RNA virome analysis of hematophagous Chironomoidea ies (Diptera: Ceratopogonidae and Simuliidae) collected in Tokyo, Japan
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
〔Med. Entomol. Zool. Vol. 71 No. 3 p. 225‒243 2020〕 225
reference
DOI: 10.7601/mez.71.225
Original Article
RNA virome analysis of hematophagous Chironomoidea flies (Diptera:
Ceratopogonidae and Simuliidae) collected in Tokyo, Japan
Daisuke Kobayashi*, 1), Katsunori Murota1), 2), Astri Nur Faizah1),
Michael Amoa-Bosompem1), Yukiko Higa1), Toshihiko Hayashi1),
Yoshio Tsuda1), Kyoko Sawabe1) and Haruhiko Isawa1)
* Corresponding author: dkoba@nih.go.jp
1)
Department of Medical Entomology, National Institute of Infectious Diseases,
1‒23‒1 Toyama, Shinjuku-ku, Tokyo 162‒8640, Japan
2)
Kyushu Research Station, National Institute of Animal Health, NARO,
2702 Chuzan-cho, Kagoshima City, Kagoshgima 891‒0105, Japan
(Received: 26 June 2020; Accepted: 3 August 2020)
Abstract: The development of sequencing technologies, in recent years, gives novel insights into the diversity of
viruses in arthropods. Human pathogenic or possible pathogenic arthropod-borne viruses (arboviruses) including
novel viruses from mosquitoes and ticks have been found by RNA virome analysis using a high-throughput
sequencer. However, virome studies for other blood-sucking arthropods like biting midges as well as black flies are
relatively scarce. In this study, to find viruses in hematophagous Chironomoidea flies, we performed RNA virome
analyses of field-caught female Culicoides arakawae and Simulium aureohirtum as a pilot study. In the analyses,
six novel viruses belonging to five virus taxa were detected, showing that RNA virome analysis using the next-
generation sequencer was a strong method for understanding the viruses in both biting midges and black flies.
This study indicated that C. arakawae and S. aureohirtum, which are not a popular vector for human pathogenic
viruses, have a variety of viruses which are as many as other important vectors including mosquitoes and ticks.
Furthermore, RNA virome analysis of a variety of blood-sucking insects will aid in not only discovering novel
arboviruses but also understanding novel importance for arboviral vectors.
Key words: virome, metagenome, biting midge, black fly, insect-specific virus, Jingmenvirus
Introduction (reviewed in Mullen and Murphree, 2019). The
genus Culicoides is the main taxon within the family
The blood-sucking property in arthropods is needed from the aspect of disease vectors for both humans
for disease transmission to occur in animal hosts. and animals. Oropouche fever due to Oropouche
Among hematophagous insects, flies in Diptera such orthobunyavirus is a Culicoides-borne human
as mosquitoes and tsetse flies are important vectors viral disease which is endemic in the entire Latin
of several types of pathogens (viruses, protozoans, America (Mullen and Murphree, 2019). Except for
and filarial nematodes) and causes serious public human diseases, Culicoides midges pass on a variety
health problems in several areas of the world (Durden of pathogenic viruses to domesticated animals
and Mullen, 2019). Among the dipteran insects, the (Mullen and Murphree, 2019). In Japan, for instance,
blood-sucking properties have been evolved in an Akabane disease caused by Akabane virus and
independent manner several times (Wiegmann et transmitted by Culicoides midges is a serious issue
al., 2011). Many famous disease vectors (e.g., biting for livestock ruminants with stillbirth and congenital
midge, black fly, mosquito, and sand fly) are known in malformations, etc. (Yanase, 2009).
suborder Nematocera in Diptera. The biting midges More than 2,200 species of black flies have
and black flies are in close association taxonomically been descried worldwide (reviewed in Adler and
within Nematocera since the families Ceratopogonidae McCreadie, 2019). Black flies are well known vectors
(including biting midges) and Simuliidae (including of human onchocercasis caused by the filarial
black flies) are categorized into the same superfamily, nematode Onchocerca, which is endemic in several
Chironomoidea. countries in the central belt of Africa and in tropical
The Ceratopogonidae are widespread with America (reviewed in Adler and McCreadie, 2019).
6,267 surviving described species in 123 genera In Japan, 11 human cases of zoonotic onchocercasis226 Med. Entomol. Zool.
due to O. dewittei japonica Uni, Bain & Takaoka al., 2001) with primer A and primer B designated by
have been reported so far (Fukuda et al., 2019), and Xiong and Kocher (1991). Moreover, the sequence
Simulium bidentatum (Shiraki) was pointed out as of the DNA barcoding region of the cytochrome c
the vector species of this nematode (Fukuda et al., oxidase subunit I (COI) gene was amplified with the
2010). Moreover, some species in Simuliidae were primer set LCO1490 and HCO2198 (Folmer et al.,
regarded as the vectors for an avian blood parasite, 1994). The amplicons were purified and as well as
Leucocytozoon lovati (Sato et al., 2009). In contrast, sequenced as reported previously (Kobayashi et al.,
vesicular stomatitis virus is just known as a virus that 2018). The specimens were stored at -80°C until the
is transmitted by a black fly in the Americas (reviewed following analyses.
in Adler and McCreadie, 2019).
The development of sequencing technologies, in Next-generation sequencing
recent years, gives novel insights into the diversity A basic technique of next-generation sequencing
of viruses in nature (e.g., Shi et al., 2016a, 2018). (NGS) was the same as reported previously
Present-day studies have shown that quite diverse (Kobayashi et al., 2020). Shortly, the pooled female
viruses present in arthropods (e.g., Li et al., 2015; Shi C. arakawae and S. aureohirtum were homogenized
et al., 2016a) and several studies indicated human with the medium. The supernatant of the centrifuged
pathogenic or possible pathogenic arthropod-borne homogenates was passed through a sterilized 0.45 µm
viruses (arboviruses) including novel viruses by RNA filter. To digest DNA and RNA derived from host
virome analysis of hematophagous arthropods (Tokarz insects, nuclease treatment was conducted. Nuclease
et al., 2014, 2018; Moutailler et al., 2016; Bouquet et cocktail [14 units of TURBO DNase (Invitrogen), 12.5
al., 2017; de Souza et al.,2018; Brinkmann et al., 2018; units of Baseline-ZERO DNase (epicentre), and 5 µg
Harvey et al., 2019a; Temmam et al., 2019; Faizah et of RNase A (Nippon gene)] was added to the 380 µL
al., 2020; Kobayashi et al., 2020). Additionally, a lot filtrate and incubated at a temperature of 37°C for 1
of viruses have been discovered from mosquitoes by hour. RNA extraction was carried out by ISOGEN II
virome analyses so far (reviewed in Atoni et al., 2019). (Nippon gene), and cDNA was synthesized with the
Almost all studies were principally conducted on use of NEBNext RNA first-strand and second-strand
mosquitoes and ticks, and the studies for other blood- synthesis modules (New England Biolabs). Eventually,
sucking arthropods are relatively scarce (Temmam et library preparation steps were done with the use of
al., 2016; Harvey et al., 2019b; Modha et al., 2019). TruSeq Nano DNA library prep kit (illumina) or
In this manuscript, to quest as well as characterize NEBNext Ultra II End Repair/dA-Tailing Module
viruses in biting midges and black flies, we have (New England Biolabs) and NEBNext Ultra II Ligation
accomplished the RNA virome analysis of field-caught Module (New England Biolabs). The prepared library
female C. arakawae (Arakawa) and S. aureohirtum was amplified as needed by PCR enzyme and primer
Brunetti as a pilot study. In the course of the analyses, cocktail which are supplied with the TruSeq nano
six various types of virus-like sequences were found, DNA library prep kit or NEB Next Ultra II Q5 Master
and further genetic and phylogenetic analyses were Mix (New England Biolabs). The purified library was
done for the characterization of virus properties. assessed with the use of the MiniSeq system (Illumina)
with the MiniSeq Mid Output kit (300 cycles)
Materials and Methods
(Illumina). The acquired reads were imported into the
Collection and identification of biting midges and CLC Genomics Workbench version 12 (Qiagen), and
black flies de novo assembly was conducted. The possible viral
Biting midges and black flies were collected in sequence was pointed out by BLAST searches from the
the continual mosquito surveillance in the National resulting contigs.
