Journal of Plant Protection Research
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Jour nal o f P la n t Pro t e ct io n R e s e a rc h ISSN 1427-4345
ORIGINAL ARTICLE
Characterization of Turkish isolates of Pseudocercospora griseola
the causal agent of angular leaf spot of common beans
Sirel Canpolat1*, Salih Maden2
1
Department of Phytopathology, Ankara Plant Protection Central Research Institute, Ankara, Turkey
2
Department of Plant Protection, Faculty of Agriculture, Ankara University, Ankara, Turkey
Vol. 61, No. 1: 95–102, 2021 Abstract
DOI: 10.24425/jppr.2021.136273
Characterization of angular leaf spot (ALS) disease of beans caused by Pseudocercospora
griseola (Sacc.) Crous & Braun along with its occurrence was investigated using 118 isolates
Received: July 7, 2020 obtained from beans grown in greenhouses in the western Black Sea region of Turkey. In-
Accepted: August 24, 2020 cidences of ALS disease ranged between 77–100% and 82–100% for summer and autumn
sown bean cultivations while the disease severity was in the ranges of 66–82% and 74–86%
*Corresponding address: for the same periods, respectively. All of the 118 isolates of P. griseola yielded 500–560 bp
sirelozan_18@hotmail.com PCR products from ITS1 and ITS4 primers, while 45 isolates yielded 200–250 bp products
from actin genes primer and 5 isolates yielded 300–350 bp from calmodulin primer. The
form of the Turkish isolates of P. griseola was determined as f. griseola since ITS sequences
of 118 isolates of P. griseola showed between 98–100% similarity to the isolates of P. griseola
f. griseola deposited in GenBank and our isolates took place on the same branch on the
phylogenetic tree formed by the representative isolates in GenBank. The actin sequences
did not give a clear differentiation for the forms of P. griseola. The phylogenetic trees gener-
ated by ITS1, ITS2 and actin genes formed similar branches. Each had two main clade and
similar sub clades.
Keywords: angular leaf spot, bean, disease, fungus
Introduction
Common bean (Phaseolus vulgaris L.) when used to- DNA (nrDNA), since it showed indistinguishable
gether with cereals is a valuable crop to maintain a bal- characteristics from other hyphomycete anamorph
anced diet in order to prevent some serious diseases genera associated with Mycosphaerella, namely Pseu-
such as coronary diseases and diabetes (Viguiliouk docercospora and Stigmina (Crous et al. 2006). These
et al. 2017). Angular leaf spot (ALS) disease of com- researchers also identified two gene pools in the pop-
mon bean occurs in many tropical and subtropical ulation of P. griseola and named them Andean and
countries on all the continents of the world, especially Middle-American. They also delineated two groups
in areas having humid and warm climates. Although within P. griseola, which are recognised as two for-
the disease takes its name from the leaf spot symp- mae, namely f. griseola and f. mesoamericana by fur-
toms, it affects all the plant parts causing brown circu- ther analysis of morphology, cultural characteristics,
lar spots on the pods and seeds. ALS can cause severe and DNA sequences of the internal transcribed spacer
crop damage, and up to 70% loss. (ITS), calmodulin, and actin gene regions. The causal
ALS on common bean is caused by a fungus which agent is also known as Isariopsis griseola (Sacc.) and
has recently been named as Pseudocercospora griseola Phaeoisariopsis griseola (Sacc.) Ferraris.
(Sacc.) Crous & Braun based on the sequence analysis Common bean cultivation in greenhouses espe-
of the small subunit (SSU) region of nuclear ribosomal cially in two provinces in the western Black Sea region
96 Journal of Plant Protection Research 61 (1), 2021
of Turkey, Zonguldak and Bartın, has increased. Re- taking a transact walk along the rows and across the
cently, a new disease, causing gray to brown, angular selected greenhouse. Disease severity was evaluated
leaf spots on the leaves has been determined. When by using the 1 to 9 scale of Schoonhoven and Pastor-
the intensity of the disease was high, leaf shed follow- -Corrales (1987) as follows: 1 – no visible symptoms of
ing the yellowing of the leaves occurred. The causal the disease, 3 – presence of a few, small non-sporulat-
agent of the disease was initially identified as P. grise- ing lesions covering approximately 2% of the leaf area,
ola. This study was aimed to determine dissemination 5 – the presence of several, generally small lesions with
and severity of the disease, which is probably one of limited sporulation covering approximately 5% of the
the greatest problems of greenhouse bean cultivation leaf area, 7 – abundant and generally large sporulating
in the region. This paper also deals with further identi- lesions covering approximately 10% of the leaf area,
fication and molecular characterization of ALS disease 9 – 25% or more of the leaf area covered by large sporu-
occurring in Turkey. lating and often coalescing lesions. The coordinates of
each sampled site in the greenhouse was recorded by
GPS. Disease severity was calculated by Townsend and
Materials and Methods Heuberger’s (1943) formula as below:
Disease severity (%)
Sampling and isolations
(No. of lives at each scale × Scale value)
ALS symptoms were observed in many greenhouses 100.
