Multiple Nuclear Gene Analysis of the Divergence Between Populations of the Tallapoosa Darter

 
CONTINUE READING
2010                         SOUTHEASTERN NATURALIST                       9(2):373––384

Multiple Nuclear Gene Analysis of the Divergence Between
          Populations of the Tallapoosa Darter,
                 Etheostoma tallapoosae

                                    Leos G. Kral*

Abstract - Populations of Etheostoma tallapoosae (Tallapoosa Darter) have previ-
ously been shown to be genetically divergent for mitochondrial DNA. In this study,
PCR primers were developed to amplify portions of six nuclear genes, and sequences
of these genes were assessed in three of the most divergent Tallapoosa Darter popula-
tions. This analysis shows that these populations are also highly divergent for nuclear
gene sequences and thus any adaptive or potentially adaptive variation is likely to be
partitioned among the populations. Sequences of the six nuclear genes have also been
determined in the closely related species E. coosae and E. brevirostrum, and the utility
of these nuclear gene sequences to the elucidation of darter phylogeny is discussed.

                                    Introduction
    Etheostoma tallapoosae Suttkus and Etnier (Tallapoosa Darter) is en-
demic to the Tallapoosa River system above the fall line (Suttkus and Etnier
1991). Analysis of mitochondrial DNA in a previous study (Brogdon et al.
2003) has shown that this species is subdivided into at least four genetically
divergent reproductively isolated populations that were designated as man-
agement units (MU) according to the denition of Moritz (1994a, 1994b).
These MUs do not share any mitochondrial haplotypes. The upper Tal-
lapoosa River MU and the Little Tallapoosa MU are the most divergent, with
a 1.6% mitochondrial sequence divergence. The mitochondrial sequence
divergence between the Enitachopco Creek MU and the upper Tallapoosa
River and Little Tallpapoosa River MUs is 1.04% and 1.10%, respectively.
The Jay Bird Creek MU is very closely related to the upper Tallapoosa River
MU, with a mitochondrial sequence divergence of 0.26%, and was not in-
cluded in this study. The maximum mitochondrial sequence divergence of
1.6% between the most genetically diverged populations is fairly low, and no
obvious morphological differences have been noted between those popula-
tions (Suttkus and Etnier 1991). Furthermore, since mitochondrial genomes
sort faster than nuclear genomes, it is not certain that these populations have
signicantly different allelic frequencies of nuclear genes such that actual
or potential adaptive diversity associated with the nuclear genome is parti-
tioned among the various populations.
    To help ascertain the degree of nuclear gene divergence in these
populations, PCR primers were developed to amplify portions of six single-
copy protein-coding nuclear genes. These primers are complementary to
*
Department of Biology, University of West Georgia, Carrollton, GA 30118; lkral@
westga.edu.
374                          Southeastern Naturalist               Vol. 9, No. 2
conserved exon sequences and also amplify the targeted gene segments from
other darter species (both Etheostoma and Percina). As such, these prim-
ers can be used to assess the nuclear genetic heterogeneity of other darter
species and may have utility in the estimation of darter phylogeny. Current
estimation of darter phylogeny is mainly based on morphological and mi-
tochondrial DNA sequence analysis (e.g., Near 2002, Porter et al. 2002),
although some recent studies utilize both mitochondrial sequences and in-
tron 1 of the nuclear S7 ribosomal protein gene (e.g., Keck and Near 2008).
The problem with estimating phylogeny with mitochondrial sequences alone
is that incorrect phylogenies may be inferred if hybridization has resulted in
mitochondrial introgression with subsequent replacement by drift or selec-
tive sweep in one of the species (Alves et al. 2003, Fredsted et al. 2006, Ray
et al. 2008). Basing phylogenies on single nuclear genes is also less accurate
than basing phylogenies on multiple nuclear genes (Edwards et al. 2007,
Gadagkar et al. 2005, Gontcharov et al. 2004, Liu et al. 2008).
    In this study, the nuclear sequence heterogeneity of six genes was deter-
mined in three Tallapoosa Darter populations, previously designated as the
most divergent MUs, to ascertain if nuclear gene divergence exists in these
populations. Using the six nuclear genes, relationships of these populations
were also assessed to the closely related species Etheostoma coosae Fowler
(Coosa Darter) and Etheostoma brevirostrum Suttkus and Etnier (Holiday
Darter) to determine the congruence of nuclear gene phylogenies and previ-
ously determined mitochondrial phylogenies (Brogdon et al. 2003, Porter et
al. 2002).