Institute of Infectious Diseases which is located at
Shinjuku, Tokyo, Japan (Tsuda and Hayashi, 2014). Confirmation of the endogenous viral elements of
The collection methods were reported previously detected viruses
(Tsuda and Hayashi, 2014). In brief, a battery- Endogenous viral elements (EVEs) of various
operated CDC-like suction trap with 1 kg dry ice was viruses were found in diverse arthropods (Shi et
used for the collection, and the trap was utilized for al., 2016a). For the possibilities of EVEs of detected
24 hours. Collected biting midges were identified by viruses to be confirmed, viral genome-specific primer
morphology. Contrarily, molecular identification was sets were designated based on the resultant contigs
attempted for the identification of the species of black (Table 1). RNA and DNA were extracted from the
flies with the use of genomic DNA that is extracted by filtrate and then subjected to RT-PCR and PCR with
alkaline lysis (Rudbeck and Dissing, 1998) from their the use of the primers (Table 2), the same method
one or two legs. The mitochondrial 16S ribosomal previously described (Kobayashi et al., 2020). Internal
RNA (rRNA) gene was utilized for this experiment controls in this experiment were amplified using the
in accordance with the previous study (Otsuka et primer sets for the 28S rRNA gene of C. arakawaeVol. 71
No. 3
2020
Table 1. List of virus-like contigs found by BLAST search.
Contigs related to viral sequence
No. of total No. of Total Result of blastx search
Source Length Average
read contig* Virus taxon Contig name read
(nt) coverage Highest score protein name Accession Identity
count e-value
No. (%)
C. arakawae 97620 43 Jingmenvirus nC1_c7 984 33 5.04 putative glycoprotein [Shuangao insect virus 7] ALL52906 0.001 25
nC1_c24 2611 121 6.91 putative capsid protein [Wuhan aphid virus 2] QDF44112 8e-22 30
nC1_c26 2358 74 4.69 NS3-like protein [Wuhan aphid virus 1] ALL52901 2e-113‒0.008** 39‒46**
nC1_c33 666 18 4.05 non-structural protein 1 [Wuhan aphid virus 1] BBV14756 1e-71 51
Phasmaviridae nC1_c10 1774 47 3.97 RNA-dependent RNA polymerase [Ganda bee virus] APT68154 2e-140 43
nC1_c22 1691 57 5 RNA-dependent RNA polymerase [Ganda bee virus] APT68154 6e-54 28
nC1_c21 1486 63 6.16 nucleopasid protein [Wuchang Cockroach Virus 1] AJG39319 2e-43 37
nC1_c36 816 17 3.12 glycoprotein precursor [Wuhan mosquito virus 1] AJG39296 6e-07 26
nC1_c38 776 16 3.1 L protein, partial [Niukluk phantom virus] QDZ59195 2e-92 61
nC1_c39 557 16 4.21 RNA-dependent RNA polymerase [Pink bollworm virus 2] QID77675 3e-10 29
Nodaviridae nC1_c11 3142 176 8.35 RNA-dependent RNA polymerase [Macrobrachium rosenbergii AAO60068 0.0 46
nodavirus]
S. aureohirtum 464240 46 Dicistroviridae 18BF1_c1 3967 30327 1088.99 putative non-structural polyprotein [Solenopsis invicta virus 6] QBL75886 1e-165 46
18BF1_c3 3484 30457 1249.69 putative non-structural polyprotein [Solenopsis invicta virus 6] QBL75886 3e-134 45
18BF1_c5 696 4297 870.01 putative structural polyprotein [Solenopsis invicta virus 6] QBL75888 3e-21 39
Nodaviridae 18BF1_c27 1240 176 20.45 RNA dependent RNA polymerase protein A [Nodamura virus] AAF97860 1e-90 46
18BF1_c34 668 65 14.45 hypothetical protein [Shuangao insect virus 11] APG76299 9e-84 61
18BF1_c31 1103 114 15.22 capsid [Caninovirus sp.] ASM93481 7e-86 50
unclassified 18BF1_c37 528 19 5.37 hypothetical protein 2 [Wuhan insect virus 21] APG76533 8e-37 56‒70**
*Total number of contigs more than 500 nt in length. **Several frames were opened inside one contig. The range of number shows the value in each frame.
227228 Med. Entomol. Zool.
Table 2. Primers used for EVE examinations.
Virus Prime name Sequence (5′-3′)
Carajing virus segment 1 CaJin-s1-FW TTGCACGACCTCGGAATGCGATT
CaJin-s1-RV GCATATCCTTGCGTGGAAATCCT
segment 2 CaJin-s2-FW AAACTCCTGTCGTAGAGGCTGCA
CaJin-s2-RV TGTGTTTCATGCAGTACGTCGAG
segment 3 CaJin-s3-FW2 ACGGATATCGCGGAATGCGGAAT
CaJin-s3-RV2 GGGTGGTCGTCCTTCTCGCAGAA
segment 4 CaJin-s4-FW AGCAAGCCCTAGACAAATTGCCT
CaJin-s4-RV ACGCATTGCAATCAAGCACTAGT
Carapha virus L segment CaPhas-Lc38-FW TAGTGCCTTAGTCTCCAAGGTGC
CaPhas-Lc10-RV AATGAGCACGATAATATAGAAGA
M segment CaPhas-Mc36-FW AAGAGATGTTGGGTCACAGCCAA
CaPhas-Mc36-RV GGTGATGACGTGACATACTACAT
S segment CaPhas-Sc21-FW GTGCTCAGTAGTCATTAGGTGAC
CaPhas-Sc21-RV AGAGACTGCTGCATCATCACGTT
Carano virus RNA 1 CaNoda-RNA1-FW AGACTGTCCAGACAGAGCATTGG
CaNoda-RNA1-RV GAGCTCACCAGTGAAGTGCTGAC
Sacri virus Scrip-4F ATGCCCGATATGGTAGGCAATAA
Scrip-4R GAACGTCAGGATTAGGCCAAGAA
Sano virus RNA 1 SNoda1-2F AAAGAGAAACCGTATTGGCTAAC
SNoda1-2R GGAAGTCTCTGGATTTGCTCTAT
RNA 2 SNoda2-1F GGAGACCTGTTCTCTCGAATAGT
SNoda2-1R GTACCTGAATGATGCGTAATTGT
Simulium aureohirtum associated A virus SCPL-1F CTAACTCCAAGCGCAAAGTGTA
SCPL-1R GCACAACCAAGTGAGGAAGTAAT
(Ca28SrRNA-FW, 5′-AGC TCA GCA CGT AGG alignments were performed by MAFFT online service
CCG ACA AC-3′; Ca28SrRNA-RV, 5′-CCC TTA AAC (Katoh et al., 2019). The multiple alignments of all
GGT TTC ACG TAC TT-3′) and Simuliidae universal viruses were performed using MAFFT-L-INS-i (Katoh
(Sim28S-F, 5′-TGA AGT GTC TAA ATA TCT GAA et al., 2005). The conserved amino acid sequences
T-3′; Sim28S-R: 5′-GAC TTC TTG GTC CGT GTT among associated viruses were extracted with the use
TCA A-3′). of the Gblocks program (Castresana, 2000). Selections
of the appropriate amino acid substitution models
Determination and characterization of viral genome and constructions of phylogenetic dendrogram were
sequences carried out using MEGA 6 (Tamura et al., 2013).
Specific primer sets for virus sequences filled the
Results
sequence gaps of each contig with the use of RT-PCR,
and the resultant amplicons were sanger-sequenced RNA virome analysis of hematophagous
with the use of ABI 3130 Genetic Analyzer (Applied Chironomoidea flies
Biosystems) as described previously (Kobayashi et Female biting midges were collected on June 13 and
al., 2018). The 3′ terminal sequence of the Sacri virus 20, 2017, and they were all classified as C. arakawae
was determined by the rapid amplification of cDNA by morphology. On the other hand, three female
ends method as described previously (Kobayashi Simulium spp. were collected on July 10, 2018, and
et al., 2016, 2017). The open reading frame (ORF) molecular identification was performed. A total of
and the encoded amino acid sequences of each 516 nucleotides (nt) of the mitochondrial 16S rDNA
virus were determined using the Genetyx version 13 was sequenced, showed 100% identity to each other,
software (Genetyx). The secondary structure of the which suggests that three individuals were of the
internal ribosome entry site (IRES) was speculated same species. The sequences were compared with the
by the mfold program (Zuker, 2003) and constructed deposited sequences in the International Nucleotide
manually. Sequence Database (DDBJ/EMBL/GenBank), and
they shared 99% identity with that of S. aureohirtum
Phylogenetic analysis (GenBank accession nos. KP793690 and AB056735).
The determined amino acid sequences of each virus Moreover, the COI sequence has also shown to be
were used for phylogenetic analysis. Multiple sequence 99% identical to that of the same species (KF289401),Vol. 71 No. 3 2020 229
Fig. 1. Examinations of the endogenous viral element (EVE) of detected viruses.