Highest scale value (9) × Total no. of leaves (50)
growing beans in Bartın and Zonguldak provinces,
Turkey. Pseudocercospora griseola isolates were ob-
tained from samples collected from naturally infected
DNA extraction and PCR amplification
leaves and pods of common bean. Greenhouses grow-
ing beans were visited once a week and samples were For DNA extraction, 100 mg P. griseola mycelium
collected from the plants showing ALS symptoms. The grown on malt extract agar (MEA) was scraped,
samples were taken at seedling-flowering and pod- weighed and treated with liquid nitrogen. After freez-
harvest stages from the greenhouses representing the ing and crushing, DNA extraction was performed
provinces by the random sampling method described according to the protocol of DNeasy plant kit (QIA-
by Bora and Karaca (1970). Data regarding cultivars, GEN Inc. Valencia, CA). The obtained DNAs were
their seed size and color, growth habits, and location stored at –20°C for use of PCR. The amount and
were recorded during the collection of diseased sam- purity of the obtained DNAs were determined as
ples. For fungal sporulation, tissues from infected bean ng ∙ µl–1 by using the NANODROP spectrophotom-
leaves were placed on moistened filter papers in Petri eter (Thermo Scientific 2000) by reading at absorb-
dishes, and were incubated at room temperature for ance values of 260, 280, 260/280, and 260/230 nm,
3 to 4 days. Conidia from sporulated ALS lesions were using ultra-pure water as a blind. Spectrophotometric
picked up with a tiny piece of agar placed on the tip of readings were performed with three replications.
a sterile dissecting needle, streaked onto V-8 juice agar, PCR amplification of the DNAs was performed by
and then incubated for 24 h at 24°C. Individual germi- using general primers of three different conserved re-
nated conidia were then transferred to V-8 juice agar to gions of the causal agent which were, respectively, ACT-
obtain monosporic cultures for each P. griseola isolate. -512F ATGTGCAAGGCCGGTTTCGC, ACT-783R
TACGAGTCCTTCTGGCCCAT (200–300 bp), CAL-
-228F AGTTCAAGGAGGCCTTCTCCC, CAL-737R
Disease incidence and severity
CATCTTTCTGGCCAT (300–350 bp), ITS1: TCCG
Surveys were conducted in Karabük, Bartın and Zon- TAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATT
guldak provinces of the north-western part of Turkey. GATATGC (500–560 bp). The implemented PCR cy-
Observations were made between May–December cle program was followed (Crous et al. 2006). The PCR
2011. Locations were selected based on their bean pro- products were carried out and monitored by electro-
duction intensity comprising 39% of the total produc- phoresis at 100 volts in 1× TBE (40 mM Tris-borate,
tion area. Sampling was carried out randomly by select- 1 mM EDTA, pH 8.0) buffer loaded onto 1.5% agarose
ing 42 greenhouses per location 2 km away from each gel in the following order. DNA sequences were per-
other. In each greenhouse plot, incidence and severity formed by GENOKS (Gazi Mah. Silahtar Cd. No: 67,
were estimated visually at several systematically se- 06560, Yenimahalle/Ankara). In addition, DNA se-
lected sampling sites. Disease incidence was expressed quences of PCR products using general primers were
as the percentage of infected plants of the 50 plants extracted and compared with respective sequences in
picked. Disease severity was assessed by evaluating the NCBI (National Centre for Biotechnology Infor-
50 bean leaves from different parts of the greenhouse mation).
Sirel Canpolat and Salih Maden: Characterization of Turkish isolates of Pseudocercospora griseola the causal agent… 97
Determination of the form
of Pseudocercospora griseola
and phylogenetic analysis of the isolates
PCR products were separated in 1.5% agarose gels,
stained with ethidium bromide and visualized under
UV light. Sequence analysis of the products was done.
