NapA-Type Na /H Antiporters with Novel Ion Specificity That Are Involved in Salt Tolerance at Alkaline pH
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2005, p. 4176–4184 Vol. 71, No. 8
0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.8.4176–4184.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Halotolerant Cyanobacterium Aphanothece halophytica Contains
NapA-Type Na⫹/H⫹ Antiporters with Novel Ion Specificity
That Are Involved in Salt Tolerance at Alkaline pH
Nuchanat Wutipraditkul,1 Rungaroon Waditee,2 Aran Incharoensakdi,3 Takashi Hibino,4
Yoshito Tanaka,4 Tatsunosuke Nakamura,5 Masamitsu Shikata,6 Tetsuko Takabe,1
and Teruhiro Takabe2,4*
Graduate School of Agricultural Science, Nagoya University, Nagoya 464-8601, Japan1; Research Institute of Meijo University,
Nagoya 468-8502, Japan2; Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand3; Graduate School of
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
Environmental and Human Sciences, Meijo University, Nagoya 468-8502, Japan4; Faculty of Pharmacy,
Niigata University of Pharmacy and Applied Life Science, Niigata 950-2081, Japan5; and
Genomic Research Center, Shimadzu Corporation, Kyoto 604-8511, Japan6
Received 6 December 2004/Accepted 20 February 2005
Aphanothece halophytica is a halotolerant alkaliphilic cyanobacterium which can grow at NaCl concentrations
up to 3.0 M and at pH values up to 11. The genome sequence revealed that the cyanobacterium Synechocystis
sp. strain PCC 6803 contains five putative Naⴙ/Hⴙ antiporters, two of which are homologous to NhaP of
Pseudomonas aeruginosa and three of which are homologous to NapA of Enterococcus hirae. The physiological
and functional properties of NapA-type antiporters are largely unknown. One of NapA-type antiporters in
Synechocystis sp. strain PCC 6803 has been proposed to be essential for the survival of this organism. In this
study, we examined the isolation and characterization of the homologous gene in Aphanothece halophytica. Two
genes encoding polypeptides of the same size, designated Ap-napA1-1 and Ap-napA1-2, were isolated. Ap-
NapA1-1 exhibited a higher level of homology to the Synechocystis ortholog (Syn-NapA1) than Ap-NapA1-2
exhibited. Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 complemented the salt-sensitive phenotypes of an Esch-
erichia coli mutant and exhibited strongly pH-dependent Naⴙ/Hⴙ and Liⴙ/Hⴙ exchange activities (the highest
activities were at alkaline pH), although the activities of Ap-NapA1-2 were significantly lower than the activities
of the other polypeptides. Only one these polypeptides, Ap-NapA1-2, complemented a Kⴙ uptake-deficient E.
coli mutant and exhibited Kⴙ uptake activity. Mutagenesis experiments suggested the importance of Glu129,
Asp225, and Asp226 in the putative transmembrane segment and Glu142 in the loop region for the activity.
Overexpression of Ap-NapA1-1 in the freshwater cyanobacterium Synechococcus sp. strain PCC 7942 enhanced
the salt tolerance of cells, especially at alkaline pH. These findings indicate that A. halophytica has two
NapA1-type antiporters which exhibit different ion specificities and play an important role in salt tolerance at
alkaline pH.
Salinity has a detrimental effect on soil microorganisms and, shown that ribulose-1,5-bisphosphate carboxylase/oxygenase of
in general, results in decreased productivity of crop plants. A. halophytica dissociates easily into large and small subunits
Organisms that thrive in hypersaline environments possess spe- when betaine is absent (8). A. halophytica DnaK contains a
cific mechanisms to adjust their internal osmotic status (1, 10, longer C-terminal segment than other DnaK/Hsp70 family
21, 35). One such mechanism is the ability to accumulate low- members contain (12) and exhibits extremely high protein fold-
molecular-weight organic compatible solutes, such as glycine ing activity at high salinity (5). It has also been shown that an
betaine (10, 21). Another mechanism for adaptation to high A. halophytica NhaP-type Na⫹/H⫹ antiporter has a novel ion
salinity is exclusion of Na⫹ ions from the cells (1–4). specificity (32) and can confer tolerance to salt stress on the
Aphanothece halophytica is a halotolerant cyanobacterium freshwater cyanobacterium so that it is capable of growth in
which can grow in a wide range of salinity conditions (0.25 to seawater (30).
3.0 M NaCl) and accumulate betaine concomitantly (5, 30). It The genome sequence of Synechocystis sp. strain PCC 6803
also can grow at alkaline pH (pH 11.0). Na⫹/H⫹ antiporters of revealed the presence of five putative Na⫹/H⫹ antiporter
alkaliphilic A. halophytica may play a crucial role in Na⫹ efflux genes (9). Of the five proteins encoded by these genes, two
and in cytoplasmic pH homeostasis. At alkaline pH, the cells (Syn-NhaP1 and Syn-NhaP2) are homologous to NhaP of
maintain a cytoplasmic pH much lower than the external pH Pseudomonas aeruginosa and three (Syn-NapA1, Syn-NapA2,
and require unique systems to survive under these severe en- and Syn-NapA3) are homologous to NapA of Enterococcus
vironmental conditions (5, 30). Indeed, previous studies have hirae (3, 4, 7, 33). Originally, NapA was designated an Na⫹/H⫹
antiporter different from Escherichia coli NhaA (34). NhaP
antiporters exhibit some homology to eukaryotic antiporters,
* Corresponding author. Mailing address: Research Institute of
Meijo University, Tenpaku-ku, Nagoya 468-8502, Japan. Phone: 81-
such as SOS1 and NHX1 from plants and NHE1 from animals
52-838-2277. Fax: 81-52-832-1545. E-mail: takabe@ccmfs.meijo-u (29, 32).
.ac.jp. NapA is a member of the monovalent cation-proton anti-
4176VOL. 71, 2005 NapA-TYPE Na⫹/H⫹ ANTIPORTERS FROM CYANOBACTERIA 4177
TABLE 1. Primers used for isolation and expression of Na⫹/H⫹ served at alkaline pH. An important role for NapA1 antiport-
antiporter genes ers in salt tolerance at an alkaline pH was demonstrated.
