Cross-amplified microsatellite loci for the red brocket deer complex (Mazama americana Erxleben, 1777) Prospecção de lócus microssatélites para o ...
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Brazilian Journal of Animal and Environmental Research 256
ISSN: 2595-573X
Cross-amplified microsatellite loci for the red brocket deer complex
(Mazama americana Erxleben, 1777)
Prospecção de lócus microssatélites para o complexo de espécies de veado-
mateiro (Mazama americana Erxleben, 1777)
DOI: 10.34188/bjaerv5n1-023
Recebimento dos originais: 25/11/2021
Aceitação para publicação: 03/01/2022
Gabrielle Queiroz Vacari
Mestra em Genética e Melhoramento Animal pela Universidade Estadual Paulista (UNESP-
Jaboticabal)
Instituição: Universidade Estadual Paulista (UNESP- Jaboticabal) / Local de trabalho:
Universidade Estadual Paulista (UNESP- Jaboticabal)
Endereço: Via de Acesso Professor Paulo Donato Castelane Castellane S/N - Vila Industrial,
14884-900 - Jaboticabal-SP - Brasil
E-mail: gabrielle_g12@hotmail.com
Pedro Henrique de Faria Peres
Doutor em Genética e Melhoramento Animal pela Universidade Estadual Paulista (UNESP-
Jaboticabal)
Instituição: Universidade Estadual Paulista (UNESP- Jaboticabal) / Local de trabalho:
Universidade Estadual Paulista (UNESP- Jaboticabal)
Endereço: Via de Acesso Professor Paulo Donato Castelane Castellane S/N - Vila Industrial,
14884-900 - Jaboticabal-SP - Brasil
E-mail: pedrof182@gmail.com
José Mauricio Barbanti Duarte
Professor Assistente Doutor da Universidade Estadual Paulista (UNESP- Jaboticabal)
Instituição: Universidade Estadual Paulista (UNESP- Jaboticabal) / Local de trabalho:
Universidade Estadual Paulista (UNESP- Jaboticabal)
Endereço: Via de Acesso Professor Paulo Donato Castelane Castellane S/N - Vila Industrial,
14884-900 - Jaboticabal-SP - Brasil
E-mail: mauricio.barbanti@unesp.br
ABSTRACT
The red brocket deer is defined as a complex of cryptic species within Mazama americana due to
an important taxonomic uncertainty related to the karyotypic differences, therefore the species is
categorized as ‘data deficient’ in IUCN red list. Despite its wide distribution, the red brocket’s
habitat is shrinking and becoming fragmented, limiting the species to small and isolated populations.
In this study, 30 microsatellite loci, developed for Mazama gouazoubira, were tested for the M.
americana complex using samples from its entire geographic distribution and all genetic variants.
Among the tested microsatellites, 22 amplified successfully in all samples and a part of those were
sequenced to identify and confirm the microsatellite region. The set of identified primers can be
used in population studies of M. americana.
Keywords: Cervidae, molecular marker.
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 257
ISSN: 2595-573X
RESUMO
O veado-mateiro está categorizado como dados deficientes na lista vermelha da IUCN devido à uma
incerteza taxonômica importante em razão das diferenças cariotípicas observadas na espécie. Apesar
da sua ampla distribuição, seu habitat vem sofrendo processos de redução e fragmentação que
limitam a espécie a populações pequenas e isoladas. Nesse trabalho, 30 primers microssatélites
desenvolvidos para Mazama gouazoubira foram testados para o complexo de espécies de Mazama
americana, com base em amostras de toda a sua distribuição geográfica e variantes genéticas. Dentre
os microssatélites testados, 22 amplificaram com sucesso em todas as amostras, estando próximo
ao tamanho esperado, e parte deles foram sequenciados para identificação e confirmação da região
microssatélite. O conjunto de primers identificados podem ser usados para estudos da espécie M.
americana elucidando questões sobre a conexão de suas populações.
Palavras-chave: Cervidae, marcador molecular.
1 INTRODUCTION
The Mazama americana, known as the red brocket deer, is the largest species of the Mazama
genus (Bodmer, 1997). The distribution of the species, which occurs in forest habitats, covers almost
the entire Neotropical region (Eisenberg, 1989; Emmons, 1990). Habitat loss and fragmentation,
diseases introduced by bovine livestock, and illegal hunting threaten the survival of red brocket
populations (Duarte; Vogliotti, 2016).