For determination of the forms, nucleotide sequences
were blasted to NCBI BLAST search, and the form of the
isolates was identified according to the homology with
sequences already present in GenBank. The nucleotide
sequences of the bean isolates were stored in Gen
-Bank with accession numbers MK483911-MK483944,
MK483661-MK483699, MT445197-MT445217. Ma
ximum parsimony (MP) analysis was used in phylo-
genetic analysis of DNA sequences to specify genetic
differences among isolates. For phylogenetic analyses,
sequence information was transferred to MEGA 6.0
program and genetic similarity between isolates was
evaluated by creating a dendrogram (Tamura et al.
2013). A phylogenetic tree was also constructed by
using 21 isolates of ours and some isolates of f. gri-
seola and f. mesoamericana deposited in GenBank.
Phylogenetic trees were also constructed by using both
73 isolates selected from 118 ITS gene sequences.
Results
Fig. 1. Some characteristics of angular leaf spot (ALS) disease
caused by Pseudocercospora griseola: A – leaf spots, B – pod spots,
Characteristics of angular leaf spot disease C – conidiophores, D – conidia, E – fourteen-day-old colony on
MEA, F – on V8 juice agar
Although the disease takes its name from the leaf spots
seen on leaves (Fig. 1A), it also infects the pods and
produces round, slightly depressed lesions (Fig. 1B). Molecular characterization of Turkish isolates
The fungus P. griseola profusely sporulated on leaf le- of Pseudocercospora griseola
sions when humidity was high and produced fascicu-
late conidiophores (Fig. 1C) forming multi-celled, dark All of the 118 isolates of P. griseola yielded 500–560 bp
colored, elongate conidia (Fig. 1D). Pseudocercospora PCR products from ITS1and ITS4 primers (Fig. 3A),
griseola grew very slowly on culture media, producing while 45 isolates yielded 200–250 bp products from ac-
dark colored colonies on MEA (Fig. 1D) and V8 juice tin genes (Fig. 3B) and five isolates yielded 300–350 bp
agar (Fig. 1E). from calmodulin primer (Fig. 3C).
The form of our isolates of P. griseola was deter-
mined as f. griseola since ITS sequences of our 118 iso-
Disease incidence and severity in the western
lates of P. griseola showed between 98–100% similar-
Black Sea region of Turkey
ity to the isolates of P. griseola f. griseola deposited in
About 73, 44 and 30% of the total greenhouse areas of GenBank. The similarity of the ITS sequences of these
Karabük, Bartın and Zonguldak provinces were moni- isolates to P. griseola f. mesoamericana was 90–92%.
tored, respectively. All isolates were obtained from In the tree generated by our 21 selected isolates and
common beans showing angular leaf spot symptoms. four isolates from each formae of P. griseola depos-
ALS disease incidence ranged between 77–100% and ited in GenBank, all of our isolates took place in the
82–100% for summer and autumn sown bean cultiva- same clade with f. griseola (Fig. 4). Based on morpho-
tions while disease severity was in the ranges of 66–82% logical characteristics (Fig. 1) and sequencing the ITS
and 74–86% for the same periods, respectively. Autumn (Fig. 4), our isolates were identified as P. griseola f. gri-
sowing periods were slightly higher (Table 1). GPS seola. The genetic relatedness between ITS and actin
points of sampling greenhouses are given in Figure 2. sequences obtained from the present study, selected as98 Journal of Plant Protection Research 61 (1), 2021
Table 1. Percent disease incidence and severity of angular leaf spot disease of common bean in the greenhouses in districts of three
provinces of western Anatolia region of Turkey
Percent of disease incidence Percent of disease severity
Provinces/district
spring sown autumn sown spring sown autumn sown
Bartın Central 70.5–100 82.7–100 66.3–82.7 74.4–86.3
Devrek 77.1–100 85.1–100 71.4–100 86.7–100
Zonguldak Gökçebey 81.8–100 87.1–100 78.5–100 85.7–100
Çaycuma 78.7–100 89.1–100 81.7–100 84.9–100
no ALS was found in commercial bean growing areas. Only one plant had disease in a home
Karabük Yenice
garden with a transient plastic cover
Fig. 2. Distribution of the greenhouses sampled in three pro
vinces
representative of Pseudocercospora griseola f. griseola,
is shown in dendrograms of Figures 5 and 6. As shown
in both of the dendrograms, the genetic diversity of
almost all the isolates was clearly settled and showed
a similar pattern for ITS and actin gene sequences.