Primer Sequence (5⬘-3⬘) Size (bp)
MATERIALS AND METHODS
ApNapA1-1-F AACCATGGTTTTTGATCAATTAA 30
TTTCTCG Strains and culture conditions. A. halophytica cells were grown photoauto-
ApNapA1-1-R GCGTCGACACCTTCCTGTTTTG 26 tropically in BG11 liquid medium plus 18 mM NaNO3 and Turk Island salt
AGGT
solution at 28°C as previously described (5). Synechocystis sp. strain PCC 6803
ApNapA1-2-F AACCATGGCAGCTTTACAAACA 28
ATCTTT and Synechococcus sp. strain PCC 7942 cells were grown at 30°C under contin-
ApNapA1-2-R ACGTCGACACTTCCTGTTTCCT 26 uous fluorescent white light (40 microeinsteins m⫺2 s⫺1) in BG11 liquid medium
CGAC supplemented with 10 mM HEPES-KOH and bubbled with 3% CO2. E. coli
SynNapA1-F TCCCATGGTTATGAACCCATT 25 DH5␣ was grown at 37°C in LB medium. E. coli TO114 cells, in which Na⫹/H⫹
GCTC
antiporter genes (i.e., nhaA, nhaB, and chaA) were deleted, were grown at 37°C
SynNapA1-R ATGTCGACATCTGGGGTGGGA 25
ACTG in LBK medium (18). E. coli LB650 was grown at 37°C in minimal medium as
ApE129DQ-F TCCTATCT(G,C)A(A,C)CTTGGGG 27 previously described (16). Ampicillin, erythromycin, kanamycin, and chloram-
TGGTGATTT phenicol were added to final concentrations of 50, 150, 30, 30 and g ml⫺1,
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
ApE129DQ-R TGATCACCATCCTATCT(G,C)A 27 respectively, whereas isopropyl--D-thiogalactopyranoside (IPTG) was not
(A,C)CTTGGGG
added. The growth medium pH was adjusted with KOH or HCl. Cell growth of
ApE142DQ-F GCTTA(G,C)A(T,A)TCAGACTTAA 28
AAGAGCTTTT E. coli and cell growth of cyanobacteria were monitored by measuring the light
ApE142DQ-R TCTGA(T,A)T(G,C)TAAGCCAATC 27 scattering at 620 and 730 nm, respectively. For the growth experiments with E.
TCAAAAAGC coli, E. coli TO114 or LB 650 cells in the late logarithmic phase were transferred
ApD225EKN-F AGTGATT(G,A)A(A,T)GATGTGT 26 into fresh medium (LB medium for TO114 cells or minimum medium for LB 650
TGGGCATCA
cells) at an initial optical density at 620 nm (OD620) of 0.02. The medium was
ApD225EKN-R TTGGTGCAGCAGTGATT(G,A)A 27
(A,T)GATGTGT supplemented with KCl, NaCl, or LiCl as indicated below. Growth of the cells
ApD226N-F TGATCGATAATGTGTTGGGCAT 27 was measured by determining the OD620 after 9 h unless indicated otherwise.
CATTG Growth curves were constructed by using the averages of at least three indepen-
ApD226N-R TTATCGATCACTGCTGCACCA 25 dent measurements.
ATAA
Isolation of napA1 genes. The napA1 genes from A. halophytica, Ap-napA1-1
ApD226E-F TGATCGATGAAGTGTTGGGCAT 29
CATTGTC and Ap-napA1-2, were amplified by PCR using primers ApNapA1-1-F and Ap-
ApD226E-R CGCGATTCCTGCTGTTTT 18 NapA1-1-R and primers ApNapA1-2-F and ApNapA1-2-R, respectively. The
ApNapA1Pro-F CACCATGGTGATCCTGATCCAG 27 sequences of all the primers are shown in Table 1. The Syn-napA1 gene from
TTAAT Synechocystis sp. strain PCC 6803 was amplified by with primers SynNapA1-F
ApNapA1Pro-R AACCATGGTTGGTTTGTTTACAG 29 and SynNapA1-R. The amplified fragments were ligated into the EcoRV restric-
AATTTC
HisBamH-R GTGGATCCTCAATGATGATGAT 26 tion site of pBSK⫹ (Stratagene, La Jolla, CA) and sequenced. Next, the inserts
GATG were transferred into the NcoI/SalI sites of pTrcHis2C (Invitrogen, Carlsbad,
CA). The resulting plasmids, pApNapA1-1, pApNapA1-2, and pSynNapA1, en-
code Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1, respectively, fused in frame to
six histidines at the C terminus. These plasmids were transferred first to E. coli
DH5␣ and then to TO114 cells in which the nhaA, nhaB, and chaA genes were
porter 2 (CPA-2) family (22). In Arabidopsis plants, 35 putative deleted (4, 18, 32).
CPA-2 antiporter genes have been assigned based on the ge- Construction of Ap-NapA1-1 mutants. The amino acid Glu129 in Ap-NapA1-1
was changed to Asp, Gln, and His by PCR mutagenesis as previously described
nome sequence (13). A CPA-2 antiporter has not been re-
(31). Briefly, the 5⬘- and 3⬘-terminal parts of Ap-napA1-1 were amplified with
ported for mammalian cells. In prokaryotic cells, the members primers ApNapA1-1-F and ApE129DQ-R and primers Ap129DQ-F and Ap-
of this family include a putative iron transport protein, MagA, NapA1-1-R using pApNapA1-1 as the template. After the primers were re-
from Magnetospirillum sp. strain AMB-1 (15), KefB and KefC moved, two PCR-amplified fragments were mixed, heated, annealed, and used as
from E. coli, which are K⫹ efflux system activated by glutathi- the templates for amplification with primers ApNapA1-1-F and ApNapA1-1-R.
The PCR product was ligated into the EcoRV site of pBSK⫹ and sequenced.
one (14), and Na⫹/H⫹ antiporter protein NapA from E. hirae The E129D and E129Q mutants were transferred to pTrcHis2C and used for
(34). Putative antiporters important in germination of Bacillus transformation of TO114. E142D, E142Q, D225E, D225N, D226E, and D226N
megaterium (GrmA) (26) and Bacillus cereus (GerN) (23, 27) mutants were constructed essentially by the same method.
are members of the CPA-2 family and most closely resemble Antiporter activity. Everted membrane vesicles were prepared from cells
grown in LBK medium at pH 7.0 as previously described (17, 32). Briefly, E. coli
NapA.