(A) EVE detections from C. arakawae. The upper image, RT-PCR products with the use of RNA as a template; middle image, PCR
products with the use of RNA as a template; lower image, PCR products with the use of DNA as a template. First to fourth lines from
the left side, detection of different segments of CaJV by various primer sets [CaJin-s1-FW and CaJin-s1-RV (segment 1), CaJin-s2-
FW and CaJin-s2-RV (segment 2), CaJin-s3-FW2 and CaJin-s3-RV2 (segment 3), and CaJin-s4-FW and CaJin-s4-RV (segment 4);
Table 2]. Fifth to seventh lines from the left side, detection of L, M, and S segments of CaPhV by various primer sets (for L segment,
CaPhas-Lc38-FW and CaPhas-Lc10-RV; for M segment, CaPhas-Mc36-FW and CaPhas-Mc36-RV; for S segment, CaPhas-Sc21-FW
and CaPhas-Sc21-RV; Table 2). Eighth line from the left side, detection of the RNA 1 of CaNoV by the specific primer set (CaNoda-
RNA1-FW and CaNoda-RNA1-RV, Table 2). Second line from the right side, 28S rRNA gene amplicon of C. arakawae as a positive
control. Far-right lane, a 100-bp DNA marker. (B) EVE examinations from S. aureohirtum. The same meaning and order from upper
to lower images as Fig. 1A. Far-left lane, detection of SaCV by the specific primer sets (Scrip-4F and Scrip-4R, Table 2). Second and
third lines from the left side, detection of different segments of SaNoV (for RNA 1, SNoda1-2F and SNoda1-2R; for RNA 2, SNoda2-
1F and SNoda2-1R; Table 2). Fourth line from the left side, detection of SAAV by the specific primer set (SCPL-1F and SCPL-1R,
Table 2). Second line from the right side, 28S rRNA gene amplicon of S. aureohirtum as a positive control. Far-right lane, a 100-bp
DNA marker.
suggesting that the Simulium species collected is S. virus-like sequences were found in C. arakawae by
aureohirtum. blastx search, and the sequences fell into three general
A total of 30 C. arakawae (collected from 26 and virus categories including jingmenvirus, phasmavirus,
4 individuals on June 13 and 20, respectively) and and nodavirus (Table 1). Contrarily, contigs, containing
3 S. aureohirtum samples were mixed into a single three different types of virus-like sequences
pool, respectively, and NGS analysis was carried out. (dicistrovirus, nodavirus, and unclassified virus) were
Total read numbers acquired from C. arakawae and identified from S. aureohirtum (Table 1). The amino
S. aureohirtum were 97,620 and 464,240, respectively acid sequences of all contigs shared low sequence
(Table 1). As a result of the de novo assembly, 43 and identities to already known viruses, indicating that
46 contigs, which were more than 500 nt in length, these contigs were derived from novel viruses.
were acquired from C. arakawae and S. aureohirtum, RNA and DNA forms of each virus-like sequences
respectively (Table 1). A total of 11 contigs containing were analyzed for the confirmation of the EVEs. All230 Med. Entomol. Zool.
Vol. 71 No. 3 2020 231
sequences were identified only by RT-PCR with the use from a single virus.
of the template RNA, showing that all viruses detected Highly conserved amino acid sequences are
by NGS present as RNA forms in the specimens and encoded on the NSP1 (flaviviral NS5-like protein)
no EVEs in the host genome (Fig. 1). and NSP2 (flaviviral NS3-like protein) among
the related viruses. Thus, these sequences were
Characterization of a novel jingmenvirus named used for phylogenetic analyses for the assessment
Carajing virus from C. arakawae of the evolutionary relationships among related
There were four resultant contigs that are related viruses. These are two distinct clades, which are the
to jingmenvirus and all of them have low amino acid named clusters of tick-borne and insect-associated
sequence similarities to already known jingmenviruses jingmenviruses in both dendrograms (Fig. 2B and C).
(Table 1). A 666 nt sequence (contig name nC1_c33) The jingmenvirus detected in this study has formed
was acquired as segment 1 of jingmenvirus and non- a clade with the insect-associated jingmenviruses
structural protein 1 (NSP1) of Wuhan aphid virus 1 (Fig. 2B and C). The phylogenetic relationships with
(WHAV 1) (GenBank accession no. BBV14756), which other associated viruses based on the NSP1 (NS5-
was detected from corn leaf aphid Rhopalosiphum like protein) are still hidden since the nodes of the
maidis in Japan (Kondo et al., 2020), has shown the dendrogram were supported with low bootstrap values
highest amino acid similarity (51%) by blastx search (Fig. 2B). On the contrary, NSP2 (NS3-like protein)
(Table 1). Segment 1 encodes NSP1, which is related formed a robust clade with Wuhan cricket virus, which
to flaviviral NS5-like protein, and the length of that was discovered from Conocephalus sp. in China (Shi et
in related viruses is about 3,000 nt (Shi et al., 2016b). al., 2016b), with confidential bootstrap supports (Fig.
Thus, quite partial sequence of NSP1 was acquired in 2C).
this examination (Fig. 2A). The contig name nC1_c7 Altogether, jingmenvirus detected in this study
was alike the putative glycoprotein (named VP1) of has novel virus features since it belongs to the
Shuangao insect virus 7 (SAIV 7), which was encoded jingmenvirus. Thus, this virus was tentatively
on segment 2 of the virus (Table 1). This sequence named Carajing virus (CaJV) by the initial words of
also is half the length of the segment since the length Culicoides arakawae jingmenvirus (Table 3).
of that in other viruses is about 2,000 nt (Fig. 2A)
(Shi et al., 2016b). On the contrary, the most part Analysis of the genome structure and phylogenetic
of the ORF of segments 3 and 4 were detected (Fig. characterization of a novel phasmavirus, Carapha
2A). After the sequence gaps on the contig nC1_c26 virus from C. arakawae
had been filled by sanger sequencing, the length was There are total of 6 contigs which are associated to
2,357 nt, similar to the segment 3 encoding NS3-like the phasmavirus detected in the C. arakawae sample.
protein (called NSP2) of WHAV 1 (Table 1). On the Four contigs (nC1_c10, nC1_c 22, nC1_c 38, and
contig nC1_c24, two ORFs (encoded proteins named nC1_c 39) have shown similarities to the L segment of
VP2 and VP3, respectively) were observed (Fig. 2A), phasmavirus (Table 1). To confirm if these sequences
and the first ORF was 30% identical to the putative are from a single virus or not, RT-PCR and sanger
capsid protein of Wuhan aphid virus 2 (WHAV 2) sequencing were carried out. The sequence gaps
(Table 1). Interestingly, the hepta-nucleotide sequences were filled, and the contigs were connected into one
(GGUUUUU) were contained at the end of the first sequence of with a length of 6,036 nt. The sequence
ORF (Fig. 2A) like the related viruses (Shi et al., 2016b; had 39% similarity to the RdRp of Ganda bee virus,
Ladner et al., 2016), indicating a potential ribosomal which was belonging to the genus Orthophasmavirus
frameshift signal. A prior study has shown that in the family Phasmaviridae (Schoonvaere et al.,
WHAV 1, WHAV 2, and SAIV 7 formed a cluster in a 2016). Both contig nC1_c36 and nC1_c21 are 26%
phylogenetic dendrogram (Shi et al., 2016b), indicating and 37% identical to the glycoprotein precursor of
that all contigs related to jingmenvirus detected were Wuhan mosquito virus 1 and nucleocapsid protein
Fig. 2. Genome structure of a novel jingmenvirus, CaJV, and phylogenetic dendrograms between CaJV and related viruses.
(A) A schematic illustration of the genome organization of CaJV. The gray dotted boxes and lines indicate the whole ORF and UTR,
respectively, expected based upon related viruses. The gray areas in the ORF as well as the black lines represent the sequenced regions
of this study. The numbers shown above indicate nucleotides that are sequenced, and protein names are shown below. A black arrow
in segment 4 indicates the -1 frameshifting site expected. The phylogenetic dendrogram was constructed based on the amino acid
conserved regions of the viral NS5-like protein (about 145 amino acids) by the maximum likelihood method with the use of the
LG+G + I model (B) and NS3-like protein (about 230 amino acids) by the maximum likelihood method with the use of LG+G +
I model (C). The percentage of replicate trees in which the related taxa are clustered together in the bootstrap test (1,000 replicates)
is manifested in the succeeding branches (Felsenstein, 1985). Jingmenviruses that are detected from the hematophagous insects are
represented using illustrations. Insect-associated jinmenviruses and tick-borne jingmenviruses are indicated by a framed rectangle
shown by solid and dotted lines, respectively. CaJV which is identified in this study is indicated by a black circle and is bold-faced.
Pegivirus (GB virus-A) and Hepacivirus (Hepatitis C virus) were utilized as an outgroup. The accession numbers of viruses used in this
analysis are shown in Appendix 1.232 Med. Entomol. Zool.
of Wuchang Cockroach Virus 1, respectively, both of
LC552040 (M segment)
GenBank accession No.
LC552039 (L segment)
LC552035 (segment 1)
LC552036 (segment 2)
LC552037 (segment 3)
LC552038 (segment 4)
LC552041 (S segment)
which are the members of the genus Orthophasmavirus
LC552043 (RNA 1)
LC552044 (RNA 2)
LC552042 (RNA 1)
(Table 1). These results indicated that M and S
segments were derived from the same virus as that of
LC552046
LC552045
the L segment.