Fig. 3. PCR products of 500–560, 200–250, and 300–350 bp
generated by: A – ITS1 and ITS4, B – actin, C – calmodulin
primers of Pseudocercospora griseola isolates, respectively
Discussion
Angular leaf spot disease of common beans caused by bean production is not economically significant, the
P. griseola was previously found harmful and wide- disease was only found in a house garden. The reason
spread in greenhouse bean production in Bartın and for the non-existence of the disease in the fields could
Zonguldak provinces of the north western part of be the lower relative humidity, less than 90%, which
Turkey. Inoculum sources, survival of the disease and is required for disease outbreak. The disease incidence
disease outbreak were also determined in this area and severity had been very high on the local bean va
(Canpolat and Maden 2017). Studies carried out in riety grown in this area for a long time. However, while
other countries show that up to 50–80% disease sever- some commercial varieties did not show higher disease
ity (Ddamulira et al. 2014) and our study also showed severity, we think that they have no resistance (Canpo-
that disease incidence and severity up to 92% occurred lat and Maden 2020). Occurrence of higher intensities
in greenhouse bean production areas in the country, of the disease could be due to the use of a susceptible
the autumn sowing having higher rates than the spring local cultivar in autumn sowings, the use of infected
sowings in the two provinces, Bartın and Zonguldak. seeds harvested from spring sowings and the higher
In Karabük province, where commercial greenhouse relative humidity in the autumn. Commercial cultivarsSirel Canpolat and Salih Maden: Characterization of Turkish isolates of Pseudocercospora griseola the causal agent… 99 Fig. 4. Dendrogram showing genetic relatedness between 21 Turkish isolates of Pseudocercospora griseola f. griseola (marked with red spots) with the forms of griseola and mesoamericana deposited in GenBank sown in some greenhouses showed lower disease inci- in the wrong direction for example not being perpen- dence, which might have some tolerance to the disease. dicular to the prevailing wind and improper cultural This situation was also shown by our previous study practices. (Canpolat and Maden 2020). The high incidence of Molecular characterization of 118 isolates of disease and severity in the region may also be due to P. griseola, specifically the subtype and genotypic dif- unsuitable greenhouse structure, frequent sowing, the ferentiation was done for the first time in this study in use of more seed per bed, establishment of greenhouses Turkey. From the three primer sets, only ITS primers
100 Journal of Plant Protection Research 61 (1), 2021 Fig. 5. Dendrogram showing genetic relatedness of 73 Turkish isolates of Pseudocercospora griseola f. griseola formed by DNA sequences generated by ITS1 and ITS4 primers
Sirel Canpolat and Salih Maden: Characterization of Turkish isolates of Pseudocercospora griseola the causal agent… 101
400-Bartin-Esenyurt
404-Bartin-Cestepe
104-Devrek-Baslarkadi
408-Bartin-Tuzcular
305-Gokcebey-Merkez
338-Bartin-Akmanlar
302-Gokcebey-Kadioglu
309-Gokcebey-Karapinar
332-Bartin-Akmanlar
325-Bartin-Demirciler
116-Gokcebey-Bakacakkadi
301-Gokcebey-Kadioglu
311-Caycuma-Kayikcilar
334-Bartin-Akmanlar
312-Caycuma-Kayikcilar
316-Caycuma-Gokcehatipler
327-Bartin-Ciftlik
331-Bartin-Karahuseyinoglu
41-Devrek-Ciftlik
50-Devrek-Gebesoglu
303-Gokcebey-Satibeyler
407-Bartin-Tuzcular
304-Gokcebey-Merkez
313-Caycuma-Kayikcilar
315-Caycuma-Akyamac
40-Devrek-Hsroglu
300-Gokcebey-Bakacakkadi
401-Bartin-Yazicilar
411-Bartin-Siremircavus
118-Gokcebey-Bakacakkadi
409-Bartin-Gecen
42-Devrek-Bilik
403-Bartin-Cestepe
410-Bartin-Gecen
310-Gokcebey-Saraclar
307-Gokcebey-Merkez
105-Gokcebey-Bakacakkadi
402-Bartin-Yazicilar
317-Caycuma-Ramazanoglu
44-Devrek-Alduvaklar
308-Gokcebey-Merkez
314-Caycuma-Aricioglu
336-Bartin-Akmanlar
405-Bartin-Cestepe
406-Bartin-Cestepe
Fig. 6. Dendrogram showing genetic relatedness of 45 Turkish isolates of Pseudocercospora griseola f. griseola formed by DNA
sequences generated by actin primers
amplified 500–560 bp products from all of the isolates, Sea region of Turkey were determined by using dif-
while actin primes amplified 200–250 bp from 45 iso- ferent primers. When the obtained results were evalu-
lates and calmoludin primers 300–350 bp from only ated, all isolates were separated from each other and
five isolates. The ITS gene sequences of all the Turkish there was a variation between them. The genetic sepa-
isolates showed similarity between 98–100% to ration of the isolates in the study supports the exist-