                          Materials and Methods
    PCR primers were designed to amplify portions of six protein-coding
genes for a total of about 10,900 base pairs of nuclear DNA, of which 3900
base pairs represent protein-coding exon sequences. The following gene
segments were ampli ed: Glyceraldehyde-3-phosphate dehydrogenase,
Ribosomal Protein S6, Lysophospholipase II, Phospholipase C-gamma-1,
Kelch Repeat and BTB (POZ) Domain Containing Protein, and an open
reading frame of about 1050 base pairs corresponding to an exon within a
gene of unknown function (designated the uORF gene). The PCR primers
are anchored within conserved exon sequences and amplify across distantly
related darter species (data not shown).
    All but one of the gene segments were initially characterized from
randomly selected cDNA clones of Tallapoosa Darter muscle/skin mRNA.
Orthologous genes and likely intron/exon structure of those genes were iden-
tied by alignments of the cDNA sequences with genomes of Denio rerio
Hamilton (Zebra Danio), Takifugu rubipres Temminck and Schlegel (Japa-
nese Puffersh), and Tetraodon nigroviridis de Proce (Green Puffer Fish) on
the Ensembl Blast server. Exon-anchored PCR primers were then designed
with Primer Premier (Biosoft) to amplify across each intron, and sizes of the
Tallapoosa Darter introns of these gene segments were determined. Final
2010                                  L.G. Kral                                   375
exon-anchored PCR primer pairs were designed that amplied about 1000
base pair segments, except in those cases where a single intron exceeded that
length. Intron/exon structures of gene segments and amplication products
of these gene segments are diagramed in Figure 1. PCR primers that amplify
the six genes in twelve fragments are listed in Table 1.

Figure 1. Intron/exon structure of gene fragments utilized in this study. Boxes rep-
resent exons and connecting lines represent introns. Gene fragments greater than
1000 nucleotides are amplied in segments, and these are indicated below each gene
fragment. Exons and portions of exons are labeled A, B, C, etc. in the downstream
direction and relative to the gene fragment characterized. Sizes of gene fragments are
specic for the Tallapoosa Darter population in the Tallapoosa River.
376                                  Southeastern Naturalist                   Vol. 9, No. 2
    The uORF gene was not identied from a cDNA clone, but rather was
identied from a clone of RAPD-PCR amplied genomic DNA. This
sequence is homologous to an exon of a gene present in T. rubripes and
T. nigroviridis, but it is possible that this uORF gene fragment is an ampli-
cation of a portion of a pseudo gene. However, since all indel mutations
of this uORF gene segment in the Tallapoosa Darter and the Coosa Darter
maintain an open reading frame (data not shown), it is likely that this gene
is functional in the darters.
    Some of the genomic DNA samples previously isolated for analysis of
Tallapoosa Darter population structure (Brogdon et al. 2003) were utilized
in this study. Specically, DNA was utilized from the three most genetically
divergent sets of populations previously identied as MUs by mitochondrial
DNA sequence analysis: MU 1——the population in the upper Tallapoosa
River system (8 individuals), MU 2——the population in the Little Tallapoosa
River system (10 individuals) and the population in the portion of the Tal-
lapoosa River system just south of Harris reservoir (8 individuals), and MU
3——the population in Enitachopco Creek (5 individuals).
    To minimize costs of identifying nucleotide differences xed in each MU
sample, PCR amplications were performed on combined genomic DNA
from multiple individuals. Equal amounts of genomic DNA from individuals

Table 1. Primers that amplify gene segments diagramed in Figure 1. Letters that follow gene
designation in the primer name correspond to exons as labeled in Figure 1.

