Genotyping of Human Adenovirus Causing Conjunctivitis and Correlation to Age and Gender in Al-Diwaniyah Province in Iraq - Open Journal Systems
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Indian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2 2893
Genotyping of Human Adenovirus Causing Conjunctivitis and
Correlation to Age and Gender in Al-Diwaniyah Province in
Iraq
Muntadher A. Hawass1, Wisam S. Alrubaye2, Haider Aswad Layikh3
1
Research Scholar, Corresponding Author, University of Al-Qadisiyah/ College of
Medicine, Iraq , 2Asst. Professor, University of Al-Qadisiyah , College of Medicine, Iraq,
3Asst. Professor, University of Al-Qadisiyah , College of Medicine, Iraq
Abstract
Human conjunctival swab samples from 108 patients were male 58 (53.7 %) and female 50 (46.3 %) with
a male to female ratio of 1.16:1.for the period from October 2019 to February 2020. Patients were selected
according to clinical diagnosis by a specialist ophthalmologist. Diagnosis was confirmed by real time PCR
that showed 84 patients (77.8%) with positive result; %).The study groups were divided into groups with
different age and gender. Those aged 15–40 years had much likely to be infected than those aged 55 years.
Positive rate in mild cases was 8 (26.7 %), in moderate cases was 40(95.2 %) and in severe cases was 36
(100.0 %). Phylogenetic tree analysis of local conjunctivitis based on the Hexon gene partial sequence of
human adenovirus show genetic relation to human adenovirus 8 and 56 hexon gene .
Key words: Human adenovirus, conjunctivitis, hexon gene, severity
were classified to seven (A-G) based on phylogenetic
Introduction
analysis, genetic organization, growth characteristics
Worldwide, millions of people are affected every and oncogenicity, including over 70 stereotypes and 90
year via acute conjunctivitis. Chemicals, allergens or serotypes (4-6) .
infectious agent can cause the disease, but the incidence
and prevalence of case are caused by viruses and bacteria. Human adenovirus types D -8,9,13,19,33 , 37,53,56
Viral conjunctivitis is responsible for about 80% of all and 64 are common types that cause conjunctivitis (1,7) .
cases of acute conjunctivitis (1) . The transmission of this extremely contagious infectious
disease is facilitated by the ability of viral particles to
Viral conjunctivitis are considered as the most survive for weeks on dry surfaces and by the fact that
common external eye infection and Human adenovirus for many days before clinical features are clearly visible,
(HAdVs) the biggest non-enveloped double-stranded viral shedding may occur. Transmission is usually
DNA virus being the most common (90%) causal agent. through contact with respiratory or eye secretions, which
In areas such as workplaces (including hospitals), include contaminated fomites, such as towels (2) .
schools and swimming pools, it can occur sporadically
or in epidemic (2, 3) . These infections are relatively mild in immune
competents patients, but could be severe (can be life
Human adenovirus are members of the Adenoviridae threatening) in immune compromised patients (6, 8, 9) .
family and the Mastadenovirus genus. Human adenovirus
Typically, the clinical disease lasts 7-21 days and
is usually self-limited. Transmission via contaminated
Corresponding Author:
surfaces, equipment, eye drops, or hands is primarily
Muntadher A. Hawass
through contact with infected ocular secretions. Several
Research Scholar, University of Al-Qadisiyah / College
of Medicine, Iraq, E-mail : mmonn1112@gmail.com days before symptoms progress about 14 days after
symptoms begin an individual may become infectious2894 Indian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2
(10) . and determining the degree of severity. Conjunctival
swabs were taken for 108 Patient 50 (46.3%) female, 58
Symptoms of human adenovirus (HAdV)
(53.7) male and kept in VTM
conjunctivitis include ocular pain, sensation of
foreign body, excessive lacrimation, eyelid oedema, Collection of Samples
lymphadenopathy, conjunctival hyperemia and follicles,
One hundred and eight conjunctival swabs were
chemosis, keratitis (2)
taken from fornices with sterile dacron swabs of viral
Prevention and control transmission of HAdVs transport media without using topical anesthesia from
include : infected eye or both infected eyes if bilateral infection
of the patients noticed. The Dacron swabs including
Adequate hands washing with soap and water,
inside tubes of transport media were transported in a bag
especially after contact with an person with a signs of
contains ice packs and then stored at -80 ℃ until they
flu-like illness, when coughing or sneezing, cover mouth
were used in qPCR and conventional PCR techniques.
