Infectious Clones of Novel Lineage 1 and Lineage 2 West Nile Virus Strains WNV-TX02 and WNV-Madagascar
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Infectious Clones of Novel Lineage 1 and Lineage 2 West Nile Virus
Strains WNV-TX02 and WNV-Madagascar
Mehul S. Suthar,a Margaret M. Brassil,a Gabriele Blahnik,a and Michael Gale, Jr.a,b
Department of Immunologya and Department of Microbiology,b University of Washington School of Medicine, Seattle, Washington, USA
We report the generation of West Nile virus (WNV) infectious clones for the pathogenic lineage 1 Texas-HC2002 and nonpatho-
genic lineage 2 Madagascar-AnMg798 strains. The infectious clones exhibited biological properties similar to those of the paren-
tal virus isolates. We generated chimeric viruses and found that viral factors within the structural and nonstructural regions of
WNV-TX contribute to the control of type I interferon defenses. These infectious clones provide new reagents to study flavivirus
immune regulation and pathogenesis.
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
W est Nile virus (WNV) is a neurotropic flavivirus that consti-
tutes the leading cause of mosquito-borne and epidemic
encephalitis in humans in the United States (4). WNV is a member
coming of limitations imposed by genetic instability during plas-
mid propagation in bacterial hosts, problems due to difficult low-
yield plasmid preparations, as well as limitations due to a lack of
of the family Flaviviridae and carries a single-stranded positive- restriction sites for cDNA insertion in single-plasmid cloning
sense RNA genome approximately 11 kb in length consisting of a schemes. To generate the infectious clones, we replaced the coding
single open reading frame that is translated as a polyprotein to sequences of NY99 strain 382-99 with either WNV-TX or WNV-
generate 10 viral proteins. Lineage 1 WNV strains represent MAD in the respective plasmids. The sequence of the viral RNA 5=
emerging viruses associated with outbreaks of encephalitis and untranslated region (UTR) is conserved among WNV-NY99,
meningitis in Europe, the Middle East, and now North America, WNV-TX, and WNV-MAD. The 3= UTR sequence of the viral
whereas lineage 2 strains are typically nonpathogenic, non- RNA is conserved between WNV-NY99 and WNV-TX but not
emergent, and geographically confined to Africa and the island WNV-MAD (73.4% sequence similarity [9]). To generate the
country of Madagascar (2, 3, 12). More recently, lineage 1 WNV-TX infectious clone, three amino acid coding changes
WNV-associated infections have shifted from causing disease within the sequence of WNV-NY99 (strain 382-99) were replaced
in young children, the elderly, and the immunocompromised with WNV-TX (Table 1). The WNV-MAD infectious clone was syn-
to afflicting healthy young adults, indicating that virulence oc- thesized (GenScript, Piscataway, NJ) with nucleotides (nt) 1 to 2500
curs independently of immune senescence or immune defi- (encoding the structural genes) inserted into a pUC19 vector
ciencies associated with aging (6, 7). Pathogenic lineage 2 (GenScript) and nt 2494 to 10396 (with the 3=UTR [nt 10397 to
WNV variants have recently emerged in Europe, causing sig- 11031] from WNV-TX) inserted into the pCCI vector (GenScript).
nificant WNV-induced disease in humans (17). The increase in To allow full-length clone assembly, a unique NgoMIV restriction
virulence of lineage 1 and 2 strains, coupled with a lack of a site was engineered (nt A2496C and A2498G) that did not alter the
vaccine or therapeutic agents, continues to present WNV as a NS1 amino acid coding sequence. Infectious WNV-TX and WNV-
significant public health threat. MAD RNAs were successfully prepared from their respective two-
The host innate immune response is the first line of defense plasmid infectious clones and introduced into BHK-21 cells by elec-
during virus infection and is responsible for deterring virus repli- troporation, and viral supernatants were recovered and aliquoted as
cation and spread within the host. Lineage 1 WNV-TX, but not the primary working stocks for phenotypic analysis (as described by
lineage 2 WNV-MAD, has been shown to inhibit type I interferon Kinney et al. [10]).
