Study on the interaction mechanism between C-reactive protein and platelets in the development of acute myocardial infarction
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Original Article
Page 1 of 11
Study on the interaction mechanism between C-reactive protein
and platelets in the development of acute myocardial infarction
Yubao Liu1, Shuhui Lai2 Lijie Liang3, Donghai Zhang1
1
Department of Intensive Care Medicine, The Second Affiliated Hospital of Qiqihar Medical College, Qiqihar, China; 2The First Clinical Medical
College of Nanchang University, Nanchang, China; 3Ultrasound Department, The Second Affiliated Hospital of Qiqihar Medical College, Qiqihar,
China
Contributions: (I) Conception and design: Y Liu, D Zhang; (II) Administrative support: L Liang; (III) Provision of study materials or patients: Y Liu,
D Zhang, L Liang; (IV) Collection and assembly of data: Y Liu, L Liang; (V) Data analysis and interpretation: D Zhang, Y Liu; (VI) Manuscript
writing: All authors; (VII) Final approval of manuscript: All authors.
Correspondence to: Yubao Liu. Department of Intensive Care Medicine, The Second Affiliated Hospital of Qiqihar Medical College, No. 37, West
Zhonghua Road, Jianhua District, Qiqihar 161006, China. Email: liuyubao0452@163.com.
Background: Myocardial infarction (MI) is the single most critical event in coronary disease. Platelets
are involved in the processes of acute MI (AMI). They lack nuclear DNA but retain megakaryocyte
mRNAs, hence, their transcriptome could provide information preceding coronary events. However, their
mechanisms are not clear. In this study, we obtained a gene expression atlas of platelets from patients after
their very first AMI, and our purpose was to clarify the mechanisms of platelet involvement in the occurrence
of AMI through bioinformatics analyses and animal models of AMI in vivo.
Methods: We obtained a gene expression atlas of platelets from patients after their very first AMI from the
Gene Expression Omnibus (GEO). Differentially expressed genes (DEGs) were retrieved using R language.
Weighted gene co-expression network analysis (WGCNA) was implemented in order to construct a gene co-
expression correlation network among DEGs. Animal models of AMI in vivo were constructed to confirm
the results of the bioinformatics analysis.
Results: Gene integration analysis yielded 2,852 DEGs (P1). Bioinformatics analysis
demonstrated a significant association between C-reactive protein (CRP) and Staphylococcus aureus infection (SAI)
(P=0.015). Data from in vivo experiments showed that CRP increased significantly in AMI rats (P
Page 2 of 11 Liu et al. The relationship between platelets and CRP in AMI
electrocardiogram (ECG) (4). It accounts for approximately Weighted gene co-expression network analysis (WGCNA)
25–40% of AMI (5). The majority of patients with STEMI construction
can receive percutaneous coronary intervention and drugs
The GSE24519 dataset included 17 AMI patients with
to relieve symptoms, but it remains an impossible task
overall survival details, and thus qualified for WGCNA
to rescue the necrotic and apoptotic myocardial cells (6).
construction. Next, the module eigengenes were linked
Unfortunately, no significant decrease has been observed
with the clinical data of AMI patients. A data matrix
in the risk of death of AMI patients in hospital over the
concerning gene expression in GSE24519 was then
past decades, yet the number of affected patients in China
constructed, with the first 25% of genes in disease samples
is expected to increase to 23 million by the year 2030 (7).
exhibiting the largest variance chosen to serve as the input
Even if timely treatment exists, acute myocardial ischemic
dataset applied for the follow-up WGCNA with the use of
injury and ensuing ischemia-reperfusion injury continue to
the R “WGCNA” package. The outlier sample was then
be challenging issues. Furthermore, radiological and other
detected and excluded by employing the sample hierarchical
auxiliary examination approaches, as well as elucidating
clustering method, which was prior to the selection of
applicable biomarkers, are regarded as highly necessary for
a qualified soft-threshold power to obtain a standard
the early diagnosis of this event (8).