The viral L protein is highly conserved among the
related viruses, and the longest resultant sequence
was acquired during the analysis (Fig. 3A). Therefore,
Orthophasmavirus Phasmaviridae
Dicistroviridae
based on the amino acid sequence of L protein,
Virus family
Nodaviridae
Nodaviridae
unclassified
unclassified
phylogenetic analysis was performed. The virus
detected from C. arakawae formed a clade with viruses
that are members of Orthophasmavirus (Fig. 3B). As
Alphanodavirus a result of the prior analyses, the virus seems to be a
Alphanodavirus
novel virus which belongs to a member of the genus
Jingmenvirus*
Abbreviation Virus genus
unclassified
Orthophasmavirus and tentatively named Carapha
Cripavirus
virus (CaPhV, Culicoides arakawae phasmavirus)
(Table 3).
Genetic and phylogenetic characterizations of novel
nodaviruses from C. arakawae and S. aureohirtum
CaNoV
CaPhV
SaNoV
Simulium aureohirtum associated A virus SAAV
SaCV
CaJV
Nodavirus-like sequences were discovered in three
contigs (18BF1_c27, 18BF1_c31, and 18BF1_c34)
Summary of viruses detected in this study.
from S. aureohirtum and all contigs shared 46‒61%
identities with the already known nodaviruses (Table
1). The sequence gap between the contigs 18BF1_c27
and 18BF1_c34 was filled by the sanger sequence, and
the resultant sequence length was 2,213 nt (Fig. 4A).
On the other hand, from C. arakawae, only one contig
(nC1_c11) related to nodavirus was detected, and the
sequence was the most related to the RdRp gene of
Carajing virus
Carapha virus
Carano virus
Macrobrachium rosenbergii nodavirus by blastx search
Sacri virus
Sano virus
(Table 1 and Fig. 4B). There was no sequence similar
Viruses
Name
to capsid protein (CP) of nodavirus detected from the
resultant contigs of C. arakawae. The phylogenetic
Table 3.
analysis based on the RdRp sequences encoded
13, 20 June, 2017
Collection date
on the RNA 1 has shown that both nodavirus-like
10 July, 2018
viruses detected in this study are found in the genus
Alphanodavirus in family Nodaviridae. The virus
from C. arakawae formed a clade with the Midge
associated nodavirus M1C9 which was detected in
Shinjuku, Tokyo, Japan
Shinjuku, Tokyo, Japan
C. impunctatus in Scotland (Modha et al., 2019) (Fig.
4C). In fact, the amino acid sequence of the Midge
associated nodavirus M1C9 was not deposited on the
No. of individuals Collection site
International Nucleotide Sequence Database (DDBJ/
EMBL/GenBank). Thus, the result of blastx search was
not reflected, such as this virus. Actually, the amino
acid sequence of the nC1_c11 shared 63.1% identity
to the translated sequence of the Midge associated
nodavirus M1C9 (GenBank accession no. LR701648)
30 females
3 females
(data no shown), indicating that the contig nC1_c11
was most related to the Midge associated nodavirus
M1C9. Elseways, the virus from S. aureohirtum had
*Proposed genus.
distinct positions to the already known nodaviruses
S. aureohirtum
C. arakawae
(Fig. 4C). Based on the novelty of the sequence, the
viruses were novel species in Alphanodavirus and
Species
Source
were tentatively named Sano virus (SaNoV, Simulium
aureohirtum nodavirus) and Carano virus (CaNoV,Vol. 71 No. 3 2020 233
Culicoides arakawae nodavirus), respectively. this study has novel virus features that are part of the
genus Cripavirus in Dicistroviridae. Thus, this virus
Genetic and phylogenetic analysis of a novel was tentatively named Sacri virus (SaCV, Simulium
cripavirus from S. aureohirtum aureohirtum cripavirus) (Table 3).
From S. aureohirtum, dicistrovirus-like three
contigs called 18BF1_c1, 18BF1_c3, and 18BF1_c5 Unclassified virus from S. aureohirtum
were found by blastx search (Table 1). All contigs Within the contig 18BF1_c37, several frames were
have shown highly average coverages compared opened, sharing 56‒70% identities to the hypothetical
with the others, showing that a high titer of the virus protein 2 of Wuhan insect virus 21 (Table 1).
presented in the specimen. Additionally, all contigs Subsequent to the resequencing on the contig, the 522
shared low sequence identities (39‒46%) to the nt resultant sequences were the same as the putative
corresponding region of the already known viruses RdRp of Linepithema humile C virus 1 (GenBank
(Table 1), indicating that these contigs were derived accession no. AXA52557) with 64% identity (data no
from a novel virus. Three contigs were connected into shown). In addition that, the sequence was also similar
one sequence by RT-PCR and sanger sequence, and to the RdRp sequences of the chronic bee paralysis
the resultant had a length of 8,528 nt, such as those virus (QEI22811) and anopheline-associated C virus
from the most part of the first ORF to the 3′ terminal (AGW51774) or the hypothetical protein 2 of Hubei
(Fig. 5A). Conserved protein domain search on the tombus-like virus 42 (APG76280) (data not shown).
NCBI Conserved Domains Database (Marchler-Bauer These associated viruses have not been categorized
et al., 2015) has shown that various protein domains into a virus taxon yet. Even though we detected only
[RNA_helicase (accession; pfam00910), RdRP_1 a short sequence of the virus, we have tentatively
(pfam00680), Waikav_capsid_1 (pfam12264), rhv_like designated the virus as Simulium aureohirtum
(cd00205), and CRPV_capsid (pfam08762)] were associated A virus (SAAV) based on the novelty of the
seen on the viral genome (Fig. 5A). Dicistrovirus sequence (Table 3).
has 2 IRESs at the 5′ untranslated region (UTR) and
Discussion
intergenic region (IGR) (Valles et al., 2017). The latter
is known as IGR-IRES as distinguished from the In this study, the RNA virome of Japanese
IRES of 5′ UTR. Even though the authoritative genus hematophagous Chironomoidea flies (C. arakawae
demarcation criteria have not been established, three and S. aureohirtum) were analyzed using the NGS.
virus genera (Aparavirus, Cripavirus, and Triatovirus) Even though C. arakawae is a major vector species
in the family Dicistroviridae have been categorized of chicken leucocytozoonosis due to L. caulleryi in
using their topological characteristics in the IGR- Japan (Sakai, 2007), both fly species have not been
IRES and phylogenetic analysis (Valles et al., 2017). reported to play a role for the arboviral vectors in
However, there is no conserved nucleotide within the nature to our knowledge. A total of six novel viruses
Pseudo-knot (PK) I in the IGR-IRES. PK structures belonging to various virus taxa were detected in
called PK I-III and several domains in the IGR-IRES this study. Recent studies outside Japan have shown
which are conserved among dicistroviruses were that biting midges and black flies harbor several
seen in the virus from S. aureohirtum (Fig. 5B). Two types of viruses by analyzing of their RNA and DNA
different structural types of Domain 3 in the IGR-IRES viromes (Temmam et al., 2015, 2016; Kraberger et al.,
(called Type I and Type II) were reported (Nakashima 2019; Modha et al., 2019). Particularly, Modha et al.
and Uchiumi, 2009), and the Type I structure of (2019) have been investigating the RNA virome of C.
Domain 3 was recognized in the virus (Fig. 5B). Triplet impunctatus Goetghebuer, which is a major nuisance
codon UCA was anticipated to be the start codon of human-biting midge and the vector of avian malaria
the second ORF encoding viral capsid protein (Fig. in Scotland, and found viruses that are part of at least
5B). 11 virus families including 7 novel viruses among the
To understand the phylogenetic relationships pooled 30 midges (Modha et al., 2019). This result
among already known dicistroviruses, the dendrogram showed that the diversity of viruses was higher than
was constructed based on the conserved amino acid what was observed in C. arakawae in this study. In
sequences of non-structural proteins of the viruses by that analysis, the Illumina Miseq system was used for
the maximum likelihood method (Fig. 5C). The virus the analysis, and 1.6‒2.1 million reads were acquired
detected from S. aureohirtum is placed in the cluster of (Modha et al., 2019). On the contrary, the total read
the genus Cripavirus in the family Dicistroviridae and number from the C. arakawae sample was 97,620 in
is related to Solenopsis invicta virus 6 and Bundaberg this study. This output data amount was about 16‒21
bee virus 1, both of which were found in the insects in times lower than that of a prior study by Modha et al.,
the order Hymenoptera (Roberts et al., 2018; Valles et (2019). Moreover, Modha et al. (2019) assessed the
al., 2019). total RNA from the midge samples with no nuclease
Altogether, the dicistrovirus-like virus found in treatment. Our previous studies have shown that the234 Med. Entomol. Zool.