(IFN)-induced phosphorylation of STAT1 and STAT2 by block- The newly generated cDNA cloned infectious viruses were
ing the activity of the IFN receptor-associated kinase Tyk2 (9). We evaluated to determine whether they retained biological proper-
found that WNV-TX also blocks an inhibitor of B kinase ε ties similar to those of the parental virus isolates. To determine
(IKKε)-dependent phosphorylation event on STAT1, resulting in viral fitness accurately, the replication of the parental passaged
a temporal regulation of STAT1 phosphorylation and subsequent virus isolates (here referred to as parental) and that of a clonal
expression of IFN-stimulated genes that are essential for the con- virus generated from the respective infectious clone were com-
trol of WNV infection (18). However, studies to identify specific pared by evaluating replication in innate immune response-defec-
viral determinants that regulate WNV inhibition of IFN-mediated tive (BHK-21) and response-competent (A549) cell lines. One-
signaling have been hindered by the lack of appropriate reagents. step (multiplicity of infection [MOI] of 5.0 based on virus titer
To facilitate viral genetic studies of WNV-host interactions
that control infection and immunity, we generated a novel infec-
tious clone of WNV-TX (strain TX 2002-HC) and a clone of Received 17 February 2012 Accepted 30 April 2012
WNV-MAD (strain Madagascar-AgMg798) (9). The design of Published ahead of print 9 May 2012
each infectious clone is based on the two-plasmid reverse genetics Address correspondence to Michael Gale, Jr., mgale@u.washington.edu.
system first described by Kinney et al. (10). In this system, the Copyright © 2012, American Society for Microbiology. All Rights Reserved.
structural and nonstructural (NS) genes are broken into two plas- doi:10.1128/JVI.00401-12
mids (pAB and pCG, respectively). This system allows the over-
7704 jvi.asm.org Journal of Virology p. 7704 –7709 July 2012 Volume 86 Number 14Lineage 1 and 2 Infectious Clones
TABLE 1 Primer sequences for WNV-TX infectious clone Whereas the parental WNV-TX displayed significantly higher vi-
Primer set Amino acid ral titers at early times postinfection in a multistep growth curve
and name coding (Fig. 2C), parental WNV-MAD exhibited viral titers similar to
(orientation) Sequence differencea those of the WNV-MAD infectious clone (Fig. 2D). The WNV-TX
1 infectious clone inhibited STAT1 (Y701) and STAT2 (Y689)
249s GGCGTTCTTCAGGTTCACAGC E224K phosphorylation similarly to parental WNV-TX (Fig. 2E) (9). The
2900a GGACATTCCTTGGTCTCCGGACCA V449A WNV-MAD infectious clone displayed only slight inhibition of
STAT1 (Y701) phosphorylation; however, no block in STAT2
2
phosphorylation (Y689) was observed, similar to parental WNV-
3584s CCCAGGAGGTCCTTCGCAAGA V1493I
5244a CTCTTTGATGATCTGTGGCA
MAD (Fig. 2F) (9). These results demonstrate that the infectious
a
cloned viruses exhibit in vitro biological properties and fitness
NY99 to TX2002HC.
similar to those of the parental viruses.
Lineage I WNV-TX is virulent in mice, whereas lineage 2
determination on BHK-21 cells; Fig. 1A and B) and multistep WNV-MAD is attenuated, producing no deaths and only mild
(MOI of 0.01; Fig. 1C and D) growth curves determined with clinical signs of infection (9, 21). Wild-type (WT) mice infected
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
infected BHK-21 cells, which have a defect in IFN production (1, with the WNV-TX infectious clone exhibited clinical scores sim-
5), of the clonal and parental viruses were similar. Of note, in the ilar to those of mice infected with parental WNV-TX, albeit with
one-step growth curve (Fig. 1A), parental WNV-TX displayed sig- fewer deaths (Fig. 3A and B). The WNV-MAD infectious clone, in
nificantly higher viral titers at early times postinfection, likely due contrast, was completely avirulent in WT mice, producing no
to the fact that the parental WNV-TX stock has accumulated cell clinical scores above the baseline (Fig. 3C) with no deaths (Fig.
culture adaptations during amplification of the working stock 3D). In the absence of type I IFN signaling (Ifnar⫺/⫺ mice), the
(11). In addition, the WNV-TX infectious clone virus displayed WNV-TX infectious clone displayed virulence nearly identical to
particle-to-PFU ratios similar to those of the parental virus, while that of parental WNV-TX, while the WNV-MAD infectious clone
the WNV-MAD infectious clone virus displayed a significantly produced more deaths that parental WNV-MAD. These results
lower particle-to-PFU ratio than the parental WNV-MAD (Fig. confirm that type I IFN signaling is essential in protection against
1E and F), likely due to the effects of virus passage in cell culture. lineage 1 and 2 WNV strains (Fig. 3E and F) and validating previ-
Similar to viral growth in BHK-21 cells, parental WNV-TX and ous studies that defined WNV control of IFN signaling as a major
WNV-MAD exhibited significantly higher viral titers at early virulence determinant (9, 19).