Gene             Primer name                    Primer sequence 5’’ ĺ 3’’
uORF             uorf-sense                     CTCTTCTATTTTGCAGCACC
                 uorf-antisense                 TCCAGGTCCATGATTAGCT
Kelch            kelch-sense                    GCAAGAAACCAGGCTAAACA
                 kelch-antisesense              GCATGAAATGCCGACTGT
GAPDH            gapdh-sense                    GAGTCCACAGGTGTATTCACA
                 gapdh-antisense                GTCAGGTCAACCACGGACA
LPL              lplAC-sense                    CCCGATTCCCGTCACTCT
                 lplAC-antisense                GAGAAGCCACCGAGCATTAT
                 lplCE-sense                    ACCGTATAATGCTCGGTGG
                 lplCE-antisense                TGAGGGTTGACTATGGATTTGAG
                 lplDF-sense                    AGTTGGCTGGCATTGTGGC
                 lplDF-antisense                TTTGGGGCAAATACTTCTC
PLC              plcAC-sense                    CAGCAGCCAAGAAGAACTCA
                 plcAC-antisense                GGGCAGAGGGTCGTAGTT
                 plcCE-sense                    GTCATCCTTCCCTGAGACCA
                 plcCE-antisense                TATGCCGCGTCCGTGCTT
                 plcEF-sense                    ACGGACGCGGCATAGTTT
                 plcEF-antisense                CCACAAAGCGCAAGAAGG
S6               s6AB-sense                     CAAGGGTCACTCCTGCTACCG
                 s6AB-antisense                 CAACATACTGTCTAACGTCATCCTC
                 s6BC-sense                     CGGGCTTACCGACAGCAC
                 s6BC-antisense                 CAGCAGCTTGGCATACTCAGA
                 s6CD-sense                     GGCAAGAAGCCCAGAACTAA
                 s6CD-antisense                 CGCCTCTTGGCAATCTGTTC
2010                               L.G. Kral                               377
of each population were combined to form four population samples, and each
sample was amplied in 50-ul reactions containing 100 ng of the combined
DNA, 25 ul of Qiagen HotStarTaq Master Mix, and 0.5 uM concentration of
a sense primer and 0.5 uM concentration of the matching antisense primer.
The PCR conditions were identical for all twelve primer pair reactions:
95 °C for 15 minutes to activate the Taq polymerase, followed by 35 cycles
of 30 seconds at 94 °C, 1 minute at 55 °C, and 2 minutes at 72 °C. The nal
cycle was followed by a 10-minute incubation at 72 °C.
    Amplied PCR products were gel puried using the Qiagen Qiaquick Gel
Extraction kit or the Zymogen Zymoclean Gel DNA Recovery kit. The puri-
ed PCR products were then sequenced directly utilizing both the sense and
antisense PCR primers as sequencing primers. The puried PCR products
were also cloned into pSMART GC HK plasmids utilizing the Lucigen GC
Cloning and Amplication Kit according to manufacturers instructions, and
clones of the PCR products were sequenced utilizing the anking SL1 and
SR2 primers. Sequencing was carried out by Functional Biosciences, Inc.,
Madison, WI (www.functionalbio.com).
    Initial contig assembly from sequence alignments of direct PCR product
reads as well as two to three clones of each gene fragment were carried out in
GeneJockey II DNA analysis software (Biosoft). All variable site differences
that were xed in the population samples were identied by aligning gene
contigs of the four population samples with the direct PCR product sequence
traces in Geneious Pro bioinformatics software (Biomatters, Ltd.), and chro-
matogram peaks at each variable site were examined to ascertain lack of
nucleotide heterogeneity within each population. Eight independent clones
of each of the twelve PCR-amplied gene fragments from the combined Eni-
tachopco Creek genomic DNA samples were also sequenced, and sequence
heterogeneity observed among the cloned sequences was compared to that
observed in sequence traces obtained from a population mixture of PCR-
amplied DNA.
    Sequences of these six genes were also determined from individual Coo-
sa Darter and Holiday Darter samples by sequencing of both the direct PCR
products as well as two to three clones of those PCR products as described
above. Phylogenetic analyses were conducted using MEGA 4.0 software
(Kumar et al. 2008, Tamura et al. 2007).
    Exact test of population differentiation was carried out with ARLEQUIN
population genetics software version 3.1 (Excofer et al. 2005, Raymond
and Rousset 1995).