P. griseola f. griseola, the form which is present in many ence of different pathotypes of the causal agent. This
parts of the world (Crous et al. 2006; Chilagane et al. study is the first study in this field in Turkey and in the
2016), while the similarity of the isolates to P. griseola future, larger and detailed studies will reveal important
f. mesoamaricana ranged from 90–92%. ITS sequences information about the diversity and distribution of the
of our 21 selected isolates took place in the same clade pathotypes of angular leaf spot.
in the phylogenetic tree generated with the isolates of Angular leaf spot disease has been reported to be
f. griseola deposited in GenBank. This clearly shows one of the most important disease factors seen every-
that all the Turkish isolates of P. griseola belong to where with bean cultivation, and it has been report-
P. griseola f. griseola. ed that there are many strains and pathotypes in the
In this study, genetic diversity levels between angu- world. This number may increase with the emergence
lar leaf spot isolates collected from the western Black of new strains due to pathogenic changes between102 Journal of Plant Protection Research 61 (1), 2021
among populations. We intended to determine the of the Groups of Pseudocercospora griseola Causing An-
pathotypes of P. griseola in Turkey and we obtained gular Leaf Spot in Protected Beans in West Black Sea
a small number of 12 international pathotype differen- Region, Investigations on Prevalence, Searches of Ino
tiation seed set from the breeders from South Africa. culum and Reactions of Some Bean Cultivation Against
In order to reproduce the seeds, the 12-seed set was This Agent’’ and this project was supported by the Turk-
planted in both Antalya and Ankara, but four varieties ish Ministry of Agriculture and Forestry with Project
of the differential set did not bloom and produce pods number TAGEM-BS-/10/10-01/02-05 under National
although they grew profusely. Therefore, pathotypes of Integrated Greenhouse Disease Management Program.
P. griseola could not be determined either by using in-
ternational differential set or molecular differentiation
which has not been characterized yet. References
Various molecular techniques have been used to
identify genetic variations of P. griseola, including ran- Abadio A.K.R., Lima S.S., Santana M.F., Salamao T.M.F., Sar-
torato A., Mizubuti E.S.G., Araujo E.F., Queiroz de M.V.
dom amplified polymorphic DNA (RAPD) and inter 2012. Genetic diversity analysis of isolates of the fungal
simple sequence repeats (ISSR), ISSR-PCR (Abadio bean pathogen Pseudocercospora griseola from central and
et al. 2012) and recently random amplified microsatel- southern Brazil. Genetics and Molecular Research 11 (2):
1272–1279. DOI: 10.4238/2012.May.14.1
lite (RAMS), BOX AIR, ERIC and REM primers (Dda-
Bora T., Karaca İ. 1970. Kültür Bitkilerinde Hastalığın ve
mulira et al. 2014). All of the above-mentioned studies Zararın Olçülmesi. [Measurement of Disease and Damage
found a great variation among the isolates of P. griseola in Cultivated Plants]. Ege University, Faculty of Agriculture
f. griseola. Our findings with the use of ITS and actin Auxiliary Textbook, No. 167. (in Turkish)
Canpolat S., Maden S. 2017. Determination of the inoculum
gene primers also showed variation among the Turkish sources of angular leaf spot disease caused by Pseudocer-
isolates of P.g. cospora griseola, on common beans. Plant Protection Bul-
Pseudocercospora griseola has a great pathogenic letin 57 (1): 39–47 (in Turkish, with English abstract). DOI:
10.16955/bitkorb.299016, ISSN 0406-3597
variability and this situation is described as pathotypes Canpolat S., Maden S. 2020. Reactions of some common bean
and Quantitative Trait Loci (QTL). Nay et al. (2019) cultivars grown in Turkey against some isolates of angular
reviewed the current resistance mechanism and re- leaf spot disease, caused by Pseudocercospora griseola. Plant
ported that five QTL’s, three of them (Phg-1, Phg-4, Protection Bulletin 60 (2): 45–54. (in Turkish, with English
abstract). DOI: 10.16955/bitkorb.630968
and Phg-5) are from common bean cultivars of the Chilagane L.A., Nchimbi-Msolla S., Kusolwa P.M., Porch T.G.,
Andean gene pool and two of them (Phg-2 and Phg-3) Diaz L.M.S., Tryphone G.M. 2016. Characterization of the
are from beans of the Mesoamerican gene pool. They common bean host and Pseudocercospora griseola, the caus-
ative agent of angular leaf spot disease in Tanzania. African
also reported other resistance loci on seven chromo- Journal of Plant Science 10 (11): 238–245. DOI: https://doi.