cells were harvested by centrifugation at 3,000 ⫻ g for 10 min at 4°C and then
The physiological and functional properties of NapA-type washed with TCDS suspension buffer (10 mM Tris-HCl, pH 7.5, 0.14 M choline
antiporters are largely unknown. One of the napA-type anti- chloride, 0.5 mM dithiothreitol, 0.25 M sucrose). The pellet was suspended in 10
porter genes in Synechocystis sp. strain PCC 6803 (sll0689, ml TCDS buffer and applied to a French pressure cell (4,000 lb/in2). The solution
nhaS3), here designated Syn-napA1, has been proposed to be was then centrifuged at 12,000 ⫻ g for 10 min at 4°C. The supernatant was finally
centrifuged at 110,000 ⫻ g for 60 min at 4°C, and the pellet was suspended in 500
essential for the survival of this organism since site-directed l TCDS buffer. The antiporter activity was assayed by monitoring the changes
null mutants could not be isolated (3, 7, 33). However, no in pH (⌬pH) (transmembrane [TM⫻ pH gradient) after addition of salt to the
information is currently available on NapA-type antiporters in 2-ml reaction mixture containing 10 mM Tris-HCl, 5 mM MgCl2, 0.14 M choline
other cyanobacteria. Because of these findings, we were inter- chloride, 1 M acridine orange, and everted membrane vesicles (50 g of
protein) (4, 17, 32). The ⌬pH was monitored by using acridine orange fluores-
ested in isolating a homologous gene from A. halophytica to
cence with excitation at 492 nm and emission at 525 nm. Before addition of salt,
characterize its functional properties. Here, we show that A. Tris–DL-lactate (5 mM) was added to initiate fluorescence quenching due to
halophytica contains at least two genes (Ap-napA1-1 and Ap- respiration. Lactate energized the vesicles, causing accumulation of H⫹ intrave-
napA1-2) homologous to Syn-napA1. Although Ap-NapA1-1 sicularly and subsequent accumulation of the dye, resulting in fluorescence
and Ap-NapA1-2 had Na⫹/H⫹ and Li⫹/H⫹ exchange activi- quenching. Salt (5 mM) was then added to dequench the fluorescence due to the
excretion of H⫹ by antiporters. Finally, 25 mM NH4Cl was added to dissipate the
ties, Ap-NapA1-2 exhibited K⫹ uptake activity. In contrast to ⌬pH.
NhaP1, the exchange activities of these NapA1 antiporters Kⴙ-depleted cells. Cells harvested from 8 ml of culture were suspended at a
were strongly pH dependent, and the highest activity was ob- concentration of 0.5 mg of cell protein per ml of buffer containing 25 mM4178 WUTIPRADITKUL ET AL. APPL. ENVIRON. MICROBIOL.
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
FIG. 1. Comparison of the deduced amino acid sequences of cation-proton antiporters. (A) Alignment of the deduced amino acid sequences
of six cation-proton antiporters. The sequences were aligned with the program ClustalW. The amino acid residues conserved in all sequences are
indicated by asterisks. Predicted membrane-spanning regions are indicated above the alignment. Site-directed mutated amino acid residues in
Ap-NapA1-1 are enclosed in boxes. (B) Phylogenetic analysis of cation-proton antiporters. Multiple-sequence alignment and generation of the
phylogenetic tree were performed with the ClustalW and TreeView software, respectively. The accession numbers for various antiporters are as
follows: AB193603 for Ap-NapA1-1, AB193604 for Ap-NapA1-2, D64001 for Synechocystis sp. strain PCC 6803 Syn-NapA1 (slr0689), AF246294
for B. cereus GerN, U17283 for B. megaterium putative spore germination apparatus protein (GrmA), and M81961 for E. hirae NapA.
HEPES-NaOH, pH 7.5 and 1 mM EDTA-NaOH, pH 7.5. This suspension was ApNapA1Pro-F and ApNapA1Pro-R and ligated into the NcoI site of pAp-
gently shaken for 10 min at 37°C. Subsequently, the cells were centrifuged and NapA1-1. After the orientation of the promoter was checked by sequencing, the
washed three times with the same buffer containing 50 mM NaCl (suspension full length of Ap-napA1-1 (containing the promoter and the His tag) was am-
buffer). The cells were then suspended at concentration of 5 to 10 mg of cell plified with primers ApNapA1Pro-F and HisBamHI, blunt ended, and ligated
protein per ml of suspension buffer and shaken at 37°C until the start of the into the BamHI-digested site of E. coli-Synechococcus shuttle vector
experiment. pUC303-Bm (30). The resulting plasmid was designated pUC303-ApNapA1-1
Detection of Kⴙ uptake with an ion analyzer. K⫹-depleted cells were sus- and was used to transform Synechococcus sp. strain PCC 7942 cells (30). For the
pended at a concentration of 5 to 10 mg of cell protein per ml of suspension salt stress experiments, Synechococcus cells were subcultured in BG11 medium as
buffer. After addition of 10 mM glucose, the suspension was shaken for 10 min described above together with 10 g ml⫺1 streptomycin. Cells in the late loga-
at 37°C, and KCl was then added at the concentrations indicated below. At rithmic phase were transferred into fresh medium containing various concentra-
different times, a 1-ml sample was withdrawn from the suspension and then tions of NaCl (0 to 0.5 M).
immediately subjected to centrifugation. The cell pellet was suspended in 1 ml of Other methods. The nucleotide sequences were determined using an ABI310
distilled water and boiled for 5 min. After removal of cell debris by centrifuga- genetic analyzer (Applied Biosystems, Foster City, CA). Cellular ions were
tion, the K⫹ content in the supernatant was determined with a Shimadzu PIA- determined with a Shimadzu PIA-1000 personal ion analyzer. The protein con-
1000 personal ion analyzer. tent was determined by Lowry’s method as described previously (5, 32). Sodium
Overexpression of Ap-NapA1-1 in a freshwater cyanobacterium. An expres- dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting analysis
sion plasmid for Ap-NapA1-1 which contained its own promoter was constructed were carried out as described previously (4, 32). An antibody raised against His6
as previously described (30). The 400-bp promoter region of Ap-napA1-1 was (six-His tag) was obtained from R&D Systems (Minneapolis, MN). The hydrop-
amplified from the genomic DNA of A. halophytica using primers athy profile of proteins was predicted using the computer-assisted procedureVOL. 71, 2005 NapA-TYPE Na⫹/H⫹ ANTIPORTERS FROM CYANOBACTERIA 4179
there are 11 putative TM spanning segments in these antiport-
ers (Fig. 1A). All six antiporters shown in Fig. 1A contain two
consecutive Asp residues in a putative TM6 segment (Asp225
and Asp226 in the case of Ap-NapA1-1). Moreover, the trimer
Gly-Leu-Glu in the loop region connecting TM segments (i.e.,
TM3 and TM4) (Gly140-Leu141-Glu142 in the case of Ap-
NapA1-1) is also conserved (Fig. 1A).
Expression of Ap-NapA1-1 and Ap-NapA1-2 in E. coli and
complementation of the Naⴙ- and Liⴙ-sensitive phenotypes.