scale-free network. Thereafter, by means of adjacency,
Platelets play a key role in thrombotic processes that
topological overlap matrix (TOM) construction, and
limit the patency of the recanalized, infarct-related coronary
corresponding dissimilarity calculation, a gene dendrogram
artery and contribute to reperfusion injury (9). The vascular
was generated and module identification was carried out
importance of platelets has been attributed to their essential
with the use of dynamic tree cut, with a minimum module
role in mediating MI (10). Studies have shown that platelets
size of 50. Subsequently, module eigengenes cluster analysis
become activated during MI (11), but the mechanism of
was carried out to merge extremely similar modules (with
their participation in AMI is not clear. Thus, in our study,
dissimilarity less than 0.25), followed by calculating the
we aim to clarify the mechanisms of platelet involvement in
correlation of the module eigengene with the AMI clinical
the occurrence of AMI through bioinformatics analyses and
phenotype. The module was then selected and used for
animal models of AMI in vivo. We present the following
further analyses, then gene significance (GS) and module
article in accordance with the ARRIVE reporting checklist
membership (MM) were acquired and used for identifying
(available at https://dx.doi.org/10.21037/atm-21- 2733).
the modules linked to the clinical traits of AMI.
Methods
Enrichment analysis
Microarray-based analysis concerning up-regulated
In the gene network in accordance with the scale-free
differentially expressed genes (DEGs)
distribution, genes exhibiting identical expression would
The study was conducted in accordance with the be modulated together, linked functionally or by shared
Declaration of Helsinki (as revised in 2013). pathways. Upon topological overlap calculation, genes in
First, the GSE24519 dataset was retrieved from the the aforementioned chosen module showing a positive
Gene Expression Omnibus (GEO) database (available association with C-reactive protein (CRP) were investigated.
at http://www.ncbi.nlm.nih.gov/geo/), which comprised S u b s e q u e n t l y, G e n e O n t o l o g y ( G O ) a n d K y o t o
of platform files and original files (CEL files). Next, Encyclopedia of Genes and Genomes (KEGG) analyses
background correction was implemented, whereupon were performed via WebGestalt (available at http://www.
quantile normalization, prosummarization, and log2 webgestalt.org/). Functions presenting with P1, alongside P value Dawley rats (180–220 g, 6–8 W, Hunan, China) were
Annals of Translational Medicine, Vol 9, No 12 June 2021 Page 3 of 11
control group, CRP group, and sham operation group. Enzyme-linked immunosorbent assay (ELISA)
Prior to the experiment, 2% pentobarbital sodium, sterile
ELISA is amongst the most significant biochemical analysis
equipment packages, and a 5-F bipolar temporary pacing
techniques for diagnosing and monitoring a plethora of
electrode were prepared. The procured rats were food-
diseases (14). The content of CRP in PPP was detected as
fasted for a duration of 12 hours, water-fasted for a duration
per the manufacturer’s instructions of the rat high sensitivity
of 6 hours, partially depilated on the back, and weighed.
CRP ELISA kit (Sigma, USA).
The rats in the AMI group were anesthetized with 2%
pentobarbital sodium (0.3 mL/100 g), fixed in the supine
position, and intubated with air intake maintained with Real-time quantitative polymerase chain reaction (RT-qPCR)
a ventilator. The leads of the animal ECG monitoring
The total RNA content of PRP, which was isolated using
machine were inserted into the subcutaneous muscle
the TRIzol reagent, underwent cDNA reverse transcription
layer of limbs according to the operation requirements.