In the IUCN’s Red List (2016) of threatened species, the red brocket is categorized as ‘data
deficient’ (DD) owing to taxonomic uncertainties that arise from an extensive chromosomal
polymorphism, which results in reproductive barriers between populations (Cursino et al., 2014;
Salviano et al., 2017). Thus, these cytotypes have potential to be distinct species, characterizing M.
americana as a complex of cryptic species (Duarte et al., 2008).
A neotype of the Mazama americana species was recently proposed, with a specimen from
French Guiana that differed from all analyzed genetic variants (Rincón, 2016). This finding
reinforces the need for a taxonomic reorganization of the species so that the extinction risk can be
assessed for the various extant evolutionary units. The cytotype found in the Paraná River basin, for
example, is noteworthy for the reduction and fragmentation of its habitat, the seasonal forest of the
Atlantic Forest biome, where the species is limited to a few areas in the continental interior (Varela
et al., 2010). Since the animals of this population differ genetically from the M. americana neotype,
they are described as belonging to another species: Mazama rufa (Luduvério, 2018).
In this context, understanding the diversity and gene flow in the species is essential to
comprehending the evolutionary process and the recent impacts to which its populations have been
subjected. One study using mitochondrial DNA showed that these markers do not enable the
separation of the various M. americana cytotypes, suggesting instead that studies should use
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 258
ISSN: 2595-573X
microsatellite markers to assess the recent populational isolation suffered by these populations
(Maran, 2016).
Microsatellite markers are widely used for such population characterizations, with applications
in studies of genetic variability and diversity (Jiménez et al., 2017; Mantellato et al., 2017),
evaluation of introduced and reintroduced populations (Le Gouar et al., 2008), verification of
genetic structuration (Leding, 2000), determination of reproductive success and kinship (Clinchy et
al., 2004), verification of endogamy and inbreeding depression (Liberg et al., 2005), and detection
of hybridization (Mondol et al., 2015; Costa et al., 2017).
The process of microsatellite identification and development of specific primers was for decades
laborious and costly. The development of next-generation sequencing (NGS) and the proliferation
of genomic data reduced costs and facilitated development for the most diverse species (Abdelkrim
et al., 2009; Guichoux et al., 2011). Since NGS technology is not yet widely accessible, the
transference of microsatellites is an important strategy for covering all biodiversity and has already
shown high rates of success (Sharma et al., 2007). It involves the primers developed for one species
being used for other closely related species, given that the flanking regions of microsatellites are
usually conserved (Ferreira; Grattapaglia, 1996). Microsatellite markers have already been adapted
successfully for neotropical ungulates such as the pampas deer (Ozotoceros bezoarticus) (Cosse et
al., 2007; Mantellatto et al., 2017), deer of the genus Mazama (Mantellato et al., 2010), and the
native pigs Tayassu pecari and Pecari tajacu (Dalla Vecchia et al., 2011).
Few markers are available in the literature for M. americana, but a set of primers was recently
developed for Mazama gouazubira through NGS (Caparroz et al., 2015). Mantellato et al. (2010)
showed homology between different species of Mazama, which makes microsatellite transference
possible. In light of this, the present study tested the adaptation of microsatellite markers for
Mazama americana, with the intention of using them in future works that aim to understand the
gene flow between genetic variants of the species or between populations in fragmented regions.
2 MATERIAL AND METHODS
Animals and Samples
To test the transferability of the microsatellites, we used 12 samples of fibroblasts from M.
americana. These samples were taken from all the cytotypes described for the species, including
the neotype proposed in 2016, and from different geographic locations (Table 1). The samples come
from the sample bank of the Deer Research and Conservation Center (Núcleo de Pesquisa e
Conservação de Cervídeos – NUPECCE) at the São Paulo State University (Universidade Estadual
Paulista “Júlio de Mesquita Filho” – UNESP).
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 259
ISSN: 2595-573X
Table 1: Samples of the species Mazama americana, where 2n = diploid number; FN = fundamental number.