To examine the functional properties of Ap-NapA1-1 and Ap-
NapA1-2, the genes encoding these proteins were expressed in
salt-sensitive E. coli mutant TO114 cells in which the nhaA,
nhaB, and chaA genes were disrupted. As shown in Fig. 2A,
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 could be ex-
pressed in TO114 cells. The level of expression of Ap-NapA1-1
was considerably lower than the levels of expression of Ap-
NapA1-2 and Syn-NapA1. Figures 2B and C show the growth
of E. coli TO114 cells in LB medium containing 30 mM KCl
FIG. 2. Effects of NaCl and LiCl on the growth of E. coli cells and various concentrations of NaCl or LiCl. TO114 cells trans-
expressing Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1. (A) Immuno- formed with the control plasmid could not grow in medium
blot analyses of pApNapA1-1-, pApNapA1-2-, and pSynNapA1-ex- containing NaCl at a concentration higher than 0.2 M, whereas
pressing cells. Lane 1, pApNapA1-1-expressing cells; lane 2, pAp- the cells transformed with Ap-napA1-1, Ap-napA1-2, and Syn-
NapA1-2-expressing cells; lane 3, pSynNapA1-expressing cells; lane 4,
napA1 could grow (Fig. 2B). Similar results were obtained for
pTrcHis2C control cells. In each lane, 50 g membrane proteins was
loaded. Antiporter proteins were detected using an antibody raised growth in medium containing LiCl at a concentration higher
against the His tag. (B) LB medium containing 30 mM KCl and than 4 mM (Fig. 2C). These results clearly indicate that Ap-
different concentrations of NaCl. (C) LB medium containing 30 mM NapA1-1, Ap-NapA1-2, and Syn-NapA1 could complement
KCl and different concentrations of LiCl. The control TO114 cells and the NaCl- and LiCl-sensitive phenotypes of E. coli TO114 cells.
transformant TO114 cells expressing Ap-NapA1-1, Ap-NapA1-2, and
Syn-NapA1 in the exponential phase were transferred to growth me- Antiporter activities of Ap-NapA1-1, Ap-NapA1-2, and Syn-
dium containing the different salts and pH. Each value is the average NapA1 at various pHs. To examine whether Ap-NapA1-1,
of three independent measurements of OD620 at 9 h. Ap-NapA1-2, and Syn-NapA1 exhibit exchange activities,
everted membrane vesicles of TO114 cells were prepared (17,
32). Cells transformed with the control plasmid exhibited es-
performed as described by Kyte and Doolittle (6, 11). The possible TM structure sentially no Na⫹/H⫹ and Li⫹/H⫹ antiporter activities at all
of Ap-NapA1 and Syn-NapA1 was predicted with the computer program Top- pHs examined (pH 6.0 to 9.0) (Fig. 3A and B). However,
PredII (6, 11).
Na⫹/H⫹ exchange activities were observed in the cells express-
Nucleotide sequence accession numbers. Nucleotide sequence data for Ap-
napA1-1 and Ap-napA1-2 have been deposited in the DDBJ databases under ing Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 at pH 7.0 to
accession numbers AB193603 and AB193604, respectively. 9.0 (Fig. 3A). Ap-NapA1-2 exhibited exchange activities for
both Na⫹/H⫹ and Li⫹/H⫹ antiporters that were lower than
those of Ap-NapA1-1 and Syn-NapA1 (Fig. 3A and B). We
RESULTS
could not detect Mg2⫹/H⫹ exchange activity at any pH exam-
Cloning of NapA1-type antiporter genes from A. halophytica. ined, although low Ca2⫹/H⫹ and K⫹/H⫹ exchange activities
Although only one napA1-type antiporter gene, Syn-napA1, were observed at pH 7.0 to 8.0 and at pH 7.0 to 9.0, respec-
has been reported for Synechocystis sp. strain PCC 6803, two tively, as shown for Ap-NapA1-1 (Fig. 3C) and Ap-NapA1-2
open reading frames homologous to Syn-napA1 were found in (Fig. 3D).
the shotgun clones of A. halophytica. The two genes were Interestingly, Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1
isolated by PCR amplification and were sequenced as de- exhibited pH-dependent activities. The exchange activities of
scribed in Materials and Methods. The predicted gene prod- these antiporters increased with increasing pH (Fig. 3). This is
ucts (Ap-NapA1-1 and Ap-NapA1-2) each consist of 467 more clearly shown in Fig. 4. The NhaP-type antiporter from
amino acids, and they have molecular masses of 48,113 and A. halophytica, Ap-NhaP1, exhibited high Na⫹/H⫹ exchange
48,566, respectively (Fig. 1A). The ClustalW analysis (Fig. 1B) activities at pH 6.0 to 9.0 (Fig. 4A). By contrast, Ap-NapA1-1
showed that Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 had no Na⫹/H⫹ exchange activity at pH 6.0, and its activity
could be classified as different Na⫹/H⫹ antiporter proteins increased with increasing pH; the optimum pH was around 8.5
than Syn-NapA2, Syn-NapA3, Syn-NhaP1, and Syn-NhaP2. (Fig. 4A). Ap-NapA1-1 exhibited a similar pH dependence for
Among the NapA1-type antiporters, Ap-NapA1-1 exhibited Li⫹/H⫹ exchange, whereas Ap-NhaP1 showed very little or no
high levels of homology to Syn-NapA1 from Synechocystis sp. activity at all pHs examined (Fig. 4B).
strain PCC 6803 (67%) and to Ap-NapA1-2 (64%). By con- The kinetic parameters were also examined. At pH 8.5, the
trast, Ap-NapA1-1 exhibited low levels of homology to GrmA Km values for Na⫹ were 0.8, 1.8, and 0.5 mM for Ap-NapA1-1,
from B. megaterium (37%) (26), GerN from B. cereus (37%) Ap-NapA1-2, and Syn-NapA1, respectively, and those for Li⫹
(27), and NapA from E. hirae (34%) (34). Analysis of the were 0.05, 0.3, and 0.02 mM, respectively. The Km values for
hydropathy plot and TM prediction program suggested that Na⫹ and Li⫹ at pH 7.0 were similar to those at pH 8.5 (data4180 WUTIPRADITKUL ET AL. APPL. ENVIRON. MICROBIOL.