with the use of Reverse Transcription kits (PN4366596,
After obtaining stable readings on the ECG, second left
acquired from Applied Biosystems). Expression patterns
intercostal thoracotomy was performed to expose the
of long non-coding RNAs (lncRNAs) in tissues were
pericardium, and the coronary artery was completely
quantified using KAPA SYBR FAST qPCR kits (KK4601,
ligated with surgical suture 1–2 mm from the left anterior
acquired from Kapa Biosystems). GAPDH was employed
descending branch. After a few seconds, the ECG showed
as the internal control, and levels of expressed genes were
STEMI, the heart was thereby reset, and the chest was
assessed with the 2–ΔΔCt method combined with MxPro 4.00
closed layer by layer. The rats in the CRP group were fed
(Stratagene), with primer sequences shown in Table 1.
a conventional diet and injected with CRP (recombinant
human CRP) through the tail vein (3 mg/kg). Meanwhile,
the rats randomized into the sham operation group Statistical analysis
underwent puncture in the left anterior descending branch
All data involved in this investigation were expressed as
of the left coronary artery without ligation, and the rest
mean ± standard deviation (mean ± SD), with a minimum
of the process was the same as the model establishment.
of three repeated independent experiments. Data were
The rats in the control group were fed a conventional diet
analyzed using Graphpad prism 5.0 software. Two-group
without any treatment. Experiments were approved by
data comparisons were implemented with Student’s t-test.
ethics board of The Second Affiliated Hospital of Qiqihar
P
Page 4 of 11 Liu et al. The relationship between platelets and CRP in AMI
Table 1 The used primer sequences
Primer sequence
Gene name
Forward sequence (5'-3') Reverse sequence (5'-3')
FCGR2B GTTGGGGCTGAGAACACAAT ACAGGGAGCTTCAGGACTCA
HLA-DRB4 AGACAAGTTCACCCCACCAG AGCATCAAACTCCCAGTGCT
GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA
genes in varied samples. It is capable of forming either Model diagnosis
a cluster or module that contains genes presenting with
The successful establishment of AMI model can be judged
identical expression (15). Once genes are present in a
by ECG, serum biomarkers or echocardiography, and each
module, they exhibit a tendency to possess similar biological
method has its important diagnostic significance. In this
functions, and the associations of modules with sample
study, the method of observing the animal signs and ECG
features can be investigated (16).
in the process of model replication was used as the standard
The GSM604591, GSM604585, and GSM604589
to detect the successful establishment of AMI model. The
datasets were removed from follow-up analyses in GSE24519
results of this experiment showed that after ligation of the
as outlier samples, leaving 14 samples with survival data that
left anterior descending coronary artery, the myocardial
were included in WGCNA (Figure 1A,B). The power of β=6
(scale free R2 =0.9) was chosen as the soft-threshold in order tissue of the left ventricular anterior wall became pale and
to construct a scale-free network (depicted in Figure 1C,D). contraction weakened. Physiological signal acquisition and
Thirteen modules related to gene co-expression were finally processing system software system shows that the ECG is
identified following removal of the grey module with the converted from normal QRS waveform to typical STEMI.
use of merged dynamic tree cutting (Figure 1E). A heat map These results indicate that the AMI model was successfully
depicting the TOM of the 1000 selected genes showed established.