                                   Results
    A total of about 10,900 base pairs of single-copy genomic DNA was se-
quenced in each of three previously dened Tallapoosa Darter MUs, and 95
sites that are variable among these MUs were identied (Table 2). Of these
95 sites, 75 are single-nucleotide polymorphisms (SNPs), 18 are indels, and
2 are GT dinucleotide simple tandem repeats (STRs). Of the 93 sites that are
378                               Southeastern Naturalist                       Vol. 9, No. 2
either SNPs or indels, 89 of the variants have been veried as being xed in
each of the MU samples by examination of sequence traces. Four SNP sites,
identied as variable among the populations from sequences of cloned frag-
ments, could not be veried as being xed among the population samples
because the sequences of that portion of the gene fragment in combined
population samples were not of sufcient quality. Verication that heteroge-
neous sites would be detectable in sequence traces obtained from combined
DNA samples was obtained by a comparison of the sequence data from com-
bined Enitachopco Creek DNA samples and eight individually sequenced
clones of those DNA samples. The sites that were heterogeneous within the
direct PCR product sequence chromatograms of the combined population
sample proved to also be variable among the individual cloned sequences.
    The approximately 10,900 base pairs of DNA sequenced in this study are
composed of about 7000 base pairs of intron sequence and about 3900 base
pairs of exon sequence. The two STR loci, 17 of the 18 indels, and all but 13
of the 75 SNPs are located in the intron regions. All but one of the 13 SNPs
in the exon regions result in synonymous substitutions. The one SNP that
resulted in a non-synonymous substitution results in an arginine to a serine
substitution in the uORF gene. The one indel located in an exon region is a
deletion of two amino acids from the uORF sequence present in the upper
Tallapoosa River and Enitachopco Creek populations that maintains the same
Table 2. Nuclear gene sequence variation among populations. Only variable sites are shown
at their respective base numbers. Abbreviations within reference sequence: I = indel (+ in-
dicates sequence present and –– indicates sequence absent), S = STR (L, M, and S indicate
relative length). Abbreviations of populations: TR = Tallapoosa River, EC = Enitachopco
Creek, and LT = identical sequence in both Little Tallapoosa River and south of Harris
Reservoir populations.

Population      uOR       FK     GAPDH             LPL                    PLC
             0000000      00    0000000      00000000000        000000000000000000
             0000001      11    1222222      23333333444        555666666666667777
             3466790      14    9112677      90223359036        148113466788991345
             8223322      83    5385606      30691458103        090586857925066407
             1003813      50    0715139      24717666398        921378107141218060
             GAITTAT      TA    TGTTTTC      ACCACACGIST        GTIASCAGAATTCAIIGG
  TR         ..-....      ..    .......      ........+M.        ..+TL..C....A.-+.A
  EC         C.-....      A.    .T.....      ........+L.        ..+.S........G--..
  LT         .C+CCTC      .G    C.ACCCT      TTTGTCTT-SC        AG-.MTG.TGCG..++A.

                                                 S6
              00000000000000000000000000000000000111111111111111
              77888888888888888999999999999999999000000000000000
              89012234556677889000122246678888899002334555666789
              52670612474908029125328882286666707682780069148540
              85562561603164835628720728971789683772996952157115
              TCICTCTGAICATATIIICGIIGAAAACCTTGAAACIGIITITGTAIAIG
  TR          .T-.....T-.....--+..-+...GG..AGT....+A--.-....-.-.
  EC          ..-.AG...+.....-+-A.-+T.....T...G.G.+.++.+....+.-.
  LT          C.+A..GA.-TTCTC+--.T+-.GG..T.....G.A-.++C+CAAG+G+T
2010                                     L.G. Kral                                      379
reading frame as the sequence present in the Little Tallapoosa River popula-
tion as well as in the Coosa Darter and the Holiday Darter (data not shown).
    Variants of 89 SNP/indel sites appear to be xed in each of the three
MU samples. These 89 variable sites dene three ancestral alleles. At least
another 20 variable sites are not xed among the population samples (data
not shown) and represent variations in alleles derived from the three ances-
tral alleles. Thus, the three ancestral alleles and their derivatives are xed
among the Tallapoosa Darter population samples of the three separate MUs.
No attempt has been made to reconstruct the derived alleles since the intra
population variable sites were primarily identied in sequence traces of
mixed-population PCR-amplied gene fragments and three of the complete
gene sequences were reconstructed from multiple fragments.
    Statistical tests of population divergence can not be performed directly
because population sequence data was obtained from combined DNA samples
and not from individuals. A single ancestral allele type was detected in the
combined sequence data from 5 to 10 individuals of a population (potentially
10 to 20 different alleles), but it is possible that a few copies of the other
ancestral alleles may be present in the sample and these escaped detection.
In an attempt to determine if the combined data of this small sample size
could support nuclear genetic divergence among populations, an exact test
of population differentiation (Raymond and Rousset 1995) was performed
utilizing worst-case scenario where each population sample contained only
80% of the detected allele and 10% of each of the other two alleles. The
populations previously dened as MUs show signicant differences under
these simulated conditions (Table 3). Note that the Little Tallapoosa River
and south of Harris Reservoir populations are part of the same MU and show
no signicant differentiation.
    Maximum parsimony (MP), neighbor joining, minimum evolution,
and UPGMA analyses of individual genes and concatenated sequences
of all genes were performed for all three Tallapoosa Darter MUs as well
as the Holiday Darter and the Coosa Darter. All analyses of concatenated
sequences resulted in the same tree topologies as the MP tree shown in
Figure 2. Twenty-one of the 327 variable sites in the concatenated gene
sequences among the three species were parsimony-informative. Topologies
of trees obtained for individual genes were essentially concordant with the
concatenated dataset except for the uORF gene, where the Holiday Darter