somes (Pv1, Pv3, Pv5, Pv6, Pv8, Pv9 and Pv11) and org/10.5897/AJPS2016.1427
drew a map showing all the resistance linkages in- Crous P.W., Lienbenberg M.M., Braun U., Groenewald J.Z. 2006.
cluding QTL’s and pathotypes. The wide pathogenic Re-evaluating the taxonomic status of Phaeoisariopsis grise-
ola, the causal agent of angular leaf spot of bean. Studies in
variability, which has not been settled yet, was also re- Mycology 55 (1): 163–173. DOI: 10.3114/sim.55.1.163
flected in our phylogenetic tree generated by ITS and Ddamulira G., Mukankusi C.M., Ochwo-Ssemakula M., Ede-
actin gene regions. The presence of various pathotypes ma R., Sseruwagi P., Gepts P.L. 2014. Distribution and
variability of Pseudocercospora griseola in Uganda. Journal of
is expected in Turkey too and the determination of Agricultural Science 6 (6): 16–29. DOI: 10.5539/jas.v6n6p16
the pathotypes the QTL’s would be more beneficial for Nay M.M., Souza T.L.P.O., Gonçalves-Vidigal M.C., Raatz B.,
breeding resistance in Turkey. Mukankusi C.M., Gonçalves-Vidigal M.C., Abreu A.F.B.,
Melo L.C., Pastor-Corrales M.A. 2019. A review of angu-
In our previous work, we tested 17 commercial lar leaf spot resistance in common bean. Crop Science 59:
bean cultivar reactions against 10 different aggres- 1376–1391. DOI: 10.2135/cropsci2018.09.0596
sive isolates of P. griseola and three Turkish bred and Sartorato A. 2004. Pathogenic variability and genetic diversity
two foreign cultivars were found to be resistant to all of Phaeoisariopsis griseola isolates from two counties in
the State of Goias, Brazil. Journal of Phytopathology 152:
tested isolates (Canpolat and Maden 2020). Resistance 385–390.
of many bean cultivars grown in Turkey should be de- Schoonhoven A., Pastor-Corrales M.A. 1987. Standard system
termined by checking whether they have some of the for the evaluation of bean germplasm. Centro Internacional
de Agricultura Tropical, CIAT Apartado Areo 6713 Cali,
existing resistance loci or not. This procedure might Colombia, p. 56.
facilitate breeding resistance since chemical control of Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. 2013.
the disease is neither effective nor safe. MEGA 6: Molecular evolutionary genetics analysis version
6.0. Molecular Biology and Evolution 30 (12): 2725.
Townsend G.K., Heuberger J.W. 1943. Methods for estimating
Acknowledgements losses caused by diseases in fungicide experiments. Plant
Disease Report 27: 340–343.
This study is the Ph.D. thesis of Ankara University Viguiliouk E., Mejia S.B., Kendall C.W., Sievenpiper J.L. 2017.
Can pulses play a role in improving cardiometabolic health.
Graduate School of Natural and Applied Sciences De- Evidence from systematic reviews and meta-analyses. An-
partment of Plant Protection named ”Determination nuals of the New York Academy of Sciences 1392 (1): 43.You can also read