that each module worked as an independent verification
to one another (depicted in Figure 1F). Subsequently, we CRP increased in AMI rats
identified the green-yellow module, representing a key
module showing the most significant association with CRP After 6 hours in the animal model, the average levels of
(R 2 =0.86, P=7e–05; Figure 1G). Next, we attempted to CRP in the normal group, sham operation group, AMI
draw scatter plots concerning GS relative to MM in the group, and CRP group were 1,049±162, 1,674±190,
green-yellow module with GS for CRP (correlation =0.84, 6,577±836, and 7,949±910 ng/mL, respectively. These
P=3.5e–19; Figure 1H). Gene expression profiles from findings showed that the content of CRP was increased in
platelet samples in The Cancer Genome Atlas (TCGA) the AMI group in contrast to the sham group (**, P
Annals of Translational Medicine, Vol 9, No 12 June 2021 Page 5 of 11
A Sample clustering to detect outliers B Sample dendrogram and trait heatmap
120000
80000
Height
40000
Age
Gender
Bmi
0
Ck.peak
crp
tnl
il.6
Check Scale free topology
C Scale independence Mean connectivity D Histogram of k
scale R2 =0.92, slope =–1.65
1.0 700
600
600 –0.6
Scale free topology mode fit,
0.8 500
500 –0.8
Mean connectivity
0.6 400 –1.0
signed R2
400
log10 [p(k)]
Frequency
300 300 –1.2
0.4
200 200 –1.4
0.2
100 100 –1.6
0.0 0 –1.8
0
5 10 15 20 5 10 15 20
20 40 60 80 100 1.2 1.4 1.6 1.8
Soft threshold (power) Soft threshold (power)
k log10 (k)
Network heatmap plot, selected genes
E F
Cluster dendrogram
1.0
0.9
0.8
0.7
Height
0.6
0.5
0.4
0.3
Module
colors
© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(12):1012 | https://dx.doi.org/10.21037/atm-21-2733Page 6 of 11 Liu et al. The relationship between platelets and CRP in AMI
G Module-trait relationships H
1
Module membership vs. gene significance
cor =0.84, P=3.5e–19
Gene significance for body crp
0.5 0.8
0.6
0
0.4
–0.5
0.2
0.4 0.5 0.6 0.7 0.8 0.9 1.0
Module membership in green yellow module
–1
I Group
Expression Group
2 Case
1 Normal
0
–1
–2
Figure 1 Development of the weighted co-expression network. (A,B) Hierarchical cluster dendrogram of samples acquired from GSE24519.
(C,D) Scale-free fit indicator along with mean connectivity related to varied soft-threshold powers. β=6 for scale-free topology test. (E)
Hierarchical cluster dendrogram of differential genes based on topological overlap. In this figure, modules are indicative of the branches
in the cluster tree. (F) A heat map depicting the TOM of the selected 1,000 genes. In this figure, darker color reflects higher overlap while
lighter color reflects lower overlap. Gene dendrogram along with module assignment is exhibited along the left and top. (G) Correlation
assessment of module eigengenes with clinical traits. Columns reflect clinical traits and each row corresponds to a module eigengene. Every
cell contains correlation and P values, with the green-yellow module containing CRP. (H) Scatter plots depicting GS relative to MM in
the green-yellow module with GS for CRP (correlation =0.84, P=3.5e–19). (I) The expression matrix of 68 DEGs from platelet samples in
TCGA database. In this figure, blue reflects lower expression, red reflects higher expression, and white reflects no expression difference in
the genes. TOM, topological overlap matrix; GS, gene significance; MM, module membership; CRP, C-reactive protein; DEG, differentially
expressed gene; TCGA, The Cancer Genome Atlas.
© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(12):1012 | https://dx.doi.org/10.21037/atm-21-2733Annals of Translational Medicine, Vol 9, No 12 June 2021 Page 7 of 11
A
10
20
30
40
50
60
70
10
20
30
40
50
60
70
0
0
Bar chart of Cellular Component
All All
Membrane
Biological regulation Nucleus
Metabolic process Protein-containing complex
Bar chart of Biological
Membrane-enclosed lumen
Response to stimulus
Process categories
Endomembrane system
Cell communication Cytosol
Vesicle
categories
Multicellular organismal process Chromosome
Localization Cell projection
Cytoskeleton
Cellular component organization Golgi apparatus
Developmental process Extracellular space
Mitochondrion
Multi-organism process Endoplasmic reticulum
Reproduction Vacuole
Endosome
Cell proliferation Ribosome
Growth Extracellular matrix
Envelope
Unclassified Unclassified
10
20
30
40
50
60
70
0
All
Protein binding
Bar chart of Molecular
Ion binding
Nucleic acid binding Function categories
Transferase activity
Hydrolase activity
Nucleotide binding
Molecular transducer activity
Structural molecule activity
Transporter activity
Lipid binding
Protein tag
Unclassified
B
FDR ≤0.05 FDR >0.05
0 2 4 6 8 10 12 14 16 18 20
Glycosphingolipid biosynthesis
Thiamine metabolism
Glycosaminoglycan biosynthesis
Renin-angiotensin system
Glycosaminoglycan biosynthesis_1
Staphylococcus aureus infection
Asthma
Autophagy
Allograft rejection
Tryptophan metabolism
0 2 4 6 8 10 12 14 16 18 20
Enrichment ratio
Figure 2 Genes displaying a positive association with CRP were found to be enriched in SAI. (A) GO analysis of genes displaying a positive
association with CRP. (B) KEGG analysis of genes displaying positive relation with CRP. CRP, C-reactive protein; SAI, Staphylococcus aureus
infection; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.
