‑suppressive microRNAs (miR‑26a/b, miR‑29a/b/c and                 Regulating miR‑214/Akt/mTOR Axis. OncoTargets Ther 12:
    miR‑218) concertedly suppressed metastasis‑promoting LOXL2              8841‑8851, 2019.
    in head and neck squamous cell carcinoma. J Hum Genet 61:           39. Zhang Y and Weinberg RA: Epithelial‑to‑mesenchymal tran‑
    109‑118, 2016.                                                          sition in cancer: Complexity and opportunities. Front Med 12:
21. Zhang XM, Wang J, Liu ZL, Liu H, Cheng YF and Wang T:                   361‑373, 2018.
    LINC00657/miR‑26a‑5p/CKS2 ceRNA network promotes the                40. May CD, Sphyris N, Evans KW, Werden SJ, Guo W and
    growth of esophageal cancer cells via the MDM2/p53/Bcl2/Bax             Mani SA: Epithelial‑mesenchymal transition and cancer stem
    pathway. Biosci Rep 40: BSR20200525, 2020.                              cells: A dangerously dynamic duo in breast cancer progression.
22. Cheng Y, Wen G, Sun Y, Shen Y, Zeng Y, Du M, Zhu G,                     Breast Cancer Res 13: 202, 2011.
    Wang G and Meng X: Osteopontin Promotes Colorectal Cancer           41. Zhou P, Li B, Liu F, Zhang M, Wang Q, Liu Y, Yao Y and Li D:
    Cell Invasion and the Stem Cell‑Like Properties through the             The epithelial to mesenchymal transition (EMT) and cancer stem
    PI3K‑AKT‑GSK/3β‑β/Catenin Pathway. Med Sci Monit 25:                    cells: Implication for treatment resistance in pancreatic cancer.
    3014‑3025, 2019.                                                        Mol Cancer 16: 52, 2017.
23. Ghods AJ, Irvin D, Liu G, Yuan X, Abdulkadir IR, Tunici P,          42. K ha n M I, Cza r necka A M, L ewick i S, Helbrecht I,
    Konda B, Wachsmann‑Hogiu S, Black KL and Yu JS: Spheres                 Brodaczewska K, Koch I, Zdanowski R, Król M and Szczylik C:
    isolated from 9L gliosarcoma rat cell line possess chemoresistant       Comparative Gene Expression Profiling of Primary and
    and aggressive cancer stem‑like cells. Stem Cells 25: 1645‑1653,        Metastatic Renal Cell Carcinoma Stem Cell‑Like Cancer Cells.
    2007.                                                                   PLoS One 11: e0165718, 2016.
24. Kuo SZ, Honda CO, Li WT, Honda TK, Kim E, Altuna X,                 43. Shibue T and Weinberg RA: EMT, CSCs, and drug resistance:
    Abhold E, Wang‑Rodriguez J and Ongkeko WM: Metformin                    The mechanistic link and clinical implications. Nat Rev Clin
    Results in Diametrically Opposed Effects by Targeting Non‑Stem          Oncol 14: 611‑629, 2017.
    Cancer Cells but Protecting Cancer Stem Cells in Head and Neck
    Squamous Cell Carcinoma. Int J Mol Sci 20: E193, 2019.                              This work is licensed under a Creative Commons
                                                                                        Attribution-NonCommercial-NoDerivatives 4.0
                                                                                        International (CC BY-NC-ND 4.0) License.