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
FIG. 3. Cation-proton exchange activities measured by the acridine orange fluorescence quenching method. The control TO114 cells and
transformed TO114 cells expressing Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 were grown in LBK medium, from which everted membrane
vesicles were prepared. The antiporter activity was measured as described in Materials and Methods. (A and B) Na⫹/H⫹ and Li⫹/H⫹ antiporter
activities of Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1, respectively. (C and D) Na⫹/H⫹, K⫹/H⫹, Mg2⫹/H⫹ and Ca2⫹/H⫹ antiporter activities
of Ap-NapA1-1 and Ap-NapA1-2, respectively. The final concentration of salts was 5 mM. Each value is the average of three independent
measurements.
not shown). Although it is well documented that amiloride rates of the cells expressing Ap-NapA1-1and Syn-NapA1 were
inhibits the Na⫹/H⫹ exchange activities of antiporters from almost the same as those of the cells bearing pTrcHis2C. These
animals (19) and plants (2), Ap-NapA1-1, Ap-NapA1-2, and results indicated that Ap-NapA1-2, but not Ap-NapA1-1 and
Syn-NapA1 were not sensitive to 0.1 mM amiloride for both Syn-NapA1, could mediate K⫹ uptake.
the Na⫹/H⫹ and Li⫹/H⫹ exchange reactions (data not shown). Potassium significantly affected Naⴙ/Hⴙ and Liⴙ/Hⴙ ex-
Potassium uptake activity and complementation of potas- change activities of Ap-NapA1-2. To test whether the antiport-
sium uptake-deficient E. coli mutant by Ap-NapA1-2. Recently, ers could use K⫹ instead of H⫹ as a coupling ion, we per-
it has been shown that the spore germination protein GerN formed a fluorescence assay using everted membrane vesicles.
from Bacillus is an Na⫹/H⫹-K⫹ antiporter and can comple- The everted membrane vesicles were prepared with TCDS
ment K⫹ uptake-deficient E. coli (23). We therefore tested buffer without addition of extra K⫹. Under these conditions,
whether Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 could the intracellular K⫹ concentration of the everted membranes
transport K⫹ by performing complementation experiments was ⬃1 mM (25). Next, we tested the effects of K⫹ in the assay
with K⫹ uptake-deficient E. coli LB650 cells (16). It was found buffer on fluorescence dequenching. If K⫹ and H⫹ can com-
that the growth of control and transformed cells expressing pete for binding inside everted membrane vesicles, then the
Ap-NapA1-1 and Syn-NapA1 was essentially the same as that efflux of K⫹ would be affected by K⫹ in the assay medium,
of the cells expressing pTrcHis2C (Fig. 5A). By contrast, the which in turn would affect the efflux of H⫹. As shown in Fig.
growth of Ap-NapA1-2-expressing cells was more rapid than 6A, in the everted membrane vesicles expressing Ap-NapA1-2,
the growth of the cells expressing Ap-NapA1-1 and Syn- the fluorescence dequenching upon addition of NaCl was low
NapA1 when the growth medium contained 10 and 15 mM KCl when choline chloride (140 mM) was included in the assay
(Fig. 5A). The positive control cells with the pKT66 plasmid medium. By contrast, the fluorescence dequenching was sig-
carrying the K⫹ transport gene grew even in the defined me- nificantly higher when choline chloride was replaced with KCl
dium containing 3 mM KCl. These results indicate that Ap- (140 mM) (Fig. 6B). However, in the case of Ap-NapA1-1, the
NapA1-2 could partially complement the K⫹ uptake-deficient fluorescence dequenching was relatively high in both choline
mutant. chloride and KCl medium (Fig. 6C and D). Similar results were
We further determined the initial rate of K⫹ uptake, and the obtained for Li⫹-induced dequenching (Fig. 6E to H). These
results are shown in Fig. 5B. Cells expressing Ap-NapA1-2 data suggest that Ap-NapA1-2, but not Ap-NapA1-1, mediates
could take up K⫹, although the uptake rate was about one-half the exchange activity between Na⫹ and H⫹, as well as between
that of the positive control cells. In contrast, the K⫹ uptake Na⫹ and K⫹, and that Na⫹ could be replaced by Li⫹.VOL. 71, 2005 NapA-TYPE Na⫹/H⫹ ANTIPORTERS FROM CYANOBACTERIA 4181
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
FIG. 4. Comparison of Na⫹/H⫹ (A) and Li⫹/H⫹ (B) exchange activities of Ap-NapA1-1 and Ap-NhaP1. The experimental conditions were the
same as those described in the legend to Fig. 3. Each value is the average of three independent measurements.
Acidic amino acid residues Asp225, Asp226, and Glu129 in
the TM segment are essential for the activity. Alignment of the
deduced amino acid sequences (Fig. 1A) and a topological
model of Ap-NapA1-1 (Fig. 7) suggested that Asp225 and
Asp226 are the only conserved charged amino acid residues in
TM segments in the six antiporters. The function of acidic
amino acid residues in TM domains has not been reported
previously for any NapA-type antiporter. Therefore, we exam-
ined the effects of mutations replacing Asp225 and Asp226
with Asn and Glu. The D225N and D225E mutants did not
exhibit the Na⫹/H⫹ and Li⫹/H⫹ antiporter activities at all pHs
tested, and these two mutants could not complement the Na⫹-
and Li⫹-sensitive phenotypes of TO114 (data not shown). Es-
sentially the same results were obtained for D226E and D226N
mutants (data not shown). These results indicate that not only
the negative charges but also the side chains of Asp225 and
FIG. 5. KCl dependence on growth and K ⫹ uptake in E. coli cells
expressing Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1. (A) Growth
of K⫹ uptake-deficient control LB650 cells and cells expressing pKT66
(positive control), Ap-NapA1-1, Ap-NapA1-2, and Syn-NapA1 in min- FIG. 6. Effects of K⫹ on Na⫹/H⫹ and Li⫹/H⫹ exchange activities.
imum medium containing different concentrations of KCl. (B) K ⫹ Everted membrane vesicles were prepared using TCDS buffer. For
uptake of cells expressing pKT66. Ap-NapA1-1, Ap-NapA1-2, and panels A, C, E, and G, the assay medium contained 140 mM choline
Syn-NapA1 were detected with K⫹-depleted cells as described in Ma- chloride. For panels B, D, F, and H, KCl (140 mM) replaced choline
terial and Methods. KCl (2 mM) was added at zero time. K ⫹ contents chloride in the assay medium. (A, B, E, and F) Ap-NapA1-2-express-
of the cells were measured as described in Materials and Methods. ing cells; (C, D, G, and H) Ap-NapA1-1-expressing cells. (A to D)
Each value is the average of three measurements. Na⫹/H⫹ exchange activity; (E to H) Li⫹/H⫹ exchange activity.4182 WUTIPRADITKUL ET AL. APPL. ENVIRON. MICROBIOL.
Overexpression of Ap-NapA1-1 conferred salt tolerance on
the freshwater cyanobacterium Synechococcus sp. strain PCC
7942. We have shown previously that overexpression of Ap-
NhaP1 can confer salt tolerance on freshwater Synechococcus
sp. strain PCC 7942, making it able to grow even in seawater
(30). To examine the potential of Ap-NapA1-1 for abiotic
stress tolerance, we overexpressed Ap-NapA1-1 and Ap-
NhaP1 in freshwater Synechococcus sp. strain PCC 7942. As
shown in Fig. 8A, both the wild-type and transformed cells
could grow at almost the same rate in BG11 medium. How-
ever, in BG11 medium containing 0.4 M NaCl, the wild-type
cells could not grow, whereas the cells expressing Ap-NapA1-1
FIG. 7. Schematic secondary structure model of Ap-NapA1-1. and Ap-NhaP1 could grow under the same conditions (Fig.