influence the expression levels of infection-related genes, Discussion
the expression patterns of FCGR2B and HLA-DRB4 in the
AMI, along with heart failure that often ensues, are
four groups were detected using RT-qPCR. The results
illustrated increased mRNA expression levels of FCGR2B major causes of morbidity and mortality worldwide (17).
and HLA-DRB4 in the AMI group in contrast to the sham Interestingly, the work of our peers has shown that
operation group (***, PPage 8 of 11 Liu et al. The relationship between platelets and CRP in AMI
A OD Concentration 1400
(450 nm) (ng/mL) y = 20.743x2 + 321.16x – 14.6
1200 R2 =0.9999
S1 0.042 0
1000
S2 0.102 18.75
800
S3 0.174 37.5
600
S4 0.255 75
400
S5 0.504 150
200
S6 0.934 300
0
S7 1.714 600 0 1 2 3 4
S8 3.145 1200
B 15000
***
The content of CRP (ng/mL)
***
10000
5000
0
Normal CRP Sham AMI
operation
Figure 3 The average levels of CRP in the normal group, sham operation group, AMI group, and CRP group after 6 hours in the animal
model. (A) Standard curve of CRP. (B) Statistical chart of CRP. ***, PAnnals of Translational Medicine, Vol 9, No 12 June 2021 Page 9 of 11
10
*** FCGR2B mRNA
8 HLA-DRB4 mRNA
Relative mRNA expression
***
6
***
4 ***
2
0
al
RP
n
I
al
RP
n
I
AM
AM
io
io
m
m
C
C
at
at
or
or
er
er
N
N
op
op
am
am
Sh
Sh
Figure 4 The mRNA expression levels of FCGR2B and HLA-DRB4 in the normal group, sham operation group, AMI group, and CRP
group after 6 hours in the animal model. ***, PPage 10 of 11 Liu et al. The relationship between platelets and CRP in AMI
org/10.21037/atm-21-2733 myocardial infarction in Korea (from the Korea Acute
Myocardial Infarction Registry from 2006 to 2013). Am J
Conflicts of Interest: All authors have completed the ICMJE Cardiol 2014;114:1817-22.
uniform disclosure form (available at https://dx.doi. 6. Kloner RA, Dai W, Hale SL, et al. Approaches to
org/10.21037/atm-21-2733). The authors have no conflicts improving cardiac structure and function during and after
of interest to declare. an acute myocardial infarction: acute and chronic phases. J
Cardiovasc Pharmacol Ther 2016;21:363-7.
Ethical Statement: The authors are accountable for all 7. Li J, Li X, Wang Q, et al. ST-segment elevation
aspects of the work in ensuring that questions related myocardial infarction in China from 2001 to 2011 (the
to the accuracy or integrity of any part of the work are China PEACE-Retrospective Acute Myocardial Infarction
appropriately investigated and resolved. Experiments were Study): a retrospective analysis of hospital data. Lancet
approved by ethics board of The Second Affiliated Hospital 2015;385:441-51. Retracted and republished in: Lancet
of Qiqihar Medical University, in compliance with Qiqihar 2015;385:402.