Vol. 71 No. 3 2020 235
treatment by several types of nucleases was effective jingmenviruses is quite limited; for instance, the
for selective extraction of viral RNA from mosquitoes presence of the viruses in the saliva or salivary gland
as well as ticks (Faizah et al., 2020; Kobayashi et of mosquitoes was not specified. Thus, it is hard to
al., 2020). Therefore, nuclease treatment was also discuss the possibilities of their arboviral properties.
carried out in this study. In fact, the half volume of Further information on the insect-associated
RNase A was used in this study compared with the jingmenviruses will help in the understanding for the
case of mosquitoes and ticks in our previous studies potential as an emerging arbovirus.
mentioned previously due to the body size of biting Phasmavirus is a tri-segmented negative-stranded
midges and black flies being smaller than mosquitoes virus recently found from phantom midges (Ballinger
and adult ticks. Thus, further studies are needed to et al., 2014). Afterward, several phasmavirus-like
improve the system of virome analysis for small insects viruses were seen in various insects (Li et al., 2015; Shi
including biting midges. et al., 2016a). The new virus family Phasmaviridae was
A novel jingmenvirus, CaJV was discovered from C. established in the order Bunyavirales (Abudurexiti et
arakawae in this study. Jingmenvirus was first found al., 2019) and six viral genera (Feravirus, Inshuvirus,
from ticks in China, and succeeding related viruses Jonvirus, Orthophasmavirus, Sawastrivirus, and
have been recognized as emerging human infecting Wuhivirus) were acknowledged within the family.
tick-borne viruses (Qin et al., 2014; Emmerich et Orthophasmavirus is the most disparate genus in the
al., 2018; Jia et al., 2019; Wang et al., 2019). The family (Abudurexiti et al., 2019), and CaPhV seemed
virus usually has four viral segments, two of which to be a new member of this genus. The recent study has
encode NSPs and are genetically related to both NS3 shown the possibility that a novel Orthophasmavirus
and NS5 proteins of the genus Flavivirus (Qin et al., [Niukluk phanton virus (NUKV)] from a phantom
2014). Jingmenviruses have been found from various midge, Chaoborus americanus (Johannsen), has been
arthropods so far (Shi et al., 2016b) and were classified infecting the host continuously for millions of years
into two groups, tick-borne and insect-associated (Ballinger et al., 2019). Based on this knowledge,
jingmenviruses phylogenetically. CaJV formed a coevolution between host and virus easily occur.
clade with the insect-associated jingmenviruses in the However, our analysis has shown that CaPhV was
phylogenetic analyses in this study. Within the cluster phylogenetically distant from Kigluaik phantom virus
of insect-associated jingmenvirus, Guaico Culex virus and NUKV derived from phantom midges, which
(GCXV), Mole Culex virus (MoCV), and Wuhan flea are part of the same superfamily Chironomoidea
virus were found in hematophagous insects including as biting midges. This suggests that the virus may
mosquitoes and fleas (Shi et al., 2016b; Ladner et al., possibly be transmitted horizontally between different
2016; Amoa-Bosompem et al., 2020). Indeed, the insect taxa. Various biting midges are known to feed
infectivity of these viruses in humans or other animals on hemolymph of arthropods including Odonata and
has not been observed. In addition, it was reported Hymenoptera (Borkent and Spinelli, 2007). Perhaps,
that the viral replication of GCXV was seen in several the horizontal transmission of the phasmaviruses
mosquito cell lines but not in tick- or sand fly-derived may occur through hemolymph feeding of other
cells (Ladner et al., 2016). Moreover, the virus was not arthropods. To know the evolutionary relationships
seen in the progenies of experimentally infected adult between hosts and viruses, further virus discoveries
mosquitoes, showing that vertical transmission was are needed.
absent or there was a low occurrence in the previous Two different viruses that belong to the genus
study (Ladner et al., 2016). These viruses appear to Alphanodavirus in the family Nodaviridae were found
have opportunities to transmit to animals since GCXV in this study. The family name is derived from the
and MoCV were isolated from adult mosquitoes village name “Noda-mura” which is found in the
and CaJV was also found in adult biting midges. Chiba Prefecture in Japan, where Nodamura virus
However, the information on the insect-associated (NoV) was first isolated from Culex tritaeniorhynchus
Fig. 3. Genome organization of a novel phasmavirus, CaPhV, and phylogenetic characterization.
(A) The schematic illustration of the genome organization of CaPhV. The gray dotted open arrows and lines represent the entire ORF
and UTR, respectively, expected based on that of associated viruses. The gray areas in the ORF and black lines represent the regions
that are sequenced in this study. The italicized faces in each ORF indicate viral protein names: L protein (L), glycoprotein precursor
(GP), and nucleoprotein (N). The numbers shown above indicate sequenced nucleotides. (B) The phylogenetic dendrogram was
constructed based on the amino acid conserved regions of the viral L protein (about 1,000 amino acids) by the maximum likelihood
method with the use of the LG+G + I+F model. The percentage of replicate trees in which the associated taxa are clustered together
in the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein, 1985). Virus genera in the family Phasmaviridae
recognized by Abudurexiti et al. (2019) are indicated by symbols [Feravirus (black circle), Inshuvirus (open circle), Jonvirus (black
square), Orthophasmavirus (open square), Sawastrivirus (black triangle), and Wuhivirus (open triangle)]. CaPhV detected in this
study is indicated by a black arrow and is bold-faced. Hantaviridae viruses (Hainan oriental leaf-toed gecko virus, Hantaan virus,
Thottopalayam virus, and Wenling yellow goosefish virus) were used as an outgroup. The accession numbers of viruses used in this
analysis are shown in Appendix 1.236 Med. Entomol. Zool.
Fig. 4. Genome organization and phylogenetic relationship between SaNoV, CaNoV, and related nodaviruses.
Schematic illustration of the genome organization of both SaNoV (A) and CaNoV (B). The gray dotted open boxes and lines represent
the entire ORF and UTR, respectively, predicted based on that of related viruses. The gray areas in the ORF and black lines represent
the sequenced regions in this study. The characters in each ORF indicate viral protein names: RNA-dependent RNA polymerase
(RdRp) and CP. The numbers shown on the boxes above indicate sequenced nucleotides. (C) The phylogenetic dendrogram was
constructed based on the amino acid conserved regions of the viral RdRp (about 500 amino acids) by the maximum likelihood
method with the use of the LG+G model. The percentage of replicate trees in which the associated taxa are clustered together in
the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein, 1985). Virus genera in the family Nodaviridae
acknowledged by Hameed et al. (2019) are indicated by symbols: Alphanodavirus (black circle) and Betanodavirus (open circle).
Detected viruses in this study are indicated by black triangles and are bold-faced. The accession numbers of viruses used in this
analysis are shown in Appendix 1.Vol. 71 No. 3 2020 237
Fig. 5. Genetic characterization of a novel cripavirus, SaCV, and phylogenetic position among related viruses.
(A) Schematic illustration of the genome organization of SaCV. The gray boxes and black solid line represent the sequenced ORF
and UTR in this study, respectively. The dotted area indicates the unsequenced region. The dark gray areas in the ORF show the
regions that have conserved domains seen on the NCBI Conserved Domains Database. The numbers shown on the boxes above
indicate sequenced nucleotides. (B) Predicted secondary structure of the IGR-IRES of SaCV comprised of three main domains. Sites
of pseudoknots are designated by PK I, PK II, and PK III. Conserved nucleotides among IGR-IRES in dicistroviruses are represent by
circled. (C) The phylogenetic dendrogram was constructed based on the amino acid conserved regions of the non-structural protein
(about 540 amino acids) by the maximum likelihood method with the use of the LG+G + I model. The percentage of replicate trees
in which the related taxa are clustered together in the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein,
1985). Virus genera in the family Dicistroviridae recognized by Valles et al. (2017) are indicated by symbols: Cripavirus (black
circle) and Aparavirus (open circle). SaCV found in this study is indicated by black triangles and is bold-faced as well. The accession
numbers of viruses that are utilized in this analysis are shown in Appendix 1.238 Med. Entomol. Zool.