Acidic and basic amino acid residues in the loop regions are indicated
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
by circled minus and plus signs, respectively. The conserved amino acid 8B). When the growth medium contained 0.5 M NaCl, only the
residues Gly140-Glu142 and Asp225-Asp226 are shown. E129 and cells expressing Ap-NhaP could grow (Fig. 8C). These results
K383 are charged amino acid residues not conserved among NapA indicate that overexpression of Ap-NapA1-1 could confer salt
antiporters. tolerance on a freshwater cyanobacterium. However, the po-
tential of Ap-NapA1-1 for salt tolerance was lower than that of
Ap-NhaP1.
Asp226 are crucial for the Na⫹/H⫹ and Li⫹/H⫹ exchange Overexpression of Ap-NapA1-1 conferred salt tolerance on
activities. the freshwater cyanobacterium Synechococcus sp. strain PCC
Figure 1A shows that Glu129 in Ap-NapA1-1 is a highly 7942 at alkaline pH. Since the exchange activities of Ap-
conserved charged amino acid residue in TM segments. In six NapA1-1, Ap-NapA1-2, and Syn-NapA1 were high at alkaline
antiporters, Glu is replaced with Asn only in GerN. We tested pH, we examined the salt tolerance of Synechococcus sp. strain
the role of Glu129 in Ap-NapA1-1. Mutation of Glu129 to Gln PCC 7942 cells at an alkaline pH. As shown in Fig. 9A, both
or Asp abolished the Na⫹/H⫹ and Li⫹/H⫹ exchange activities the wild-type and transformed cells could grow at almost the
(data not shown), indicating that Glu129 in the TM3 segment same rate in BG11 medium at pH 7.0 and 9.0. When 0.3 M
of Ap-NapA1-1 is also essential for the exchange activity. NaCl was present in BG 11 medium, faster growth was ob-
Site-directed mutagenesis of Glu142 in the loop region of served for the cells expressing Ap-NapA1-1 at pH 9.0 but not
Ap-NapA1-1. Figures 1 and 7 indicate that the tripeptide Gly- at pH 7.0 (Fig. 9A and B). These results suggest that Ap-
Leu-Glu in the loop region connecting the TM3 and TM4 NapA1-1 has an important role in salt tolerance at alkaline pH.
segments is conserved among the six antiporters. We therefore
investigated the effects of mutation of Glu142 to Gln and Asp DISCUSSION
on the exchange activities. The E142Q mutant lost the
Na⫹/H⫹ and Li⫹/H⫹ exchange activities at all pHs tested and In this paper, we show that the halotolerant cyanobacterium
could not complement the Na⫹- and Li⫹-sensitive phenotypes A. halophytica has two antiporters with the same polypeptide
of TO114 cells (data not shown). The E142D mutant exhibited size, Ap-NapA1-1 and Ap-NapA1-2. Based on the finding that
drastically reduced Na⫹/H⫹ and Li⫹/H exchange activities but the antiporter-deficient E. coli TO114 mutant cells became
could complement the Na⫹- and Li⫹-sensitive phenotypes with Na⫹ and Li⫹ tolerant after transformation with Ap-napA1-1
slower growth than the growth with wild-type Ap-NapA1-1 and Ap-napA1-2 (Fig. 2) and the finding that membrane ves-
(data not shown). These results suggest that the negative icles of these transformants exhibited the Na⫹/H⫹ and Li⫹/H⫹
charge on Glu142 and also partially its size have an important exchange activities (Fig. 3), these genes could be identified as
role in the salt tolerance. the Na⫹/H⫹ and Li⫹/H⫹ antiporter genes. However, the
FIG. 8. Salt tolerance of Synechococcus sp. strain PCC 7942 cells expressing Ap-NapA1-1 and Ap-NhaP1. Freshwater Synechococcus sp. strain
PCC 7942 cells transformed with the vector only (control), with Ap-NapA1-1, and with Ap-NhaP1 were grown in BG11 medium (A) or in BG11
medium containing 0.4 M NaCl (B) or 0.5 M NaCl (C) at pH 7.0. Each value is the average of three independent measurements.VOL. 71, 2005 NapA-TYPE Na⫹/H⫹ ANTIPORTERS FROM CYANOBACTERIA 4183
activity. The importance of Asp in the TM has been docu-
mented for several Na⫹/H⫹ antiporters; the important Asp
residues include Asp163 and Asp164 in E. coli NhaA (25),
Asp155 and Asp156 in Vibrio alginolyticus NhaA (17), and
Asp138 in Syn-NhaP1 (4). Several Na⫹/H⫹ antiporters do not
contain two consecutive negatively charged amino acids in the
TM segment. Nonetheless, all six NapA1-type antiporters
shown in Fig. 1A have consecutive Asp residues in the TM
domain. The molecular mechanisms of consecutive Asp resi-
dues for Na⫹/H⫹ exchange activity are an interesting issue.
The tripeptide Gly-Leu-Glu in the loop region connecting
TM segments is conserved in the six antiporters shown in Fig.
1. Previously, the role of this peptide has not been examined in
FIG. 9. Salt tolerance of Synechococcus sp. strain PCC 7942 cells
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
expressing Ap-NapA1-1. Freshwater Synechococcus sp. strain PCC any NapA-type antiporter. We therefore examined the role of
7942 cells transformed with the vector only (control) and with Ap- Glu142 in Ap-NapA1-1 in exchange activity and found that
NapA1-1 were grown in BG11 medium (open symbols) or in BG11 Glu is essential and cannot be replaced by Gln (see above).
medium containing 0.3 M NaCl (solid symbols) at pH 7.0 (A) and pH However, Asp could partially replace Glu. These results sug-
9.0 (B). Each value is the average of three independent measurements.
gest that the negative charge on the third amino acid residue in
the tripeptide is crucial for exchange activity.
Due to the failure to obtain a complete deletion of the
growth complementation of the K⫹ uptake-deficient mutant Syn-napA1 gene, Syn-napA1 has been proposed to be essential
(Fig. 5A), the K⫹ uptake activity (Fig. 5B), and the effects of for the survival of Synechocystis sp. strain PCC 6803 (3, 7, 33).