times postinfection in one-step growth curves determined with To identify regions within the WNV-TX genome that contrib-
A549 cells (IFN competent; MOI based on titer determination on ute to the inhibition of IFN signaling, chimeric viruses consisting
Vero E6 cells) than the infectious cloned virus (Fig. 2A and B). of the lineage 1 WNV-TX and lineage 2 WNV-MAD clones were
FIG 1 The WNV-TX infectious clone (i.c.) and the WNV-MAD infectious clone display biological properties comparable to those of the parental virus isolates.
BHK-21 cells were infected in triplicate at an MOI of 5.0 (A and B) or 0.01 (C and D) with parental WNV-TX (working stocks were derived from single-round
plaque purification in Vero E6 cells and two rounds of amplification in HEK 293 cells) and the WNV-TX infectious clone or parental WNV-MAD (working
stocks were derived from two rounds of amplification in Vero E6 cells) and the WNV-MAD infectious clone. Volumes of 100 l of cell culture supernatant were
removed at the indicated times postinfection and replaced with fresh cell culture medium. Viral burdens in the culture supernatants were then determined by
plaque assay on BHK-21 cells. (E and F) Particle-to-PFU ratios were determined by triplicate viral RNA extraction from working viral stocks (harvested at 48 h
postinfection) using a QIAamp viral RNA extraction kit, followed by quantitative reverse transcription-PCR with virus-specific primers. Viral RNA copy
numbers were divided by the viral titers determined on BHK-21 cells. Data are representative of three independent experiments. *, P ⬍ 0.05.
July 2012 Volume 86 Number 14 jvi.asm.org 7705Suthar et al.
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
FIG 2 The WNV-TX infectious clone (i.c.) and the WNV-MAD infectious clone exhibit replication fitness comparable to that of their respective parental virus
isolates in IFN-competent cells. A549 cells were infected in triplicate at an MOI of 5.0 (A and B) or 0.01 (C and D) with the parental WNV-TX and WNV-TX
infectious clones or parental WNV-MAD and WNV-MAD infectious clone. Volumes of 100 l of cell culture supernatant were removed at the indicated times
postinfection and replaced with fresh cell culture medium. Viral burdens in the collected culture supernatants were then determined by plaque assay on Vero E6
cells. (D and E) A549 cells were mock infected or infected (MOI of 5) in triplicate with the parental WNV-TX and WNV-TX infectious clones or the parental
WNV-MAD and WNV-MAD infectious clones. At 6, 12, 24, or 48 h postinfection, cells were pulse treated with 1,000 IU of IFN-␣ (PBL IFN) for 30 min and
whole-cell lysates were collected in modified radioimmunoprecipitation assay buffer (10 mM Tris [pH 7.5]–150 mM NaCl– 0.5% sodium deoxycholate–1%
Triton X-100 supplemented with protease inhibitor cocktail [Sigma] and phosphatase inhibitor cocktail II [Calbiochem]) and analyzed by immunoblotting to
detect STAT1 phosphotyrosine residue 701 (Cell Signaling), total STAT1 (Cell Signaling), STAT2 phosphotyrosine residue 689 (Upstate), total STAT2 (Cell
Signaling), WNV NS3 (R&D Systems), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Santa Cruz). Data are representative of three independent
experiments. *, P ⬍ 0.05.
generated (Fig. 4A). The structural (core through E protein) and the chimeric viruses displayed replication kinetics similar to those
NS (NS1 through NS5) coding regions were exchanged between of the WT WNV-TX infectious clone, while the WT WNV-MAD
the two infectious clones, creating chimeric WNV-TX/MAD infectious clone displayed comparably reduced replication (Fig.