Medical University guidelines for the care and use of 8. Ye XD, He Y, Wang S, et al. Heart-type fatty acid binding
animals. The study was conducted in accordance with the protein (H-FABP) as a biomarker for acute myocardial
Declaration of Helsinki (as revised in 2013). injury and long-term post-ischemic prognosis. Acta
Pharmacol Sin 2018;39:1155-63.
Open Access Statement: This is an Open Access article 9. Gawaz M, Neumann FJ, Ott I, et al. Platelet function in
distributed in accordance with the Creative Commons acute myocardial infarction treated with direct angioplasty.
Attribution-NonCommercial-NoDerivs 4.0 International Circulation 1996;93:229-37.
License (CC BY-NC-ND 4.0), which permits the non- 10. Koupenova M, Clancy L, Corkrey HA, et al. Circulating
commercial replication and distribution of the article with platelets as mediators of immunity, inflammation, and
the strict proviso that no changes or edits are made and the thrombosis. Circ Res 2018;122:337-51.
original work is properly cited (including links to both the 11. Xiao SJ, Zhou YF, Wu Q, et al. Uncovering the
formal publication through the relevant DOI and the license). differentially expressed genes and pathways involved in
See: https://creativecommons.org/licenses/by-nc-nd/4.0/. the progression of stable coronary artery disease to acute
myocardial infarction using bioinformatics analysis. Eur
Rev Med Pharmacol Sci 2021;25:301-2.
References
12. Yazigi Junior JA, Dos Santos JB, Xavier BR, et al.
1. Lewis EF, Li Y, Pfeffer MA, et al. Impact of cardiovascular Quantification of platelets obtained by different
events on change in quality of life and utilities in patients centrifugation protocols in SHR rats. Rev Bras Ortop
after myocardial infarction: a VALIANT study (valsartan 2015;50:729-38.
in acute myocardial infarction). JACC Heart Fail 13. Xu J, Gou L, Zhang P, et al. Platelet-rich plasma and
2014;2:159-65. regenerative dentistry. Aust Dent J 2020;65:131-42.
2. Lavall MC, Bagatini MD, Thomé GR, et al. Extracellular 14. Zhdanov A, Keefe J, Franco-Waite L, et al. Mobile
hydrolysis of adenine nucleotides and nucleoside phone based ELISA (MELISA). Biosens Bioelectron
adenosine is higher in patients with ST elevation than 2018;103:138-42.
non-ST elevation in acute myocardial infarction. Clin Lab 15. Beckerman P, Qiu C, Park J, et al. Human kidney tubule-
2015;61:761-7. specific gene expression based dissection of chronic kidney
3. Kapur NK, Thayer KL, Zweck E. Cardiogenic shock disease traits. EBioMedicine 2017;24:267-76.
in the setting of acute myocardial infarction. Methodist 16. Tang J, Kong D, Cui Q, et al. Prognostic genes of breast
Debakey Cardiovasc J 2020;16:16-21. cancer identified by gene co-expression network analysis.
4. Gnavi R, Rusciani R, Dalmasso M, et al. Gender, Front Oncol 2018;8:374.
socioeconomic position, revascularization procedures 17. Ong SB, Hernández-Reséndiz S, Crespo-Avilan GE, et
and mortality in patients presenting with STEMI and al. Inflammation following acute myocardial infarction:
NSTEMI in the era of primary PCI. Differences or multiple players, dynamic roles, and novel therapeutic
inequities? Int J Cardiol 2014;176:724-30. opportunities. Pharmacol Ther 2018;186:73-87.
5. Kook HY, Jeong MH, Oh S, et al. Current trend of acute 18. Newby LK. Inflammation as a treatment target after acute
© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(12):1012 | https://dx.doi.org/10.21037/atm-21-2733Annals of Translational Medicine, Vol 9, No 12 June 2021 Page 11 of 11
myocardial infarction. N Engl J Med 2019;381:2562-3. meta-analysis of CRP levels. Psychol Med 2019;49:1958-70.