Table 3. Nuclear genetic differentiation of Tallapoosa Darter populations under simulated
condition of 80% population specic allele frequency. Signicance level (P-value) of non-
differentiation test. Abbreviations: NS = not signicant, TR = Tallapoosa River, LT = Little
Tallapoosa River, HR = south of Harris Reservoir, and EC = Enitachopco Creek.

                  TR                          LT                         HR
TR
LT         0.00319 ± 0.0005
HR         0.00558 ± 0.0006                1.0 (NS)
EC         0.02853 ± 0.0014            0.01790 ± 0.0013           0.02555 ± 0.0016
380                               Southeastern Naturalist                      Vol. 9, No. 2
partitions within the Tallapoosa Darter clade (data not shown). The uncor-
rected pairwise sequence divergence of the concatenated genes between the
Tallapoosa Darter populations ranged from 0.17% to 0.55% (Table 4), and
the average distance between Tallapoosa Darter populations and the Holiday
Darter averaged 0.84% (0.80% to 0.88%, Table 4).

                                      Discussion
    Analysis of nuclear DNA sequences showed that the Tallapoosa Darter
populations previously identied as being genetically diverged for mito-
chondrial haplotypes (Brogdon et al. 2003) are also genetically diverged
for single-copy nuclear protein-coding genes. Of the approximately 10,900
nucleotides sequenced, 89 variable sites have been conrmed as xed among
the population samples analyzed. These xed differences show that the MU
samples are each homogeneous for one major ancestral allele type at each
of the six loci examined, and heterogeneity within each MU sample is com-
prised of variants of those ancestral allele types. The sample size is sufcient
to determine that signicant nuclear gene divergence is partitioned among
the MUs (Table 3), but the total number of individuals examined is not great
enough to conclude that these allele-frequency differences are xed in the
actual populations from which the samples were analyzed.
    The variation observed at the six gene fragments examined in these MU
samples is, with the possible exception of the two codon deletion and non-
synonymous substitution in the uORF gene, most likely neutral variation.

Figure 2. Maximum parsimony phylogram of combined nuclear gene sequences.
Bootstrap values (1000 replicates) are given at branches. Abbreviations: TR = Tal-
lapoosa River, EC = Enitachopco Creek, LT = Little Tallapoosa River, BR = Holiday
Darter, and CS = Coosa Darter.

Table 4. Uncorrected sequence divergence of combined nuclear gene sequences. Abbreviations:
TR = Tallapoosa River, EC = Enitachopco Creek, LT = Little Tallapoosa River, BR = Holiday
Darter, and CS = Coosa Darter.