(containing the structural genes of WNV-TX and the NS genes of 4D). Analysis of type I IFN induction, as measured by the activa-
WNV-MAD) and WNV-MAD/TX (containing the structural tion of IFN regulatory factor 3 (IRF-3) and the expression of
genes of WNV-MAD and the NS genes of WNV-TX). In BHK-21 IFIT1, showed that WNV-TX, WNV-MAD, and the chimeric vi-
cells, the chimeric viruses replicated similarly to the WNV-MAD ruses are strong activators of host innate defenses (Fig. 4E). For all
infectious clone, with all three viruses replicating at early times at of the viruses, IRF-3 phosphorylation and IFIT1 protein expres-
significantly lower levels than that of the WNV-TX infectious sion tracked with the synthesis of viral NS3. Introduction of the
clone (Fig. 4B). Interestingly, while the levels of all four viruses structural or NS genes from WNV-TX into the WNV-MAD infec-
were similar by 48 h postinfection, we observed dramatic differ- tious clone backbone resulted in the inhibition of type I IFN sig-
ences in plaque-forming efficiency between chimeric viruses (Fig. naling to levels similar to that observed with the WT WNV-TX
4C). The WT WNV-TX infectious clone displayed a large-plaque infectious clone, demonstrating that both the structural and NS
morphology, whereas the WT WNV-MAD infectious clone dis- regions of the WNV-TX genome encode products that suppress
played a small-plaque morphology. Chimeric viruses containing IFN signaling (Fig. 4F). Similarly, the chimeric viruses showed
either the structural or the NS genes from WNV-TX resulted in clinical scoring nearly indistinguishable from that of the WT
increased plaque sizes, suggesting that both the structural and NS WNV-TX infectious clone upon the infection of WT mice (Fig.
regions of the viral genome contribute to virus-induced cytopa- 4G), while virulence in Ifnar⫺/⫺ mice was also maintained (Fig.
thology. In multistep growth curves determined with A549 cells, 4H). These results demonstrate that the NS and structural genes of
7706 jvi.asm.org Journal of VirologyLineage 1 and 2 Infectious Clones
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
FIG 3 Infectious cloned viruses display in vivo biological properties comparable to those of the parental virus isolates. Six- to 12-week-old C57BL/6 mice were
infected with parental WNV-TX (n ⫽ 24) and the WNV-TX infectious clone (i.c.) (n ⫽ 10) (A) or parental WNV-MAD (n ⫽ 6) and the WNV-MAD infectious
clone (n ⫽ 6) (B) by subcutaneous injection into the left rear footpad of 100 PFU in a 10-l inoculum diluted in phosphate-buffered saline supplemented with
1% heat-inactivated fetal bovine serum. Mice were monitored daily and scored for clinical signs as follows: 1, ruffled fur and/or hunched body posture; 2, mild
hind limb dysfunction; 3, dysfunction in at least one hind limb; 4, severe dysfunction in both hind limbs; 5, paresis of the hind limbs; 6, terminal morbidity. (C
and D) Six- to 12-week-old C57BL/6 mice were infected in a manner similar to that described for panels A and B and monitored daily for death. (E and F) Six-
to 12-week-old Ifnar⫺/⫺ mice (courtesy of Murali-Krishna Kaja) were infected in a manner similar to that described for panels A and B (WNV-TX, n ⫽ 9;
WNV-TX infectious clone, n ⫽ 5; WNV-MAD, n ⫽ 6; WNV-MAD infectious clone, n ⫽ 6) and monitored daily for death. Experiments were performed in
accordance with the University of Washington Institutional Animal Care and Use Committee. As required by the University of Washington animal protocol,
infected mice were euthanized during the experiment either when they lost more than 20% of their initial body weight or when they exhibited severe disease signs.
Kaplan-Meier survival curves were analyzed by the log-rank test to determine the significance of differences (GraphPad Prism 5). Data are representative of three
independent experiments.
the lineage 1 WNV-TX strain encode viral factors that influence general reduction in virulence with the infectious clones in WT
host cell cytopathic effect, inhibition of IFN signaling, and viral mice, these differences can likely be attributed to either virus
pathogenesis. amplification procedures or genetic differences found within
In this report, we describe the generation and characteriza- the 3= UTR sequence (in the case of WNV-MAD). Overall, the
tion of two infectious clones for novel lineage 1 and 2 WNV infectious clones displayed biological properties comparable to
strains. The WNV-TX and WNV-MAD infectious clones dis- those of the parental viruses.