19. Akodad M, Sicard P, Fauconnier J, et al. Colchicine and 29. Geluk CA, Post WJ, Hillege HL, et al. C-reactive protein
myocardial infarction: a review. Arch Cardiovasc Dis and angiographic characteristics of stable and unstable
2020;113:652-9. coronary artery disease: data from the prospective
20. Thackeray JT, Hupe HC, Wang Y, et al. Myocardial PREVEND cohort. Atherosclerosis 2008;196:372-82.
inflammation predicts remodeling and neuroinflammation 30. Anzai T. Inflammatory mechanisms of cardiovascular
after myocardial infarction. J Am Coll Cardiol remodeling. Circ J 2018;82:629-35.
2018;71:263-75. 31. Yuksel M, Xiao X, Tai N, et al. The induction of
21. Liu Z, Ma C, Gu J, et al. Potential biomarkers of autoimmune hepatitis in the human leucocyte antigen-
acute myocardial infarction based on weighted gene DR4 non-obese diabetic mice autoimmune hepatitis
co-expression network analysis. Biomed Eng Online mouse model. Clin Exp Immunol 2016;186:164-76.
2019;18:9. 32. Su K, Wu J, Edberg JC, et al. A promoter haplotype of
22. McNamara JF, Harris PNA, Chatfield MD, et al. Acute the immunoreceptor tyrosine-based inhibitory motif-
Myocardial Infarction and Community-Acquired bearing FcgammaRIIb alters receptor expression and
Staphylococcus aureus Bloodstream Infection: an associates with autoimmunity. I. Regulatory FCGR2B
observational cohort study. Clin Infect Dis 2020. [Epub polymorphisms and their association with systemic lupus
ahead of print]. doi: 10.1093/cid/ciaa1197. erythematosus. J Immunol 2004;172:7186-91.
23. Rischpler C. Acute myocardial infarction. Q J Nucl Med 33. Vogelpoel LT, Baeten DL, de Jong EC, et al. Control
Mol Imaging 2016;60:236-51. of cytokine production by human fc gamma receptors:
24. Hennessy T, Soh L, Bowman M, et al. The Low Dose implications for pathogen defense and autoimmunity.
Colchicine after Myocardial Infarction (LoDoCo-MI) Front Immunol 2015;6:79.
study: a pilot randomized placebo controlled trial of 34. Loughman A, Fitzgerald JR, Brennan MP, et al. Roles for
colchicine following acute myocardial infarction. Am fibrinogen, immunoglobulin and complement in platelet
Heart J 2019;215:62-9. activation promoted by Staphylococcus aureus clumping
25. Black S, Kushner I, Samols D. C-reactive protein. J Biol factor A. Mol Microbiol 2005;57:804-18.
Chem 2004;279:48487-90. 35. Klimenta B, Nefic H, Prodanovic N, et al. Association of
26. Du Clos TW, Mold C. C-reactive protein: an activator of biomarkers of inflammation and HLA-DRB1 gene locus
innate immunity and a modulator of adaptive immunity. with risk of developing rheumatoid arthritis in females.
Immunol Res 2004;30:261-77. Rheumatol Int 2019;39:2147-57.
27. Sproston NR, Ashworth JJ. Role of C-reactive protein 36. Şelli ME, Thomas AC, Wraith DC, et al. A humanized
at sites of inflammation and infection. Front Immunol HLA-DR4 mouse model for autoimmune myocarditis. J
2018;9:754. Mol Cell Cardiol 2017;107:22-6.
28. Osimo EF, Baxter LJ, Lewis G, et al. Prevalence of low-
grade inflammation in depression: a systematic review and (English Language Editor: C. Betlazar-Maseh)
Cite this article as: Liu Y, Lai S, Liang L, Zhang D. Study
on the interaction mechanism between C-reactive protein and
platelets in the development of acute myocardial infarction.
Ann Transl Med 2021;9(12):1012. doi: 10.21037/atm-21-2733
© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(12):1012 | https://dx.doi.org/10.21037/atm-21-2733You can also read