                   TR                 EC                     LT                BR
TR
EC               0.17%
LT               0.55%               0.51%
BR               0.85%               0.80%                  0.88%
CS               2.55%               2.51%                  2.61%             2.78%
2010                               L.G. Kral                               381
The high level of allelic divergence present among these MUs suggests that
any non-neutral or potentially non-neutral mutations present in the genome
are likely not homogeneously distributed among the populations. Since no
obvious morphological differences are evident in these genetically divergent
populations, such potentially non-neutral variation would represent cryptic
variation that may be adaptive (potential adaptive variation) under new
environmental conditions or change in genetic background such as future
hybridization between populations or accumulation of new mutations (Le
Rouzic and Carlborg 2007).
    Brogdon et al. (2003) designated populations of the Tallapoosa Darter as
MUs based on mitochondrial sequence divergence, and this study character-
ized these MUs as showing a high degree of nuclear gene variation. These
results strengthen the need to monitor these populations as MUs since it is
likely that potential adaptive variation is sequestered among these popula-
tions. Maintenance of such variation enhances the evolutionary potential
of the species. Fixation of advantageous traits by drift or selection is more
likely and occurs faster if advantageous alleles are already present with
multiple copies in a population than if such alleles have to arise de novo by
mutation (Barrett and Schluter 2008).
    A number of studies have demonstrated that clades dened by mitochon-
drial haplotype variation within a darter species are distributed among river
drainages (Krabbenhoft et al. 2008, Piller et al. 2008, Powers et al. 2004,
Ray et al. 2006), as well as allopatrically distributed among tributatries
within major drainages (Hollingsworth and Near 2009, Krabbenhoft et al.
2008). Etheostoma blenniodes Ranesque (Geenside Darter) clades dened
by intron 1 of the S7 ribosomal protein gene also are distributed among river
drainages (Piller et al. 2008), and populations of Etheostoma mariae Fowler
(Pinewood Darter) showed signicant genetic structuring based on AMOVA
of S7 intron 1 sequence analysis (Krabbenhoft et al. 2008). Segregation of
nuclear gene variation is, therefore, likely sequestered among populations
of other darter species as well. It may well be worthwhile to apply the mul-
tigenic analysis presented in this study to populations of other darter species
to more fully dene the segregation of nuclear genetic variation among their
populations. As new low-cost, high-throughput sequencing methodologies
are becoming available, a more thorough quantitative study of such varia-
tion should become practical in the near future. The elucidation of darter
evolution will be more complete if an analysis of a signicant sampling of
nuclear gene variation complements analysis of mitochondrial and micro-
satellite markers as well as morphological variation.
    Along with the studies of Krabbenhoft et al. (2008) and Hollingsworth
and Near (2009), this study shows that variation within a darter species does
not only occur among major drainages, but also can occur among tributaries
within a drainage. This result shows that allopatric darter evolution occurs
at much smaller geographic scales than previously thought. This phenom-
enon is common across three major eastern US drainages, the Atlantic slope
382                           Southeastern Naturalist                Vol. 9, No. 2
(Krabbenhoft et al. 2008), the Cumberland (Hollingsworth and Near 2009),
and the Mobile (this study). The relatively low-cost method utilized in this
study is effective in identifying nuclear genomic variation at these small
geographic scales.
    It has also been demonstrated that multigenic analysis based on the six
genes utilized in this study is suitable for analysis of darter phylogeny.
The cladograms obtained from multigenic analysis (Fig. 2) are concordant
with cladograms of the same species obtained by mitochondrial sequence
analysis (Brogdon et al. 2003, Porter et al. 2002). At the population level,
analysis of the Tallapoosa Darter mtDNA haplotype data from Brogdon et al.
(2003) shows that the Tallapoosa River MU and the Little Tallapoosa River
MU are evolutionarily about equidistant from the Enitachopco Creek MU.
However, multigenic analysis shows that the Tallapoosa River MU and the
Enitachopco Creek MU are more closely related to each other than either is
to the Little Tallapoosa MU (Fig. 2, Table 4). This discrepancy is likely due
to faster lineage sorting of the haploid unisexually transmitted mitochondrial
genome, which would be more susceptible to genetic drift than the nuclear
genome. Furthermore, the multigenic analysis is based on a larger number
of presumably independently assorting genes, whereas mitochondrial hap-
lotypes represent essentially a single locus. Thus, it is likely that multigenic
analysis may provide a better understanding of the evolutionary relatedness
of populations than mitochondrial sequence analysis in situations where
populations are divergent at nuclear loci.
    The major problem with reconstruction of phylogenies with nuclear
genes is that sorting of gene lineages may be independent of speciation
events (Maddison 1997, Moore 1995, Nichols 2001). That is, alleles of genes
that have arisen prior to any speciation events may be stochastically sorted
during subsequent speciation events. Under these conditions, phylogeny
reconstruction using single genes may be incongruent. An example of this is
seen in the phylogeny of the Tallapoosa Darter based only on the uORF gene,
where Tallapoosa Darters and the Holiday Darter are not resolved as separate
lineages (data not shown). Utilization of multiple genes increases accuracy.
Utilizing a dataset of 106 orthologous genes in eight species of yeast, Rokas
et al. (2003) found that concatenations of 20 or more genes provided ac-
curate trees with >95% bootstrap values at each branch. Bootstrap support
of >70% was obtained with as few as three concatenated genes. Using com-
puter simulations, Gadagkar et al. (2005) have found that concatenations of
10 genes provide >95% accuracy. The phylogenetic trees were generated in
this study from concatenated gene sequences. It should be noted that under
some conditions concatenated data do not produce accurate species trees
(Kubatko and Degnan 2007). A number of statistical methodologies are be-
ing developed to estimate species trees from multiple nuclear gene and allele
DNA sequence data (Brumeld et al. 2008, Edwards et al. 2007, Liu et al.
2008). Regardless of methodology, it will probably be necessary to develop
primers for more single-copy nuclear genes than the six genes utilized in this
study to increase accuracy of estimated darter species relationships.
2010                                  L.G. Kral                                   383
                                Acknowledgments
    I thank Ian Stansbury, Catherine Singleton, Levy Trusty, Gregory Ayuk, and Ivey
Holland, students in the department of biology at the University of West Georgia, for
laboratory assistance during various phases of this project. I also thank Thomas Near
for DNA samples of E. coosae and E. brevirostrum. I further thank all the reviewers
of this manuscript for many helpful comments. This study was supported by Faculty
Research Grant and Faculty Research Enhancement Award funds obtained from the
University of West Georgia.