and nose, avoid touching eyes, nose or mouth with
unwashed hands, avoid close contact with sick people Molcular method
and stay at home when people are sick themselves (11,
12) . DNA extraction were done from each patient
sample that were DNA-Sorb-B nucleic acid extraction
Materials and Methods kit® was used according to the instruction manual of a
manufacturing company Real-time PCR was carried out
Patient’s
for detection of Human Adenovirus in DNA by using
Patients were selected after examination by an the designed primers specific for hexon gene shown in
experienced ophthalmologist for human conjunctivitis table (1)
Primer Sequence Product size
Forward GGTTCCTCGTCCAGATGCTC
Human Adenovirus hexon primer 114 bp
Reverse TGCTCATGGGCTGGAAGTTG
Table 1. : Primer for Real-time PCR
DNA Sequencing Method
DNA sequencing process was accomplished for detection Human Adenovirus genotypes in suspected of
positive swabs samples by Real-time PCR process based on phylogenetic tree analysis of hexon gene that amplified
by conventional PCR method and the primer shown in table (2) . Phylogenetic tree analysis was performed based on
NCBI-BLAST alignment identification and neighbor distance phylogenetic tree analysis (MEGA X).
Table 2. : Conventional PCR primer
Primer Sequence Product Size
Forward GGTTCCTCGTCCAGATGCTC
Hexon PCR 529 bp
Reverse AGGTAGACGGCCTCGATGACIndian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2 2895
Result
Age and Gender
According to table (3), the highest percentage of age subgroups was recorded in those with ages between (30-39)
yeras (22.2 %); whereas, female patients were (53.7%) .
Table 3. : Descriptive statistics (frequency and percentage) of patients, according to
age and gender
Subgroups Frequency Percentage
0.5-9 12 11.1
10-19 20 18.5
20-29 22 20.4
30-39 24 22.2
Age (Years) 40-49 16 14.8
50-59 8 7.4
60-69 2 1.9
70-80 4 3.7
Male 50 46.3
Gender
Female 58 53.7
Positive 84 77.8
PCR Result
Negative 24 22.2
Real time PCR
The frequency distribution of patients according to Rt-PCR results is shown in table 3. Positive results were
recorded in 84 patients (77.8 %); whereas, negative results were recorded in 24 patients (22.2 %). The mean age of
patients with positive results was 28.89 ± 16.23 years while the mean age of patients with negative PCR was 36.17
± 22.17 years (figure 1) .
Figure 1 : Q-PCR amplification and melt curve for the study sample2896 Indian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2
Table 4: Association between severity of disease and positive PCR results
Severity
PCR
Mild Moderate Severe
n = 30 n = 42 n = 36
Positive 8 (26.7 %) 40 (95.2 %) 36 (100.0 %)
Negative 22 (73.3 %) 2 (4.8 %) 0 (0.0 %)
P-value < 0.001 C
Mild versus moderate HS
P-value < 0.001 C
Mild versus severe HS
P-value 1.000 F
Moderate versus moderate NS
n: number of cases; C: Chi-square test; F: Fischer exact test; HS: highly significant at P ≤ 0.01; NS: not
significant at P > 0.05
Figure 2 : phylogenetic tree analysis based on hexon gene partial sequence of in local conjunctivitis of
human adenovirus
Phylogenetic tree analysis based on Hexon adenovirus 56 isolate DL06 hexon gene (KF029434.1).