Identification Cytotype 2n/FN Location Citation
T 248 Juína 2n=44/FN=48 Juína - MT Abril et al 2010
T 253 Juína 2n=43/FN=48 Juína – MT Abril et al 2010
T 254 Carajás 2n=50/FN=54 Açailândia - MA Abril et al 2010
T 256 Paraná 2n=52/FN=56 Foz do Iguaçu -PR Abril et al 2010
T 258 Jarí 2n=49/FN=56 Santarém- PA Abril et al 2010
T 259 Santarém 2n=51/FN=56 Santarém -PA Abril et al 2010
T 267 Paraná 2n=53/FN=56 Foz do Iguaçu -PR Nupecce
T 269 Rondônia 2n=42/FN=46 Buritis – RO Abril et al 2010
T 274 Carajás 2n=50/FN=54 Imperatriz-MA Abril et al 2010
T 310 Belém 2n=49/FN=56 Belém -PA Nupecce
T 358 Neotype 2n=45/FN=50 French Guiana Rincón 2016
T 385 Paraná 2n=52/FN=56 Foz do Iguaçu - PR Luduvério 2018
Marker Selection
We selected markers that generate fragments with a maximum size of 220 pb. Such markers
are best for amplification in samples containing degraded DNA, as is the case with feces, which
allows extensive and numerous samplings (Oliveira et al., 2012; Duarte et al., 2017; Mantellatto et
al., 2017). We also selected microsatellites with repetitions of tri- and tetra-nucleotides, facilitating
the analysis of the electropherograms; and of similar annealing temperatures, enabling future
multiplex amplifications. In M. americana, we tested 30 primers originally described for M.
gouazoubira by Caparroz et al. (2015) (Table 2).
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 260
ISSN: 2595-573X
Table 2- Microsatellite primers selected successfully for M. americana.
Expected Optimized TA
Locus Primer Sequence (5’-3’) SSR
size (°C)
F- AAAGGAGATGTCAGGATATGGG
Goua8 174 (GTG)15 55
R- ACTTGGTTGATTTCGCTGCTAT
F- TCAGAGTGAGATAAAGCTGAGGC
Goua9 220 (TCTA)14 55
R- GTTGAATATGACTGAGCGACTGA
F- TAGTGGGACGTTTGTTGTTGTT
Goua10 134 (TTG)13 55
R- TGGATCTTTGGAGAGGGTCTAA
F- GCCATAACCAACGAAAGGATAC
Goua11 220 (AGGA)13 55
R- CCTTGTTGAGGAGTGGAGGTAG
F- GGAGTATTCTGTCTTTGGCGAT
Goua14 122 (TAGA)12 55
R- TTTCATCCATACCTCAGCACTC
F- GGGACAGTGATAAACTAGGTGT
Goua16 222 (TACA)12 55
R- CTAATGAGATAGCAAAGTACGC
F- TTCCAGGCAAGAATACAGGAGT
Goua18 205 (ATT)11 55
R- GTAACTCGTTGAGCATAAGGGC
F- ACAACTGGAGAAAACCCTTGTG
Goua20 201 (ATAA)11 55
R- AGCCTTTAGAGATGTTCTGTTTGG
F- GAGTACAACAGCCATGCAGAGA
Goua21 168 (CATA)11 55
R- CATTGGGGTTCACCTAGAGAAG
F- GATTCAGTTTTGGGGAGAA
Goua22 209 (CTAT)11 55
R- ATTCACAGCAGAGATTTACCAC
F- GAGGAGGGAATTAGTAGATACA
Goua23 203 (ATAG)11 55
R- GGTGGATTCTTTACCAGC
F- AAGAAGCTCAAACTTGCCTGTC
Goua24 167 (ACA)10 55
R- TCTTATTTCCACCTCTTTCCCA
F- AGGACAACCATGCACCTACTTT
Goua25 174 (CAT)10 55
R- ATCCCAGCTCCTTTTAACACAA
F- CCGTATGAGGTCCATGATTACA
Goua26 199 (GCA)10 55
R- TGCTCCACTTTGAGGACACTAA
F- TTCCAGCATCAGGGTCTTTTAT
Goua27 183 (TATT)10 55
R- TCCCAAAGGAAATCAGTCCTAA
F- CCTGGACTTTTGTTTGTAGGGA
Goua28 132 (TTA)9 55
R- CCAAGACTGAGCCAAGAAGAAA
F- CGGTCCCATTATTTCATAGCAA
Goua29 144 (TTTA)9 55
R- AGCGTCTTTAATTTCATGGCTG
F- GCAGCTTTGTTTTGCTTTGAC
Goua30 158 (GTT)8 55
R- CTAGCATGTGGGGTCTTAGCTC
F- CCTTGCAGTTATGGGACTTGTT
Goua31 115 (CTG)8 55
R- ATCTATGGGGTTGCACAGAGTT
F- AAACCCCAATAGTACAAACAGGTC
Goua32 167 (CTTT)8 55
R- AACCAAGATTCCACTTGCCTT
F- ACTCAGGGATCAAACCCACAT
Goua34 162 (TCTA)8 55
R- ATATTAGTTGCTGGCGTATGGC
F- ACAGTTCAGGATTCTCCCCTTC
Goua 35 177 (TGT)8 55
R- AATGGCAACCCACTCCAGTA
DNA Extraction and Amplification of Samples
DNA was extracted from cellular lines (fibroblasts) kept frozen in liquid N2 in the cell bank
of NUPECCE. The extraction was achieved by digestion with proteinase K, purification with
phenol-chloroform, and precipitation with absolute ethanol (Sambrook et al., 1989). The samples,
diluted to a concentration of 50ng/ul to standardize the PCR, were quantified in a Nanodrop
spectrophotometer. The PCRs were normalized to a final volume of 30ul, containing 1x of buffer
(10 mM de Tris-HCl, pH 8.4, KCl 50 mM), 3 mM of MgCl2, 0.5 mM of dNTP, 1 U of Taq
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 261
ISSN: 2595-573X
polimerase, 2.5 mg/ml of BSA, 0.6 pM of each primer, and approximately 150 ng of genomic DNA.