                                 Literature Cited
Alves, P.C., N. Ferrand, F. Suchentrunk, and D.J. Harris. 2003. Ancient introgres-
   sion of Lepus timidus mtDNA into L. granatensis and L. europaeus in the Iberian
   Peninsula. Molecular Phylogenetics and Evolution 27:70––80.
Barrett, R.D.H., and D. Schluter. 2008. Adaptation from standing genetic variation.
   Trends in Ecology and Evolution 23:38––44.
Brogdon, S.M., C.R. Tabit, and L.G. Kral. 2003. Population structure of the Tal-
   lapoosa Darter (Etheostoma tallapoosae). Southeastern Naturalist 2:487––498.
Brumeld, R.T., L. Liu, D.E. Lum, and S.V. Edwards. 2008. Comparison of species
   tree methods for reconstructing the phylogeny of Bearded Manakins (Aves: Pipri-
   dae: Manacus) from multilocus sequence data. Systematic Biology 57:719––731.
Edwards, S.V., L. Liu, and D.K. Pearl. 2007. High-resolution species trees without
   concatenation. Proceedings of the National Academy of Sciences of the United
   States of America 104:5936––5941.
Excofer, L., G. Laval, and S. Schneider. 2005. Arlequin ver. 3.0: An integrated soft-
   ware package for population genetics data analysis. Evolutionary Bioinformatics
   Online 1:47––50.
Fredsted, T., T. Wincentz, and P. Villesen. 2006. Introgression of Mountain Hare
   (Lepus timidus) mitochondrial DNA into Brown Hares (Lepus europaeus) in
   Denmark. BMC Ecology 6:17––22.
Gadagkar, S.R., M.S. Rosenberg, and S. Kumar. 2005. Inferring species phylogenies
   from multiple genes: Concatenated sequence tree versus consensus gene tree.
   Journal of Experimental Zoology (Molecular and Developmental Evolution)
   304B:64––74.
Gontcharov, A.A., B. Marin, and M. Melkonian. 2004. Are combined analyses better
   than single gene phylogenies? A case study using SSU rDNA and rbcL sequence
   comparisons in the Zygnematophyceae (Streptophyta). Molecular Biology and
   Evolution 21:612––624.
Hollingsworth, P.R., and T.J. Near. 2009. Temporal patterns of diversication and
   microendemism in eastern highland Barcheek Darters (Percidae: Etheostomati-
   nae). Evolution 63:228––243.
Keck, B.P., and T.J. Near. 2008. Assessing phylogenetic resolution among mito-
   chondrial, nuclear, and morphological datasets in Nothonotus darters (Teleostei:
   Percidae). Molecular Phylogenetics and Evolution 46:708––720.
Krabbenhoft, T.J, F.C. Rohde, A.N. Leibman, and J.M. Quattro. 2008. Concordant
   mitochondrial and nuclear DNA partitions dene evolutionarily signicant units
   in the imperiled Pinewoods Darter, Etheostoma mariae (Pisces: Percidae). Co-
   peia 2008:909––915.
Kubatko, L.S., and J.H. Degnan. 2007. Inconsistency of phylogenetic estimates from
   concatenated data under coalescence. Systematic Biology 56:17––24.
384                            Southeastern Naturalist                   Vol. 9, No. 2
Kumar, S., M. Nei, J. Dudley, and K. Tamura. 2008. MEGA: A biologist-centric