Giles mosquitoes (Hameed et al., 2019). NoV has have a variety of viruses which are as many as other
been categorized as an arbovirus since the virus can arboviral vectors including mosquitoes and ticks.
infect both mosquito and hamster cell lines with no Further RNA virome analysis for a variety of blood-
cytopathic effects as well as cause paralysis and death sucking insects will help to not only discover novel
in suckling mouse (reviewed in Kuwata, 2014). Even arboviruses but also understand novel importance for
though the antibodies against NoV were found in the arboviral vectors.
swine and herons, the isolation of the virus has not
Acknowledgements
been detailed from the 1970s onward (reviewed in
Kuwata, 2014). Other than NoV, there have been no This work was supported by grants-in-aid for
reports on mammal infectious nodaviruses so far since the Research Program on Emerging and Re-
the recognized virus members of Alphanodavirus were emerging Infectious Diseases from Japan Agency
isolated from non-blood-sucking insects including for Medical Research and Development (AMED),
beetles and armyworms in nature (Venter et al., and JSPS KAKENI Grant Numbers JP18K19220 and
2010). Recently, a novel nodavirus called hypnovirus JP20K15671. The authors would like to thank Enago
was found in the blood of the fruit bat Hypsignathus (www.enago.jp) for the English language review.
monstrosus Allen in the Republic of Congo (Bennett et
References
al., 2019), indicating the possibility that the virus has
an arboviral potential. Because of the detection from Abudurexiti, A., Adkins, S., Alioto, D., Alkhovsky, S. V., Avšič-
Županc, T., Ballinger, M. J., Bente, D. A., Beer, M., Bergeron, É.,
hematophagous insects, both CaNoV and SaNoV have
Blair, C. D., Briese, T., Buchmeier, M. J., Burt, F. J., Calisher, C. H.,
opportunities to infect animals. Further analyses are Cháng, C., Charrel, R. N., Choi, I. R., Clegg, J. C. S., de la Torre, J.
needed to understand their properties for arboviruses. C., de Lamballerie, X., Dèng, F., Di Serio, F., Digiaro, M., Drebot,
Viruses belonging to Dicistroviridae are insect- M. A., Duàn, X., Ebihara, H., Elbeaino, T., Ergünay, K., Fulhorst,
specific (Valles et al., 2017). However, detections of C. F., Garrison, A. R., Gāo, G. F., Gonzalez, J. J., Groschup, M.
novel dicistroviruses from the blood or organs of H., Günther, S., Haenni, A. L., Hall, R. A., Hepojoki, J., Hewson,
R., Hú, Z., Hughes, H. R., Jonson, M. G., Junglen, S., Klempa, B.,
human and bats have been reported recently (Phan Klingström, J., Kòu, C., Laenen, L., Lambert, A. J., Langevin, S.
et al., 2018; Bennett et al., 2019; Cordey et al., 2019; A., Liu, D., Lukashevich, I. S., Luò, T., Lǚ , C., Maes, P., de Souza,
Fumagalli et al., 2019), although their pathogenicities W. M., Marklewitz, M., Martelli, G. P., Matsuno, K., Mielke-
in humans or animals are still unknown. A report Ehret, N., Minutolo, M., Mirazimi, A., Moming, A., Mühlbach,
proposed that the novel dicistrovirus was found in H. P., Naidu, R., Navarro, B., Nunes, M. R. T., Palacios, G., Papa,
A., Pauvolid-Corrêa, A., Pawęska, J. T., Qiáo, J., Radoshitzky, S.
the blood of febrile Tanzanian children (Cordey et al.,
R., Resende, R. O., Romanowski, V., Sall, A. A., Salvato, M. S.,
2019). In fact, the seasonality detection of the virus Sasaya, T., Shěn, S., Shí, X., Shirako, Y., Simmonds, P., Sironi, M.,
was observed, and the authors proposed that the virus Song, J. W., Spengler, J. R., Stenglein, M. D., Sū, Z., Sūn, S., Táng,
is transmitted by some kinds of insects (Cordey et S., Turina, M., Wáng, B., Wáng, C., Wáng, H., Wáng, J., Wèi, T.,
al., 2019). Even though the diversity of dicistrovirus Whitfield, A. E., Zerbini, F. M., Zhāng, J., Zhāng, L., Zhāng, Y.,
has been quite limited in blood-sucking insects, a Zhang, Y. Z., Zhāng, Y., Zhou, X., Zhū, L. and Kuhn, J. H. 2019.
Taxonomy of the order Bunyavirales: update 2019. Arch. Virol.,
recent study has reported several dicistroviruses were
164: 1949‒1965.
detected from mosquitoes (Sadeghi et al., 2018). In Adler, P. H. and McCreadie, J. W. 2019. Black flies (Simuliidae). In:
this study, a novel dicistrovirus called SaCV was also Medical and Veterinary Entomology. Third Edition (ed. Mullen,
found in the black fly, which is not a popular vector G. R. and Durden, L. A.), pp. 237‒259, Academic Press, London,
for human pathogenic viruses so far. Thus, further United Kingdom.
virus discovery from a wide variety of hematophagous Amoa-Bosompem, M., Kobayashi, D., Murota, K., Faizah, A.
N., Itokawa, K., Fujita, R., Osei, J. H. N., Agbosu, E., Pratt, D.,
insects may show novel vectors for human viral Kimura, S., Kwofie, K. D., Ohashi, M., Bonney, J. H. K., Dadzie,
diseases. S., Sasaki, T., Ohta, N., Isawa, H., Sawabe, K. and Iwanaga,
In conclusion, there were a total of six novel RNA S. 2020. Entomological assessment of the status and risk of
viruses in C. arakawae and S. aureohirtum collected mosquito-borne arboviral transmission in Ghana. Viruses, 12:
in Tokyo, showing that RNA virome analysis utilizing 147.
NGS was an efficient method for studying and Atoni, E., Zhao, L., Karungu, S., Obanda, V., Agwanda, B., Xia, H.
and Yuan, Z. 2019. The discovery and global distribution of novel
understanding the diversity of the virome of small mosquito-associated viruses in the last decade (2007‒2017). Rev.
hematophagous flies. The results have also revealed Med. Virol., 29: e2079.
that C. arakawae and S. aureohirtum harbor various Ballinger, M. J., Bruenn, J. A., Hay, J., Czechowski, D. and Taylor, D.
types of viruses. This study is the first RNA virome J. 2014. Discovery and evolution of bunyavirids in arctic phantom
report of the black fly and a third report of the midges and ancient bunyavirid-like sequences in insect genomes.
J. Virol., 88: 8783‒8794.
RNA virome analysis of biting midges in the world.
Ballinger, M. J. and Taylor, D. J. 2019. Evolutionary persistence
Thousands of species of blood-sucking Chironomoidea of insect bunyavirus infection despite host acquisition and
flies are present on the earth, and the role of most expression of the viral nucleoprotein gene. Virus Evol., 5: vez017.
of these species in the transmission of arboviruses Bennett, A. J., Bushmaker, T., Cameron, K., Ondzie, A., Niama, F.
remains unknown. This study has shown that they R., Parra, H. J., Mombouli, J. V., Olson, S. H., Munster, V. J. andVol. 