played growth kinetics and magnitude nearly identical to those Lineage 1 WNV-TX antagonizes type I IFN signaling by inhib-
of the parental strain, with the exception of slightly enhanced iting the phosphorylation and activation of STAT1 and STAT2
virus replication at early times postinfection. Functionally, the transcription factors (9). Recent studies have also found that
infectious clones were comparable to the parental strains in the WNV-TX also prevents IKKε phosphorylation at serine 708,
capacity to inhibit the IFN signaling pathway. In vivo analysis which is essential in driving a subset of antiviral effector genes
demonstrated that the infectious cloned viruses displayed (18). Multiple viral factors have been implicated in the regulation
more uniform virulence than that of the parental virus strains of type I IFN signaling, including NS proteins NS2A (14, 15),
in WT and IFN receptor knockout mice. While there was a NS2B (15), NS3 (15), NS4A (15), NS4B (8, 15, 16), and NS55 (13)
July 2012 Volume 86 Number 14 jvi.asm.org 7707Suthar et al.
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
FIG 4 WNV-TX NS and structural genes inhibit type I IFN signaling. (A) Schematic of chimeric viruses. (B) Multistep growth curve (MOI of 0.01) determined
with BHK-21 cells. (C) Plaque assay performed with BHK-21 cells with counterstaining on day 3 postinfection with crystal violet. (D) Multistep growth curve
(MOI of 0.01) determined with A549 cells. Data are representative of three independent experiments. *, P ⬍ 0.05. (E) A549 cells were mock infected (M) or
infected (MOI of 5) with parental and chimeric viruses, and whole-cell lysates were collected in modified radioimmunoprecipitation assay buffer and analyzed
by immunoblotting with the indicated antibodies (phospho-IRF-3 [Cell Signaling], total IRF-3 [courtesy of Michael David], ISG56 [courtesy of Ganes Sen], and
glyceraldehyde 3-phosphate dehydrogenase [GAPDH]). (F) A549 cells were mock infected (M) or infected (MOI of 5) with parental and chimeric viruses pulse
treated with 1,000 IU of IFN-␣ for 30 min at the indicated times postinfection. (G) Six- to 12-week-old C57BL/6 mice were infected with the parental (WNV-TX
infectious clone [i.c.], n ⫽ 10; WNV-MAD infectious clone, n ⫽ 12) and chimeric viruses (WNV-MAD/TX infectious clone, n ⫽ 8; WNV-TX/MAD infectious
clone, n ⫽ 10) by subcutaneous injection of 100 PFU in a 10-l inoculum into the left rear footpad. Mice were monitored daily and scored for clinical signs. (H)
Six- to 12-week-old Ifnar⫺/⫺ mice (WNV-TX infectious clone, n ⫽ 5; WNV-MAD infectious clone, n ⫽ 6; WNV-MAD/TX infectious clone, n ⫽ 4; WNV-TX/
MAD infectious clone, n ⫽ 5) were infected in a manner similar to that described for panel G and monitored daily for death. Data are representative of two
independent experiments.
and the structural proteins (8). Recently, the noncoding sub- identification of viral factors associated with pathogenesis, these
genomic RNA was implicated in the evasion of type I IFN sig- infectious clones can serve to identify host factors within novel
naling; however, a further mechanism is required to determine virus-host interactions that control immunity to lineage 1 and 2
how an RNA product can regulate IFN signaling (20). The use WNV infections. Indeed, the avirulent WNV-MAD infectious
of the WNV-TX and WNV-MAD infectious clones, which dif- clone may serve as a live attenuated vaccine strain and allow future
fer in the ability to inhibit type I IFN signaling, provides a studies to define the immune correlates of protection against fla-
platform for the identification of novel viral determinants of vivirus infection.
type I IFN signaling and response regulation.
The viral and host factors governing the outcome of WNV ACKNOWLEDGMENTS
infection have been hindered by the lack of appropriate WNV We thank Brian Doehle for helpful discussion. We tahnk Richard M.
reagents. These novel infectious clones now provide valuable re- Kinney for providing the WNV-NY99-derived infectious clone.
agents that allow comparative infection studies of virulent and This study was supported by NIH grants 1F32AI081490, R01AI074973,
avirulent WNV strains. In addition to serving as a platform for the U19AI083019, and U54AI081680.