    software for evolutionary analysis of DNA and protein sequences. Briengs in
    Bioinformatics 9:299––306.
Le Rouzic, A., and O. Carlborg. 2007. Evolutionary potential of hidden genetic
    variation. Trends in Ecology and Evolution 23:33––36.
Liu, L., D.K. Pearl, R.T. Brumeld, and S.V. Edwards. 2008. Estimating species trees
    using multiple-allele DNA sequence data. Evolution 2080––2091.
Maddison, W.P. 1997. Gene trees in species trees. Systematic Biology 46:523––536.
Moore, W.S. 1995. Inferring phylogenies from mtDNA variation: Mitochondrial
    gene trees versus nuclear gene trees. Evolution 49:718––726.
Moritz, C. 1994a. Dening ““evolutionary signicant units”” for conservation. Trends
    in Ecology and Evolution 9:373––375.
Moritz, C. 1994b. Applications of mitochondrial DNA analysis in conservation: A
    critical review. Molecular Ecology 3:401––411.
Near, T.J. 2002. Phylogenetic relationships of Percina (Percidae: Etheostomatinae).
    Copeia 2002:1––14.
Nichols, R. 2001. Gene trees and species trees are not the same. Trends in Ecology
    and Evolution 16:358––364.
Piller, K.R., H.L. Bart, and D.L. Hurley. 2008. Phylogeography of the Greenside
    Darter complex, Etheostoma blennioides (Teleostomi: Percidae): A wide-ranging
    polytypic taxon. Molecular Phylogenetics and Evolution 46:974––985.
Porter, B.A., T.M. Cavender, and P.A. Fuerst. 2002. Molecular phylogeny of the
    snubnose darters, subgenus Ulocentra (Genus Etheostoma, Family Percidae).
    Molecular Phylogenetics and Evolution 22:364––374.
Powers, S.L., R.L. Mayden, and D.A. Etnier. 2004. Conservation genetics of the
    Ashy Darter, Etheostoma cinereum (Percidae: subgenus Allohistium), in the
    Cumberland and Tennessee Rivers of the southeastern United States. Copeia
    2004:632––637.
Ray, J.M., R.M. Wood, and A.M. Simons. 2006. Phylogeography and post-glacial
    colonization patterns of the Rainbow Darter, Etheostoma caeruleum (Teleostei:
    Percidae). Journal of Biogeography 33:1550––1558.
Ray, J.M., N.J. Lang, R.M. Wood, and R.L. Mayden. 2008. History repeated: Recent
    and historical mitochondrial introgression between the Current Darter Etheosto-
    ma uniporum and Rainbow Darter Etheostoma caeruleum (Teleostei: Percidae).
    Journal of Fish Biology 72:418––438.
Raymond, M., and F. Rosset. 1995. An exact test of population differentiation. Evo-
    lution 49:1280––1283.
Rokas, A., B.L. Williams, N. King, and S.B. Carroll. 2003. Genome-scale approach-
    es to resolving incongruence in molecular phylogenies. Nature 425:798––804.
Suttkus, R.D., and D.A. Etnier. 1991. Etheostoma tallapoosae and E. brevirostrum,
    two new darters, subgenus Ulocentra, from the Alabama River drainage. Tulane
    Studies in Zoology and Botany 28:1––24.
Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular evolution-
    ary genetics analysis (MEGA) software version 4.0. Molecular Biology and
    Evolution 24:1596––1599.
You can also read