The reactions were performed in a thermal cycler (Bio-Rad C1000 Touch™ Thermal Cycler) for 35
cycles under the following conditions: 94 °C for 5 min, 94 °C for 1 min, 52 to 59 °C for 1 min
(during which different temperatures were tested for each primer), 72 °C for 1 min and, finally, 72
°C for 30 min. Obtainment of the fragments of interest was confirmed by viewing the product of the
PCR through electrophoresis in 2% agarose gel.
Confirmation of Microsatellites
Some of the amplified loci were sequenced for confirmation of the microsatellite region.
They were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega), and at least
one sample had its sense strand sequenced in an ABI 3730xl automatic sequencer (Applied
Biosystems Inc) at the Center for Biological Resources and Genome Biology (Centro de Recursos
Biológicos e Biologia Genômica – CREBIO/Unesp Jaboticabal). The obtained sequences were
exported to the program Sequence Scanner 2, where their electropherogram was visually confirmed.
3 RESULTS AND DISCUSSION
Among the 30 microsatellite loci analyzed, 22 were satisfactorily amplified and were the
expected length (Table 2), and seven of them were sequenced to confirm the repetitive region.
However, five others presented non-specific bands (Goua6, 12, 13, 15 and 33), while three did not
amplify (Goua7, 17 and 19) and were therefore discarded. All of the 12 samples, originating from
different regions and representing the genetic variants of currently known species, amplified
successfully in the loci where the transference was observed.
The microsatellite transfer was 73% successful in relation to the first tested panel. This success
rate is high compared to the 50% transfer rate observed in other studies (Sharma, et al., 2007) and
the 40% successful transference in mammals among and between genera (Barbará, et al., 2007).
Mantellatto et al. (2010) also achieved successful amplification in microsatellite transference,
reaching 93% among Cervidae of the Northern Hemisphere and Mazama species. The high rates of
transference observed in the Cervidae family suggest that this set of microsatellites can be applied
to the other species of the genus Mazama, with a high chance of success.
The optimization for similar annealing temperatures was interesting, since such primers can be
used in multiplex PCR. The multiplex reactions represent an advancement, because they reduce the
workload and laboratory costs as well as the quantity of DNA used. It is estimated that the change
from single reaction to 2-plex saves half of the cost involved (Guichoux et al., 2011).
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 262
ISSN: 2595-573X
The selected markers generated fragments with a maximum size of 220pb, which we were able
to use in the amplification of non-invasive samples containing degraded DNA, such as fecal and
hair samples (Beja-Pereira et al., 2009). Feces, collected with the help of detection dogs, is the most
accessible material and has enabled extensive sampling of Mazama species in Brazil (Oliveira et al.
2012; Duarte et al., 2017). The selected microsatellite markers can be used not only for exclusively
genetic questions, but also in ecological applications such as geographic distribution, population
estimates, movement and habitat use in fragmented landscapes (Selkoe; Toonen, 2006).
4 CONCLUSION
The present study demonstrated the possibility of transferring primers for microsatellite markers
between two close species of the family Cervidae. This is the first cross- amplification study
including samples for the wide cytotypes variations known until present in M. americana. We were
able to identified 22 microsatellite loci set for further population genetic studies. Moreover, their
use could be useful to understand the evolutionary and taxonomical context of red brocket deer.