7708 jvi.asm.org Journal of VirologyLineage 1 and 2 Infectious Clones
REFERENCES 12. Lanciotti RS, et al. 2002. Complete genome sequences and phylogenetic
1. Andzhaparidze OG, Bogomolova NN, Boriskin YS, Bektemirova MS, analysis of West Nile virus strains isolated from the United States, Europe,
Drynov ID. 1981. Comparative study of rabies virus persistence in human and the Middle East. Virology 298:96 –105.
and hamster cell lines. J. Virol. 37:1– 6. 13. Laurent-Rolle M, et al. 2010. The NS5 protein of the virulent West Nile
2. Beasley DW, Li L, Suderman MT, Barrett AD. 2002. Mouse neuroinva- virus NY99 strain is a potent antagonist of type I interferon-mediated
sive phenotype of West Nile virus strains varies depending upon virus JAK-STAT signaling. J. Virol. 84:3503–3515.
genotype. Virology 296:17–23. 14. Liu WJ, et al. 2006. A single amino acid substitution in the West Nile virus
3. Berthet FX, et al. 1997. Extensive nucleotide changes and deletions within nonstructural protein NS2A disables its ability to inhibit alpha/beta inter-
the envelope glycoprotein gene of Euro-African West Nile viruses. J. Gen. feron induction and attenuates virus virulence in mice. J. Virol. 80:2396 –
Virol. 78(Pt 9):2293–2297. 2404.
4. Centers for Disease Control and Prevention. 2011. West Nile virus 15. Liu WJ, et al. 2005. Inhibition of interferon signaling by the New York 99
disease and other arboviral diseases—United States, 2010. MMWR Morb. strain and Kunjin subtype of West Nile virus involves blockage of STAT1
Mortal. Wkly. Rep. 60:1009 –1013. and STAT2 activation by nonstructural proteins. J. Virol. 79:1934 –1942.
5. Clarke JB, Spier RE. 1983. An investigation into causes of resistance of a 16. Muñoz-Jordán JL, et al. 2005. Inhibition of alpha/beta interferon signal-
cloned line of BHK cells to a strain of foot-and-mouth disease virus. Vet. ing by the NS4B protein of flaviviruses. J. Virol. 79:8004 – 8013.
Microbiol. 8:259 –270. 17. Papa A, Xanthopoulou K, Gewehr S, Mourelatos S. 2011. Detection of
6. DeBiasi RL, Parsons JA, Grabert BE. 2005. West Nile virus meningoen- West Nile virus lineage 2 in mosquitoes during a human outbreak in
cephalitis in an immunocompetent adolescent. Pediatr. Neurol. 33:217– Greece. Clin. Microbiol. Infect. 17:1176 –1180.
219.
Downloaded from http://jvi.asm.org/ on October 6, 2015 by guest
18. Perwitasari O, Cho H, Diamond MS, Gale M, Jr. 2011. Inhibitor of
7. Emig M, Apple DJ. 2004. Severe West Nile virus disease in healthy adults.
kappaB kinase epsilon (IKK(epsilon)), STAT1, and IFIT2 proteins define
Clin. Infect. Dis. 38:289 –292.
novel innate immune effector pathway against West Nile virus infection. J.
8. Evans JD, Seeger C. 2007. Differential effects of mutations in NS4B on
West Nile virus replication and inhibition of interferon signaling. J. Virol. Biol. Chem. 286:44412– 44423.
81:11809 –11816. 19. Samuel MA, Diamond MS. 2005. Alpha/beta interferon protects against
9. Keller BC, et al. 2006. Resistance to alpha/beta interferon is a determinant lethal West Nile virus infection by restricting cellular tropism and enhanc-
of West Nile virus replication fitness and virulence. J. Virol. 80:9424 – ing neuronal survival. J. Virol. 79:13350 –13361.
9434. 20. Schuessler A, et al. 2012. West Nile virus noncoding subgenomic RNA
10. Kinney RM, et al. 2006. Avian virulence and thermostable replication of contributes to viral evasion of type I interferon-mediated antiviral re-
the North American strain of West Nile virus. J. Gen. Virol. 87:3611–3622. sponse. J. Virol. 86:5708 –5718.
11. Laassri M, Bidzhieva B, Speicher J, Pletnev AG, Chumakov K. 2011. 21. Suthar MS, et al. 2010. IPS-1 is essential for the control of West Nile virus
Microarray hybridization for assessment of the genetic stability of chime- infection and immunity. PLoS Pathog. 6:e1000757. doi:10.1371/
ric West Nile/dengue 4 virus. J. Med. Virol. 83:910 –920. journal.ppat.1000757.
July 2012 Volume 86 Number 14 jvi.asm.org 7709You can also read