gene partial sequence in local conjunctivitis Human
adenovirus PCR positive sample that common used Discussion
for genotyping identification is shown in figure 2. The
The different distribution of age group may be
phylogenetic tree was constructed using Maximum
Likelihood method and UPGMA tree method in explained by different levels of protective antibodies and
(MEGA X version). Human Adenovirus conjunctivitis the possible variation in their exposure risk according
isolate No.1, No.3, No.4, No.5, No.6, No.8, No.9, to the different social activity levels and occupational
No.10 were showed genetic related to NCBI-BLAST risk. Patients with HAdV conjunctivitis .Those aged
Human adenovirus 8 gene for hexon (AB330089.1) and 15–40 years had much likely to be infected than those
Human Adenovirus conjunctivitis isolate No.2and No.7 aged 55 years. However, that because younger age more
were showed genetic related to NCBI-BLAST Human active than elderly, also the health education levelsIndian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2 2897
should be taken into consideration, and this opinion is found HAdV-4, HAdV-37 and HAdV-53 were the most
agreed with (11, 13). common types in Beijing, China (13).
In present study the association between gender Conclusions
of patients and PCR results was insignificant and the
Finally, it was expected that there were at least
male to female ratio of 1.16:1 The correlation between
three genotypes of Human Adenovirus were circulating
positive result in q-PCR and severity is highly significant
in Iraqi environment, and probably other genotypes
in severe case while decrease in moderate case and lastly
may cause infections due to the fact we were carried a
mild case can be explained by many reasons such as :
sequencing for only 10 samples of total 108 of positive
IFN-alpha type I effected by EA1and E1B protein cases.
play role in this is process because this protein is
Ethical Clearance : Taken from University of Al-
immediately expressed (after an hour of infection) that
Qadisiyah ethical committee
lead to block expiration of IFN-alpha type I , also ,
E1A blocks the induction of MHC class II genes and Source of Funding : Self
this involves a block in transcription complex formation
that affected on severity of disease. while E1B works by Conflict of Interest : Nil
interfering with the induction of IFN genes .
References
A study found that toll like receptor (TLR) and 1. Johansson E, Caraballo R, Mistry N, Zocher G, &
proteins of HAdVs play important role in stimulation Qian W, Andersson CD, Hurdiss DL, Chandra N,
of immune system and EAI ,E1A, E1B, E3, and E4 Thompson R, Frängsmyr L, Stehle T, Arnberg N,
attenuated innate response (14) . Elofsson M. Pentavalent Sialic Acid Conjugates
Block Coxsackievirus A24 Variant and Human
One study found that E1A expression in infected
Adenovirus Type 37-Viruses That Cause Highly
conjunctival cells is causing repression of the host IFN
Contagious Eye Infections. ACS Chem Biol. 2020
response allowing increased expression of the viral early 15(10):2683-2691.
gene, which, in turn, results in increased viral replication
(8).
2. Salmon, J.K. and J.B. Jack, Kanski’s Clinical
Ophthalmology International Edition: A Systematic
Another study found that when DNA of AdVs Approach. 2020: Elsevier Health Sciences.
is detected in TLR or in plasmacytoid dendritic cells 3. Balasopoulou A, Κokkinos P, Pagoulatos D, Plotas
there was an increase stimulation for the production of P, & Makri OE, Georgakopoulos CD, Vantarakis
interferon alpha (15) A. Α molecular epidemiological analysis of
adenoviruses from excess conjunctivitis cases.
One study concluded that viral conjunctivitis affects BMC Ophthalmol. 2017 ; 17(1):51.
patients in all age groups regardless of ocular history 4. Espínola EE, Barrios JC, Russomando G, Mirazo
(16).
The researcher suggested that proper hygienic and S, & Arbiza J. Computational analysis of a species
disinfection of possibly contaminated environmental D human adenovirus provides evidence of a novel
surfaces should be routinely practiced to minimize the virus. Journal of General Virology, 2017. 98(11): p.
dissemination of HAdV-associated conjunctivitis (13) . 2810-2820.
5. Bonadonna, L. and G. La Rosa, A review and
One study in Tokyo found that the most common
update on waterborne viral diseases associated
type causing adenoviral conjunctivitis was HAdV-8 (17) . with swimming pools. International journal of
Also, Study in Saudi Arabia and Southwest China found environmental research and public health, 2019.
the same result that HAdV-8 is the predominant (18, 19). 16(2): p. 166.
All this mentioned study agree with current study.