71 No. 3 2020 239 Goldberg, T. L. 2019. Diverse RNA viruses of arthropod origin in Harvey, E., Rose, K., Eden, J. S., Lo, N., Abeyasuriya, T., Shi, M., the blood of fruit bats suggest a link between bat and arthropod Doggett, S. L. and Holmes, E. C. 2019a. Extensive diversity of viromes. Virology, 528: 64‒72. RNA viruses in Australian ticks. J. Virol., 93: e01358-18. Brinkmann, A., Dinçer, E., Polat, C., Hekimoğlu, O., Hacıoğlu, S., Harvey, E., Rose, K., Eden, J. S., Lawrence, A., Doggett, S. L. Földes, K., Özkul, A., Öktem, İ. M. A., Nitsche, A. and Ergünay, and Holmes, E. C. 2019b. Identification of diverse arthropod K. 2018. A metagenomic survey identifies Tamdy orthonairovirus associated viruses in native Australian fleas. Virology, 535: 189‒ as well as divergent phlebo-, rhabdo-, chu-and flavi-like viruses 199. in Anatolia, Turkey. Ticks Tick Borne Dis., 9: 1173‒1183. Jia, N., Liu, H. B., Ni, X. B., Bell-Sakyi, L., Zheng, Y. C., Song, J. L., Borkent, A. and Spinelli, G. R. 2007. Neotropical Ceratopogonidae Li, J., Jiang, B. G., Wang, Q., Sun, Y., Wei, R., Yuan, T. T., Xia, (Diptera: Insecta). In: Aquatic Biodiversity in Latin America. Vol. L. Y., Chu, Y. L., Wei, W., Li, L. F., Ye, J. L., Lv, Q. Y., Cui, X. M., 4. (ed. Adis, J., Arias, J. R., Rueda-Delgado, G. and Wnatzen, K. Guan, Y., Tong, Y. G., Jiang, J. F., Lam, T. T. and Cao, W. C. 2019. M.). pp. 1‒198, Pensoft, Sofia, Bulgaria. Emergence of human infection with Jingmen tick virus in China: Bouquet, J., Melgar, M., Swei, A., Delwart, E., Lane, R. S. and Chiu, A retrospective study. EBioMedicine, 43: 317‒324. C. Y. 2017. Metagenomic-based surveillance of Pacific Coast tick Kraberger, S., Schmidlin, K., Fontenele, R., Walters, M. and Varsani, Dermacentor occidentalis identifies two novel bunyaviruses and A. 2019. Unravelling the single-stranded DNA virome of the New an emerging human ricksettsial pathogen. Sci. Rep., 7: 12234. Zealand blackfly. Viruses, 11: 532. Castresana, J. 2000. Selection of conserved blocks from multiple Katoh, K., Kuma, K. I., Toh, H. and Miyata, T. 2005. MAFFT alignments for their use in phylogenetic analysis. Mol. Biol. Evol., version 5: Improvement in accuracy of multiple sequence 17: 540‒552. alignment. Nucleic Acids Res., 33: 511‒518. Cordey, S., Laubscher, F., Hartley, M. A., Junier, T., Pérez-Rodriguez, Katoh, K., Rozewicki, J. and Yamada, K. D. 2019. MAFFT online F. J., Keitel, K., Vieille, G., Samaka, J., Mlaganile, T., Kagoro, F., service: Multiple sequence alignment, interactive sequence choice Boillat-Blanco, N., Mbarack, Z., Docquier, M., Brito, F., Eibach, and visualization. Brief. Bioinform., 20: 1160‒1166. D., May, J., Sothmann, P., Aldrich, C., Lusingu, J., Tapparel, C., Kobayashi, D., Isawa, H., Ejiri, H., Sasaki, T., Sunahara, T., Futami, D’Acremont, V. and Kaiser, L. 2019. Detection of dicistroviruses K., Tsuda, Y., Katayama, Y., Mizutani, T., Minakawa, N., Ohta, RNA in blood of febrile Tanzanian children. Emerg. Microbes N. and Sawabe, K. 2016. Complete genome sequencing and Infect., 8: 613‒623. phylogenetic analysis of a Getah virus strain (genus Alphavirus, de Souza, W. M., Fumagalli, M. J., Torres Carrasco, A. O., Romeiro, family Togaviridae) isolated from Culex tritaeniorhynchus M. F., Modha, S., Seki, M. C., Gheller, J. M., Daffre, S., Nunes, M. mosquitoes in Nagasaki, Japan in 2012. Vector Borne Zoonotic R. T., Murcia, P. R., Acrani, G. O. and Figueiredo, L. T. M. 2018. Dis., 16: 769‒776. Viral diversity of Rhipicephalus microplus parasitizing cattle in Kobayashi, D., Isawa, H., Fujita, R., Murota, K., Itokawa, K., southern Brazil. Sci. Rep., 8: 16315. Higa, Y., Katayama, Y., Sasaki, T., Mizutani, T., Iwanaga, S., Durden, L. A. and Mullen, G. R. 2019. Arthropod-borne diseases. Ohta, N., Garcia-Bertuso, A. and Sawabe, K. 2017. Isolation In: Medical and Veterinary Entomology. Third Edition (ed. and characterization of a new iflavirus from Armigeres spp. Mullen, G. R. and Durden, L. A.), pp. 6-7. Academic Press, San mosquitoes in the Philippines. J. Gen. Virol., 98: 2876‒2881. Diego, CA. Kobayashi, D., Murota, K., Fujita, R., Itokawa, K., Kotaki, A., Emmerich, P., Jakupi, X., von Possel, R., Berisha, L., Halili, B., Moi, M. L., Ejiri, H., Maekawa, Y., Ogawa, K., Tsuda, Y., Sasaki, Günther, S., Cadar, D., Ahmeti, S. and Schmidt-Chanasit, J. 2018. T., Kobayashi, M., Takasaki, T., Isawa, H. and Sawabe, K. 2018. Viral metagenomics, genetic and evolutionary characteristics of Dengue virus infection in Aedes albopictus during the 2014 Crimean-Congo hemorrhagic fever orthonairovirus in humans. autochthonous dengue outbreak in Tokyo Metropolis, Japan. Am. Kosovo. Infect. Genet. Evol., 65: 6‒11. J. Trop. Med. Hyg., 98: 1460‒1468. Faizah, A. N., Kobayashi, D., Isawa, H., Amoa-Bosompem, M., Kobayashi, D., Murota, K., Itokawa, K., Ejiri, H., Amoa-Bosompem, Murota, K., Higa, Y., Futami, K., Shimada, S., Kim, K. S., Itokawa, M., Faizah, A. N., Watanabe, M., Maekawa, Y., Hayashi, T., K., Watanabe, M., Tsuda, Y., Minakawa, N., Miura, K., Hirayama, Noda, S., Yamauchi, T., Komagata, O., Sawabe, K. and Isawa, K. and Sawabe, K. 2020. Deciphering the virome of Culex vishnui H. 2020. RNA virome analysis of questing ticks from Hokuriku subgroup mosquitoes, the major vectors of Japanese encephalitis, District, Japan, and the evolutionary dynamics of tick-borne in Japan. Viruses, 12: 264. phleboviruses. Ticks Tick Borne Dis., 11: 101364. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach Kondo, H., Fujita, M., Hisano, H., Hyodo, K., Andika, I. B. and using the bootstrap. Evolution, 39: 783‒791. Suzuki, N. 2020. Virome analysis of aphid populations that infest Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrigenhoek, R. 1994. the barley field: The discovery of two novel groups of nege/kita- DNA primers for amplification of mitochondrial cytochrome c like viruses and other novel RNA viruses. Front. Microbiol., 11: oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. 509. Biol. Biotechnol., 3: 294‒299. Kuwata, R. 2014. Virus species associated with mosquito Culex Fukuda, M., Otsuka, Y., Uni, S., Bain, O. and Takaoka, H. 2010. tritaeniorhynchus Giles. Med. Entomol. Zool., 65: 1‒11 (In Molecular identification of infective larvae of three species Japanese with English abstract). of Onchocerca found in wild-caught females of Simulium Ladner, J. T., Wiley, M. R., Beitzel, B., Auguste, A. J., Dupuis, A. bidentatum in Japan. Parasite, 17: 39‒45. P. 2nd, Lindquist, M. E., Sibley, S. D., Kota, K. P., Fetterer, D., Fukuda, M., Uni, S., Igari, T., Utsumi, Y., Otsuka, Y., Nakatani, J., Eastwood, G., Kimmel, D., Prieto, K., Guzman, H., Aliota, M. Uga, S., Hara, T., Hasegawa, H. and Takaoka, H. 2019. Human T., Reyes, D., Brueggemann, E. E., St John, L., Hyeroba, D., case of Onchocerca dewittei japonica infection in Fukushima, Lauck, M., Friedrich, T. C., O’Connor, D. H., Gestole, M. C., Northeastern Honshu, Japan. Parasitol. Int., 72: 101943. Cazares, L. H., Popov, V. L., Castro-Llanos, F., Kochel, T. J., Fumagalli, M. J., de Souza, W. M., de Araujo, J., Modha, S., Queiroz, Kenny, T., White, B., Ward, M. D., Loaiza, J. R., Goldberg, T. L., L. H., Durigon, E. L., Murcia, P. R. and Figueiredo, L. T. M. 2019. Weaver, S. C., Kramer, L. D., Tesh, R. B. and Palacios, G. 2016. Krykféie dicistrovirus: A novel dicistrovirus in velvety free-tailed A multicomponent animal virus isolated from mosquitoes. Cell bats from Brazil. Infect. Genet. Evol., 75: 104036. Host Microbe, 20: 357‒367. Hameed, A. S., Ninawe, A. S., Nakai, T., Chi, S. C. and Johnson, K. Li, C. X., Shi, M., Tian, J. H., Lin, X. D., Kang, Y. J., Chen, L. J., Qin, L. 2019. ICTV virus taxonomy profile: Nodaviridae. J. Gen. Virol., X. C., Xu, J., Holmes, E. C. and Zhang, Y. Z. 2015. Unprecedented 100: 3‒4. genomic diversity of RNA viruses in arthropods reveals the