KCl on the exchange activity (Fig. 6) revealed that Ap- This situation contrasts with the results for Arabidopsis, in
NapA1-2 has unique properties; namely, K⫹ can partially re- which an NhaP homologous gene, SOS1, is crucial and con-
place H⫹. To our knowledge, the replacement of H⫹ with K⫹ tributes to salt tolerance, although Arabidopsis plants have
has not been reported previously for any transporter from many CPA-2-type antiporters which are homologous to NapA
photosynthetic organisms, such as plants and cyanobacteria. (24). Moreover, it should be noted that the NhaP-type anti-
The more rapid growth of E. coli cells expressing Ap-NapA1-2 porters Ap-NhaP1 and Syn-NhaP1 have high Na⫹/H⫹ ex-
than of the other expressing cells in the presence of 0.6 M NaCl change activities over a wide range of pHs (pH 6 and 9) and
(Fig. 2B) and 0.1 M LiCl (Fig. 2C) might have been due to the complement an Na⫹-sensitive E. coli mutant (4, 32), and over-
uptake of K⫹ in the former cells (Fig. 5). expression of Ap-NhaP1 in a freshwater cyanobacterium con-
One of the striking properties of Ap-NapA1-1, Ap- ferred salt tolerance on Synechococcus sp. strain PCC 7942
NapA1-2, and Syn-NapA1 antiporters is their pH dependence cells capable of growth in seawater (30). The data in Fig. 8
and roles in salt tolerance at alkaline pH (Fig. 3, 4, and 9). indicate that the salt tolerance of Synechococcus sp. strain PCC
Figures 3 and 4 show that the Na⫹/H⫹ and Li⫹/H⫹ exchange 7942 cells conferred by Ap-NapA1-1 is lower than that con-
activities of these NapA1-type antiporters significantly in- ferred by Ap-NhaP1. These data strongly suggest that Syn-
creased with increasing pH. This is in sharp contrast to the NhaP1 or Ap-NhaP1 could replace Syn-NapA1. Therefore, it is
previous results for Ap-NhaP1 and Syn-NhaP1, which exhibit still not clear why the Syn-napA1 gene could not be deleted.
high exchange activities over a wide pH range (pH 5.0 to 9.0) Further studies are required to understand the physiological
(5, 7). The pH dependence of Ap-NapA1-1, Ap-NapA1-2, and role of Ap-NapA1-1 and Ap-NapA1-2.
Syn-NapA1 was different from that of E. hirae NapA (34) and
that of B. cereus GerN (27), but it was similar to that of the E. ACKNOWLEDGMENTS
coli NhaA antiporter (25). The exchange activity of NapA This work was supported in part by grants-in-aid for scientific re-
decreased with increasing pH (34), whereas that of GerN was search from the Ministry of Education, Science and Culture of Japan
constant. In NhaA from E. coli (20) and Helicobacter pylori and the High-Tech Research Center of Meijo University. N.W. and
(28), several amino acid residues involved in pH sensing have A.I. were supported by the Thai government through the Thailand-
Japan Technology Transfer Project.
been identified. Therefore, it would be interesting to identify We thank Eiko Tsunekawa for her expert technical assistance.
the amino acid residues involved in pH sensing in Ap-
NapA1-1, Ap-NapA1-2, and Syn-NapA1. REFERENCES
Two consecutive Asp residues in TM6 (Asp225 and Asp226 1. Apse, M. P., and E. Blumwald. 2002. Engineering salt tolerance in plants.
Curr. Opin. Biotechnol. 13:146–150.
in the case of Ap-NapA1-1) are conserved in all six NapA-type 2. Blumwald, E., E. J. Cragoe, and R. J. Poole. 1987. Inhibition of Na⫹/H⫹
antiporters shown in Fig. 1. The role of these residues has not antiport activity in sugar beet tonoplast by analogs of amipride. Plant
been examined previously. Site-directed mutagenesis of Physiol. 85:30–33.
3. Elanskaya, I. V., I. V. Karandashova, A. V. Bogachev, and M. Hagemann.
Asp225 and Asp226 indicated that not only the negative charge 2002. Functional analysis of the Na⫹/H⫹ antiporter encoding genes of the
on the TM segment but also the configuration of the side chain cyanobacterium Synechocystis PCC 6803. Biochemistry (Moscow) 67:432–
440.
is important for the exchange activity; i.e., replacement of Asp 4. Hamada, A., T. Hibino, T. Nakamura, and T. Takabe. 2001. Na⫹/H⫹ anti-
with Glu resulted in a loss of exchange activity. A change of porter from Synechocystis species PCC 6803, homologous to SOS1, contains
one of the two Asp residues decreased the exchange activity an aspartic residue and long C-terminal tail important for the carrier activity.
Plant Physiol. 125:437–446.
(see above), indicating that two consecutive aspartates 5. Hibino, T., N. Kaku, H. Yoshikawa, T. Takabe, and T. Takabe. 1999. Mo-
(Asp225 and Asp226) in TM6 are required for the exchange lecular characterization of DnaK from the halotolerant cyanobacterium Aph-4184 WUTIPRADITKUL ET AL. APPL. ENVIRON. MICROBIOL.
anothece halophytica for ATPase, protein folding, and copper binding under 21. Rontein, D., G. Basset, and A. D. Hanson. 2002. Metabolic engineering of
various salinity conditions. Plant Mol. Biol. 40:409–418. osmoprotectant accumulation in plants. Metab. Eng. 4:49–56.
6. Hofmann, K., and W. Stoffel. 1992. PROFILEGRAPH: an interactive graph- 22. Saier, M. H., Jr., B. H. Eng, S. Fard, J. Garg, D. A. Haggerty, W. J.
ical tool for protein sequence analysis. Comput. Appl. Biosci. 8:331–337. Hutchinson, D. L. Jack, E. C. Lai, H. J. Liu, D. P. Nusinew, A. M. Omar, S. S.
7. Inaba, M., A. Sakamoto, and N. Murata. 2001. Functional expression in Pao, I. T. Paulsen, J. A. Quan, M. Sliwinski, T. T. Tseng, S. Wachi, and G. B.
Escherichia coli of low-affinity and high-affinity Na⫹(Li⫹)/H antiporters of Young. 1999. Phylogenetic characterization of novel transport protein fam-
Synechocystis. J. Bacteriol. 183:1376–1384. ilies revealed by genome analyses. Biochim. Biophys. Acta 1422:1–56.
8. Incharoensakdi, A., T. Takabe, and T. Akazawa. 1986. Role of the small 23. Southworth, T. W., A. A. Guffanti, A. Moir, and T. A. Krulwich. 2001. GerN,
subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase in the activation an endospore germination protein of Bacillus cereus, is an Na⫹/H⫹-K⫹
process. Arch. Biochem. Biophys. 248:62–70. antiporter. J. Bacteriol. 183:5896–5903.
9. Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. 24. Sze, H., S. Padmanaban, F. Cellier, D. Honys, N. H. Cheng, K. W. Bock, G.
Miyajima, M. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, Conejero, X. Li, D. Twell, J. M. Ward, and K. D. Hirschi. 2004. Expression
A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. patterns of a novel AtCHX gene family highlight potential roles in osmotic
Takeuchi, T. Wada, A. Watanabe, M. Yamada, M. Yasuda, and S. Tabata. adjustment and K⫹ homeostasis in pollen development. Plant Physiol. 136:
1996. Sequence analysis of the genome of the unicellular cyanobacterium 2532–2547.
Synechocystis sp. strain PCC6803. II. Sequence determination of the entire 25. Taglicht, D., E. Padan, and S. Schuldiner. 1991. Overproduction and puri-
genome and assignment of potential protein-coding regions. DNA Res. fication of a functional Na⫹/H⫹ antiporter coded by nhaA (ant) from Esch-
30:109–136.
Downloaded from http://aem.asm.org/ on February 23, 2021 by guest
erichia coli. J. Biol. Chem. 266:11289–11294.
10. Kempf, B., and E. Bremer. 1998. Uptake and synthesis of compatible solutes 26. Tani, K., T. Watanabe, H. Matsuda, M. Nasu, and M. Kondo. 1996. Cloning
as microbial stress responses to high-osmolality environments. Arch. Micro- and sequencing of the spore germination gene of Bacillus megaterium ATCC
biol. 170:319–330. 12872: similarities to the NaH-antiporter gene of Enterococcus hirae. Micro-
11. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the biol. Immunol. 40:99–105.
hydropathic character of a protein. J. Mol. Biol. 157:105–132. 27. Thackray, P. D., J. Behravan, T. W. Southworth, and A. Moir. 2001. GerN,
12. Lee, B. H., T. Hibino, J. Jo, A. M. Viale, and T. Takabe. 1997. Isolation and
an antiporter homologue important in germination of Bacillus cereus endos-
characterization of a dnaK genomic locus in a halotolerant cyanobacterium,
pores. J. Bacteriol. 183:476–482.
Aphanothece halophytica. Plant Mol. Biol. 35:763–775.
28. Tsuboi, Y., H. Inoue, N. Nakamura, and H. Kanazawa. 2003. Identification
13. Maser, P., S. Thomine, J. I. Schroeder, J. M. Ward, K. Hirschi, H. Sze, I. N.
of membrane domains of the Na⫹/H⫹ antiporter (NhaA) protein from
Talke, A. Amtmann, F. J. Maathuis, D. Sanders, J. F. Harper, J. Tchieu, M.
Helicobacter pylori required for ion transport and pH sensing. J. Biol. Chem.
Gribskov, M. W. Persans, D. E. Salt, S. A. Kim, and M. L. Guerinot. 2001.
278:21467–21473.
Phylogenetic relationships within cation transporter families of Arabidopsis.
Plant Physiol. 126:1646–1667. 29. Utsugi, J., K. Inaba, T. Kuroda, M. Tsuda, and T. Tsuchiya. 1998. Cloning
14. Munro, A. W., G. Y. Ritchie, A. J. Lamb, R. M. Douglas, and I. R. Booth. and sequencing of a novel Na⫹/H⫹ antiporter gene from Pseudomonas
1991. The cloning and DNA sequence of the gene for the glutathione- aeruginosa Biochm. Biophys. Acta 1398:330–334.
regulated potassium-efflux system KefC of Escherichia coli. Mol. Microbiol. 30. Waditee, R., T. Hibino, T. Nakamura, A. Incharoensakdi, and T. Takabe.
5:607–616. 2002. Overexpression of a Na⫹/H⫹ antiporter confers salt tolerance on a
15. Nakamura, C., J. G. Burgess, K. Sode, and T. Matsunaga. 1995. An iron- freshwater cyanobacterium, making it capable of growth in sea water. Proc.
regulated gene, magA, encoding an iron transport protein of Magnetospiril- Natl. Acad. Sci. USA 99:4109–4114.
lum sp. strain AMB-1. J. Biol. Chem. 270:28392–28396. 31. Waditee, R., T. Hibino, Y. Tanaka, T. Nakamura, A. Incharoensakdi, S.
16. Nakamura, T., N. Yamamuro, S. Stumpe, T. Unemoto, and E. P. Bakker. Hayakawa Y. Futsuhara, Y. Kawamitsu, T. Takabe, and T. Takabe. 2002.
1998. Cloning of the trkAH gene cluster and characterization of the Trk Functional characterization of betaine/proline transporters in betaine-accu-
K⫹-uptake system of Vibrio alginolyticus. Microbiology 144:2281–2289. mulating mangrove. J. Biol. Chem. 277:18373–18382.
17. Nakamura, T., Y. Komano, and T. Unemoto. 1995. Three aspartic residues in 32. Waditee, R., T. Hibino, Y. Tanaka, T. Nakamura, A. Incharoensakdi, and T.
membrane-spanning regions of Na⫹/H⫹ antiporter from Vibrio alginolyticus Takabe. 2001. Halotolerant cyanobacterium Aphanothece halophytica con-
play a role in the activity of the carrier. Biochim. Biophys. Acta 1230:170– tains an Na⫹/H⫹ antiporter, homologous to eukaryotic ones, with novel ion
176. specificity affected by C-terminal tail. J. Biol. Chem. 276:36931–36938.
18. Ohyama, T., K. Igarashi, and H. Kobayashi. 1995. Physiological role of the 33. Wang, H. L., B. L. Postier, and R. L. Burnap. 2002. Polymerase chain
chaA gene in sodium and calcium circulations at a high pH in Escherichia reaction-based mutageneses identify key transporters belonging to multigene
coli. J. Bacteriol. 176:4311–4315. families involved in Na⫹ and pH homeostasis of Synechocystis sp. PCC 6803.
19. Orlowski, J., and S. Grinstein. 1997. Na⫹/H⫹ exchangers of mammalian Mol. Microbiol. 44:1493–1506.
cells. J. Biol. Chem. 272:22373–22376. 34. Waser, M., D. Hess-Bienz, K. Davies, and M. Solioz. 1992 Cloning and
20. Rimon, A., T. Tzubery, L. Galili, and E. Padan. 2002. Proximity of cytoplas- disruption of a putative NaH-antiporter gene of Enterococcus hirae. J. Biol.
mic and periplasmic loops in NhaA Na⫹/H⫹ antiporter of Escherichia coli as Chem. 267:5396–5400.
determined by site-directed thiol cross-linking. Biochemistry 41:14897– 35. Zhu, J. K. 2003. Regulation of ion homeostasis under salt stress. Curr. Opin.
14905. Plant Biol. 6:441–445.You can also read