ACKNOWLEDGMENTS
We thank FAPESP (Foundation for Research Support of São Paulo) for funding this work.
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 263
ISSN: 2595-573X
REFERENCIAS
Abril VV; Carnelossi EAG; González S; Duarte JMB (2010) Elucidating the Evolution of the Red
Brocket Deer Mazama americana Complex (Artiodactyla; Cervidae). Cytogenetic and Genome
Research 128:177-187.
Abdelkrim J; Robertson BC; Stanton JAL; Gemmell NJ (2009) Fast, cost-effective development of
species-specific microsatellite markers by genomic sequencing. BioTechniques. 46:185-192.
Barbará T; Palma-Silva C; Paggi GM; Bered F; Fay MF; Lexer C (2007) Cross-species transfer of
nuclear microsatellite markers: potential and limitations. Molecular Ecology. 16:3759-69.
Beja‐Pereira A; Oliveira R; Alves PC; Schwartz MK; Luikart G (2009) Advancing ecological
understandings through technological transformations in noninvasive genetics. Molecular Ecology
Resources, 9:1279–1301.
Bodmer RE (1997) Ecologia e conservação dos veados-mateiro e catingueiros na Amazônia. In:
Duarte, J.M.B. (Ed.) Biologia e Conservação de Cervídeos Sul-Americanos: Blastocerus,
Ozotoceros e Mazama. Jaboticabal: FUNEP, 5:70-77.
Caparroz R; Mantellatto AMB; Bertioli D; Figueiredo M; Duarte JMB (2015) Characterization of
the complete mitochondrial genome and a set of polymorphic microsatellite markers through next-
generation sequencing for the brown brocket deer Mazama gouazoubira. Genetics and Molecular
Biology, 38:338-345.
Clinchy M; Taylor AC; Zanette LY; Krebs CJ; Jarman PJ (2004) Body size, age and paternity in
common brushtail possums (Trichosurusvulpecula). Molecular Ecolology, 13:195-202.
Cosse M; González S; Maldonado JE (2007) Cross-amplification tests of ungulate primers in the
endangered Neotropical pampas deer (Ozotocerosbezoarticus). Genetics and Molecular Research,
6:1118-1122.
Costa MC; Oliveira PRRJR; Davancëo PV; Camargo CD; Laganaro NM; Azeredo RA, et al. (2017)
Recovering the Genetic Identity of an Extinct-in-the-Wild Species: The Puzzling Case of the
Alagoas Curassow. PLoS ONE, 12:1-18.
Cursino MS; Salviano MB; Abril VV; Zanetti ES; Duarte JMB (2014) The role of chromosome
variation in the speciation of the red brocket deer complex: the study of reproductive isolation in
females. BMC Evolutionary Biology, 14:40.
Dalla Vecchia ACD; Biondo C; Sanches A; Keuroghlian A; Myaki CY; Galetti Jr PM; Galetti M
(2011) Isolation and characterization of microsatellite loci for white-lipped peccaries
(Tayassupecari) and crossamplification in collared peccaries (Pecaritajacu). Conservation Genetics
Resources, 3:151-154.
Duarte JMB; González S; Maldonado JE (2008) The surprising evolutionary history of South
American deer. Molecular Phylogenetics and Evolution, 49:17–22.
Duarte JMB; Talarico ÂC; Vogliotti A; Garcia JE; Oliveira ML; Maldonado JE; González S (2017)
Scat detection dogs, DNA and species distribution modelling reveal a diminutive geographical range
for the vulnerable small red brocket deer Mazama bororo. Oryx, 19:1–9.
Duarte JMB; Vogliotti A (2016) Mazama americana. The IUCN Red List of Threatened Species
2016: e.T29619A22154827.
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 264
ISSN: 2595-573X
Eisemberg JF (1989) Mammals of the Neotropics. The University of Chicago Press, 1:449.
Emmons LH (1990) Neotropical Rainforest Mammals, a field guide. The University of Chicago
Press, Chicago, 281p.
Ferreira ME; Grattapaglia D (1996) Introdução ao uso de marcadores RAPD e RFLP em análise
genética. Brasília: EMBRAPA – CENARGEN, 220p.
Guichoux E; Lagache L; Wagner S. et al. (2011). Current trends in microsatellite genotyping.
Molecular Ecology Resources, 11:591-611.
IUCN (2016) IUCN Red List Threatened Species. IUCN Red List Unit, International Union for
Conservation of Nature and Natural Resources, Cambridge, United Kingdom.