240 Med. Entomol. Zool. ancestry of negative-sense RNA viruses. eLife, 4: e05378. 2018. The evolutionary history of vertebrate RNA viruses. Nature, Marchler-Bauer, A., Derbyshire, M. K., Gonzales, N. R., Lu, S., 556: 197‒202. Chitsaz, F., Geer, L. Y., Geer, R. C., He, J., Gwadz, M., Hurwitz, D. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. I., Lanczycki, C. J., Lu, F., Marchler, G. H., Song, J. S., Thanki, N., 2013. MEGA6: Molecular evolutionary genetics analysis version Wang, Z., Yamashita, R. A., Zhang, D., Zheng, C. and Bryant, S. 6.0. Mol. Biol. Evol., 30: 2725‒2729. H. 2015. CDD: NCBI’s conserved domain database. Nucleic Acids Temmam, S., Monteil-Bouchard, S., Sambou, M., Aubadie-Ladrix, Res., 43: D222‒D226. M., Azza, S., Decloquement, P., Khalil, J. Y. B., Baudoin, J., Jardot, Modha, S., Hughes, J., Bianco, G., Ferguson, H., Helm, B., Tong, P., Robert, C., Scola, B., Mediannikov, O., Raoult, D. and Desnues, L., Wilkie, G., Kohl, A. and Schnettler, E. 2019. Metaviromics C. 2015. Faustovirus-like asfarvirus in hematophagous biting reveals unknown viral diversity in the biting midge Culicoides midges and their vertebrate hosts. Front. Microbiol., 6: 1406. impunctatus. Viruses, 11: 865. Temmam, S., Monteil-Bouchard, S., Robert, C., Baudoin, J., Moutailler, S., Popovici, I., Devillers, E., Vayssier-Taussat, M. Sambou, M., Aubadie-Ladrix, M., Labas, N., Raoult, D., and Eloit, M. 2016. Diversity of viruses in Ixodes ricinus, and Mediannikov, O. and Desnues, C. 2016. Characterization of characterization of a neurotropic strain of Eyach virus. New viral communities of biting midges and identification of novel Microbes New Infect., 11: 71‒81. thogotovirus species and rhabdovirus genus. Viruses, 8: 77. Mullen, G. R. and Murphree, C. S. 2019. Biting Midges Temmam, S., Chrétien, D., Bigot, T., Dufour, E., Petres, S., (Ceratopogonidae). In: Medical and Veterinary Entomology Desquesnes, M., Devillers, E., Dumarest, M., Yousfi, L., Third Edition (ed. Mullen, G. R. and Durden, L. A.), pp. 213‒236, Jittapalapong, S., Karnchanabanthoeng, A., Chaisiri, K., Academic Press, London, United Kingdom. Gagnieur, L., Cosson, J. F., Vayssier-Taussat, M., Morand, S., Nakashima, N. and Uchiumi, T. 2009. Functional analysis of Moutailler, S. and Eloit, M. 2019. Monitoring silent spillovers structural motifs in dicistroviruses. Virus Res., 139: 137‒147. before emergence: A pilot study at the tick/human interface in Otsuka, Y., Aoki, C., Saito, K., Hadi, U. K., Suzuki, H. and Takaoka, Thailand. Front. Microbiol., 10: 2315. H. 2001. Phylogenetic analyses of a blackfly subgenus Simulium Tokarz, R., Williams, S. H., Sameroff, S., Leon, M. S., Jain, K. and (Nevermannia) based on mitochondrial 16S ribosomal RNA gene Lipkin, W. I. 2014. Virome analysis of Amblyomma americanum, sequences. Jpn. J. Trop. Med. Hyg., 29: 261‒266. Dermacentor variabilis, and Ixodes scapularis ticks reveals novel Phan, T. G., del Valle Mendoza, J., Sadeghi, M., Altan, E., Deng, X. highly divergent vertebrate and invertebrate viruses. J. Virol., 88: and Delwart, E. 2018. Sera of Peruvians with fever of unknown 11480‒11492. origins include viral nucleic acids from non-vertebrate hosts. Tokarz, R., Sameroff, S., Tagliafierro, T., Jain, K., Williams, S. H., Virus Genes, 54: 33‒40. Cucura, D. M., Rochlin, I., Monzon, J., Carpi, G., Tufts, D., Diuk- Qin, X. C., Shi, M., Tian, J. H., Lin, X. D., Gao, D. Y., He, J. Wasser, M., Brinkerhoff, J. and Lipkin, W. I. 2018. Identification R., Wang, J. B., Li, C. X., Kang, Y. J., Yu, B., Zhou, D. J., Xu, J., of novel viruses in Amblyomma americanum, Dermacentor Plyusnin, A., Holmes, E. C. and Zhang, Y. Z. 2014. A tick-borne variabilis, and Ixodes scapularis ticks. MSphere, 3: e00614‒e00617. segmented RNA virus contains genome segments derived from Tsuda, Y. and Hayashi, T. 2014. Results of mosquito surveillance unsegmented viral ancestors. Proc. Natl. Acad. Sci. U.S.A., 111: using dry-ice traps from 2003 to 2013 at the National Institute of 6744‒6749. Infectious Diseases, Tokyo, Japan. Med. Entomol. Zool., 65: 131‒ Roberts, J. M., Anderson, D. L. and Durr, P. A. 2018. Metagenomic 137. analysis of Varroa-free Australian honey bees (Apis mellifera) Valles, S. M., Chen, Y., Firth, A. E., Guérin, D. M. A., Hashimoto, shows a diverse Picornavirales virome. J. Gen. Virol., 99: 818‒826. Y., Herrero, S., de Miranda, J. R., Ryabov, E. and ICTV Report Rudbeck, L. and Dissing, J. 1998. Rapid, simple alkaline extraction of Consortium. 2017. ICTV virus taxonomy profile: Dicistroviridae. human genomic DNA from whole blood, buccal epithelial cells, J. Gen. Virol., 98: 355‒356. semen and forensic stains for PCR. Biotechniques, 25: 588‒592, 592. Valles, S. M. and Rivers, A. R. 2019. Nine new RNA viruses Sadeghi, M., Altan, E., Deng, X., Barker, C. M., Fang, Y., Coffey, associated with the fire ant Solenopsis invicta from its native L. L. and Delwart, E. 2018. Virome of >12 thousand Culex range. Virus Genes, 55: 368‒380. mosquitoes from throughout California. Virology, 523: 74‒88. Venter, P. A., Jovel, J. and Schneemann, A. 2010. Insect nodaviruses. Sakai, T. 2007. Current status and countermeasures of Chicken In: Insect Virology (ed. Asgari, S. and Johnson, K.), pp. 251‒282. leucocytozoonosis in Japan. J. Anim. Protozooses, 22: 14‒21 (In Caister Academic Press, Norfolk, UK. Japanese with English abstract). Wang, Z. D., Wang, B., Wei, F., Han, S. Z., Zhang, L., Yang, Z. T., Sato, Y., Tamada, A., Mochizuki, Y., Nakamura, S., Okano, E., Yan, Y., Lv, X. L., Li, L., Wang, S. C., Song, M. X., Zhang, H. J., Yoshida, C., Ejiri, H., Omori, S., Yukawa, M. and Murata, K. Huang, S. J., Chen, J., Huang, F. Q., Li, S., Liu, H. H., Hong, J., Jin, 2009. Molecular detection of Leucocytozoon lovati from probable Y. L., Wang, W., Zhou, J. Y. and Liu, Q. 2019. A new segmented vectors, black flies (Simuliudae) collected in the alpine regions of virus associated with human febrile illness in China. N. Engl. J. Japan. Parasitol. Res., 104: 251‒255. Med., 380: 2116‒2125. Schoonvaere, K., De Smet, L., Smagghe, G., Vierstraete, A., Wiegmann, B. M., Trautwein, M. D., Winkler, I. S., Barr, N. B., Braeckman, B. P. and de Graaf, D. C. 2016. Unbiased RNA Kim, J. W., Lambkin, C., Bertone, M. A., Cassel, B. K., Bayless, shotgun metagenomics in social and solitary wild bees detects K. M., Heimberg, A. M., Wheeler, B. M., Peterson, K. J., Pape, associations with eukaryote parasites and new viruses. PLoS One, T., Sinclair, B. J., Skevington, J. H., Blagoderov, V., Caravas, J., 11: e0168456. Kutty, S. N., Schmidt-Ott, U., Kampmeier, G. E., Thompson, F. C., Shi, M., Lin, X. D., Tian, J. H., Chen, L. J., Chen, X., Li, C. X., Qin, Grimaldi, D. A., Beckenbach, A. T., Courtney, G. W., Friedrich, X. C., Li, J., Cao, J. P., Eden, J. S., Buchmann, J., Wang, W., Xu, J., M., Meier, R. and Yeates, D. K. 2011. Episodic radiations in the fly Holmes, E. C. and Zhang, Y. Z. 2016a. Redefining the invertebrate tree of life. Proc. Natl. Acad. Sci. U.S.A., 108: 5690‒5695. RNA virosphere. Nature, 540: 539‒543. Xiong, B. and Kocher, T. D. 1991. Comparison of mitochondrial Shi, M., Lin, X. D., Vasilakis, N., Tian, J. H., Li, C. X., Chen, L. J., DNA sequences of seven morphospecies of black flies (Diptera: Eastwood, G., Diao, X. N., Chen, M. H., Chen, X., Qin, X. C., Simuliidae). Genome, 34: 306‒311. Widen, S. G., Wood, T. G., Tesh, R. B., Xu, J., Holmes, E. C. and Yanase, T. 2009. Arboviruses transmitted by Culicoides biting Zhang, Y. Z. 2016b. Divergent viruses discovered in arthropods midges to live-stock. Med. Entomol. Zool., 60: 195‒212 (In and vertebrates revise the evolutionary history of the Flaviviridae Japanese with English abstract). and related viruses. J. Virol., 90: 659‒669. Zuker, M. 2003. Mfold web server for nucleic acid folding and Shi, M., Lin, X. D., Chen, X., Tian, J. H., Chen, L. J., Li, K., Wang, hybridization prediction. Nucleic Acids Res., 31: 3406‒3415. W., Eden, J. S., Shen, J. J., Liu, L., Holmes, E. C. and Zhang, Y. Z.
You can also read