6. M Mennechet FJD, Paris O, Ouoba AR, Salazar
A Study in University of Babylon found that Arenas S, Sirima SB, Takoudjou Dzomo GR,
HAdVs-19 is the predominant (20). Also one study Diarra A, Traore IT, Kania D, Eichholz K, Weaver
EA, Tuaillon E, & Kremer EJ. A review of 652898 Indian Journal of Forensic Medicine & Toxicology, April-June 2021, Vol. 15, No. 2
years of human adenovirus seroprevalence. Expert 14. Hendrickx, R., Stichling, N., Koelen, J., Kuryk,
review of vaccines, 2019. 18(6): p. 597-613. L., Lipiec, A., & Greber, U. F. Innate immunity to
7. Bair, C.R., Intratypic Genetic Variability Of adenovirus. Human gene therapy, 2014. 25(4): p.
Human Adenovirus Type 4: Implication For Viral 265-284.
Pathogenesis. 2019. 15. Chigbu, D.I. and B.A. Labib, Pathogenesis and
8. Radke, J.R. and J.L. Cook, Human adenovirus management of adenoviral keratoconjunctivitis.
infections: update and consideration of mechanisms Infection and drug resistance, 2018. 11: p. 981.
of viral persistence. Current opinion in infectious 16. Marinos, E., M. Cabrera-Aguas, and S.L. Watson,
diseases, 2018. 31(3): p. 251. Viral conjunctivitis: a retrospective study in an
9. Sposito S, Zampiero A, Bianchini S, Mori A, Australian hospital. Contact Lens and Anterior
Scala A, Tagliabue C, Sciarrabba CS, Fossali Eye, 2019. 42(6): p. 679-684.
E, Piralla A, & Principi N. Epidemiology and 17. Matsui, K., Shimizu, H., Yoshida, A., Nagaoka, E.,
Clinical Characteristics of Respiratory Infections Nishio, O., & Okuda, K., Monitoring of adenovirus
Due to Adenovirus in Children Living in from conjunctival scrapings in Japan during 2005–
Milan, Italy, during 2013 and 2014. PLoS One. 2006. Journal of medical virology, 2008. 80(6): p.
2016;11(4):e0152375. 997-1003.
10. Duker, J.S. and M. Yanoff, Ophthalmology 18. Tabbara, K. F., Omar, N., Hammouda, E.,
E-Book.: Elsevier Health Sciences, 2018 . Akanuma, M., Ohguchi, T., Ariga, T., Tagawa,
11. Zhang L, Zhao N, Sha J, Wang C, Jin X, Amer Y., Kitaichi, N., Ishida, S., Aoki, K., Ishiko, H.,
S, & Liu S. Virology and epidemiology analyses & Ohno, S. Molecular epidemiology of adenoviral
of global adenovirus-associated conjunctivitis keratoconjunctivitis in Saudi Arabia. Molecular
outbreaks, 1953–2013. Epidemiology & Infection, vision, 2010. 16: p. 2132.
2016. 144(8): p. 1661-1672. 19. Li, D., Zhou, J. N., Li, H., He, C. Y., Dai, Q. S.,
12. Efros O, Zahavi A, Levine H, Hartal M. Clinical Li, X. L., He, J. F., He, H., Li, M. B., Jiang, L. I.,
and public health management of conjunctivitis Chen, Y. Y., & Xu, W. An outbreak of epidemic
in the Israel Defense Forces. Disaster and military keratoconjunctivitis caused by human adenovirus
medicine, 2015. 1(1): p. 12. type 8 in primary school, southwest China. BMC
infectious diseases, 2019. 19(1): p. 624.
13. Li, J., Lu, X., Jiang, B., Du, Y., Yang, Y., Qian,
H., Liu, B., Lin, C., Jia, L., Chen, L., & Wang, 20. Akraa, A.T. and Y.A.A.-K. , Genotyping of
Q., Adenovirus-associated acute conjunctivitis Adenovirus Among Iraqi Patients with Epidemic
in Beijing, China, 2011–2013. BMC infectious Keratoconjunctivitis, in College of Medicine/
diseases, 2018. 18(1): p. 135. Medical Microbiology. 2019, University of
BabylonYou can also read