Jiménez, ÁP; Albarracín, MY; Estupiñán, S (2017) Variabilidad genética del cerdo Congo
Santandereano mediante marcadores microsatellite. Archivos de zootecnia, 66:599-602.
Mantellatto, AMB; Carnelossi EAG.; Duarte JMB (2010) Transferability of microsatellite loci from
exotic Cervidae to Brazilian brocket deer (Mazama spp, Mammalia: Cervidae). Genetics and
Molecular Research, 9:277-282.
Mantellatto AMB; Caparroz R; Christofoletti MD; Piovezan U; Duarte JMB (2017) Genetic
diversity of the pampas deer (Ozotoceros bezoarticus) population in the Brazilian Pantanal assessed
by combining fresh fecal DNA analysis and a set of heterologous microsatellite loci. Genetics and
Molecular Biology, Ribeirão Preto , 40:774-780.
Maran LHM (2016) Filogenia molecular de Mazama americana (Artiodactyla: Cervidae) como
auxilio na resolução das incertezas taxonômicas. 2016. 55 f. Dissertação (Mestrado em genética e
melhoramento animal) – Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual
Paulista “Júlio de Mesquita Filho”, Jaboticabal.
Mondol S; Moltke I; Hart J; Keigwin M; Brown L; Stephens M; Wasser SK (2015) New evidence
for hybrid zones of forest and savanna elephants in Central and West Africa. Molecular Ecology,
24:6134–6147.
Leding FT (2000) Founder effects and the genetic structure of coulter pine. The American genetic
association v.91, p,307-315, 2000.
Le Gouar P; Rigal F; Boisselier-Dubayle MC; Sarrazin F; Arthur C; Choisy JP; Hatzofe O;
Henriquet S; Lécuyer P; Tessier C; Susic G; Samadi S (2008) Genetic variation in a network of
natural and reintroduced populations of Griffon vulture (Gyps fulvus) in Europe. Conservation
Genetics, 9:349-359.
Liberg O; Andren H; Pedersen HC; Sand H; Seiberg D; Wabakken P; Akesson M; Bensch S (2005)
Severe inbreeding depression in a wild wolf population Canis lupus. BiologyLetters, 1:17-20.
Luduvério DJ (2018) O status taxonômico te Cervus rufus Illiger, 1811 e sua caracterização genética
e morfológica. 2018. 67f. Dissertação (Mestrado em genética e melhoramento animal) – Faculdade
de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista “Júlio de Mesquita Filho”,
Jaboticabal.
Oliveira ML; Norris D; Ramírez JFM; Peres PHF; Galetti M; Duarte JMB (2012) Dogs can detect
scat samples more efficiently than humans: an experiment in a continuous Atlantic Forest
remnant. Zoologia (Curitiba), Curitiba, 29:183-186.
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.Brazilian Journal of Animal and Environmental Research 265
ISSN: 2595-573X
Rincón AC (2016) Caracterização morfológica, citogenética e molecular de Mazama americana
(Artiodactyla: Cervidae) a partir de um topótipo atual. Dissertação (Mestrado em Genética e
Melhoramento Animal). Universidade Estadual Paulista “Julio de Mesquita Filho”, Jaboticabal,
Brasil.
Sambrook J; Fritsch E; Maniats T (1989) Molecular Cloning: a Laboratory Manual. Cold Spring
Harbor Press, New York.
Salviano MB; Cursino MS; Zanetti ES; Abril VV; Duarte JMB (2017) Intraspecific chromosome
polymorphisms canlead to reproductive isolation and speciation: anexample in red brocket deer
(Mazama americana).Biology of Reproduction, 96:1279–1287.
Selkoe KA; Toonen RJ (2006) Microsatellites for ecologists: a practical guide tousing and
evaluating microsatellite markers. Ecology Letters, 9:615–29.
Sharma PC; Grover A; Kahl G (2007) Mining microsatellites in eukaryotic genomes. Trends in
Biotechnology, 25:490–498.
Varela DM; Trovati RG; Guzmán KR; Rossi RV; et al (2010) Red Brocket Deer – Mazama
americana. In: Neotropical Cervidology; Biology and Medicine of Latin American Deer (Duarte
JMB and Gonzalez S, eds.). FUNEP/IUCN, Jaboticabal, 151-159.
Brazilian Journal of Animal and Environmental Research, Curitiba, v.5, n.1, p. 256-265, jan./mar. 2022.You can also read
