Spread of Recombinant DNA by Roots and Pollen of Transgenic Potato Plants, Identified by Highly Specific Biomonitoring Using
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2003, p. 4455–4462 Vol. 69, No. 8
0099-2240/03/$08.00⫹0 DOI: 10.1128/AEM.69.8.4455–4462.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Spread of Recombinant DNA by Roots and Pollen of Transgenic
Potato Plants, Identified by Highly Specific Biomonitoring Using
Natural Transformation of an Acinetobacter sp.
Johann de Vries,* Martin Heine, Klaus Harms, and Wilfried Wackernagel
Genetics Section, Institute for Biology and Environmental Sciences, University of Oldenburg, D-26111 Oldenburg, Germany
Received 23 January 2003/Accepted 14 May 2003
Transgenic potato plants with the nptII gene coding for neomycin phosphotransferase (kanamycin resis-
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
tance) as a selection marker were examined for the spread of recombinant DNA into the environment. We used
the recombinant fusion of nptII with the tg4 terminator for a novel biomonitoring technique. This depended on
natural transformation of Acinetobacter sp. strain BD413 cells having in their genomes a terminally truncated
nptII gene (nptIIⴕ; kanamycin sensitivity) followed by the tg4 terminator. Integration of the recombinant fusion
DNA by homologous recombination in nptIIⴕ and tg4 restored nptII, leading to kanamycin-resistant transfor-
mants. DNA of the transgenic potato was detectable with high sensitivity, while no transformants were obtained
with the DNA of other transgenic plants harboring nptII in different genetic contexts. The recombinant DNA
was frequently found in rhizosphere extracts of transgenic potato plants from field plots. In a series of field plot
and greenhouse experiments we identified two sources of this DNA: spread by roots during plant growth and
by pollen during flowering. Both sources also contributed to the spread of the transgene into the rhizospheres
of nontransgenic plants in the vicinity. The longest persistence of transforming DNA in field soil was observed
with soil from a potato field in 1997 sampled in the following year in April and then stored moist at 4°C in the
dark for 4 years prior to extract preparation and transformation. In this study natural transformation is used
as a reliable laboratory technique to detect recombinant DNA but is not used for monitoring horizontal gene
transfer in the environment.
Molecular techniques have been used now for about 2 de- found (10, 25, 29). However, Kay et al. have demonstrated in
cades to introduce new traits such as resistance to diseases, planta gene transfer from transplastomic tobacco plants to
pests, and herbicides into plants of agronomical importance. Acinetobacter sp. strain, BD413 when the plants were experi-
Many of the transgenic plants contain antibiotic resistance mentally coinfected by Acinetobacter and Ralstonia solanacea-
genes, which were used as selection markers during their con- rum (17).
struction (9). The use of transgenic plants in agriculture leads The nptII gene, which is present as selection marker gene in
to the presence of recombinant DNA in the environment on a the genomes of several transgenic plants (9), has previously
large scale. The concern has been raised that an unintended been used to determine the prerequisites for a horizontal
transfer of the recombinant genetic material into the soil mi- transfer of plant DNA into competent bacteria. It was found
crobiota may occur and increase, e.g., antibiotic resistance in that recombinant plant DNA can transform competent cells to
bacteria, including human pathogens (7, 24, 43). antibiotic resistance when the recipient cells provide DNA
At the same time, the recombinant and thus specific nucle- homology for transgene integration by homologous recombi-
otide sequences of the DNA of genetically modified organisms nation (5, 11, 17). Integration was not detectable in the ab-
enabled the quantitative tracing of the fate of DNA from sence of homology (4, 17, 27).
transgenic organisms in the environment by applying PCR To assess the level, frequency, and dynamics of DNA spread
amplification. DNA of high molecular weight has been found from plants during growth, we employed transgenic potato
to be present in soil sites where free DNA (10) or plant ma- plants carrying nptII as selection marker and measured the
terial (10, 29, 41) had been deposited and to persist in non- presence of the recombinant DNA in their environment. For
sterile soils for several months (33, 34, 41, 42). It was suggested detecting the recombinant DNA we used a biomonitoring as-
that DNA released from eukaryotic and prokaryotic cells con- say based on natural transformation of Acinetobacter sp. strain
stitutes an extracellular gene pool which can be used by natu- BD413. This species does not discriminate between its own
rally competent bacterial cells that take up DNA and integrate DNA and foreign DNA during the DNA uptake process (3, 18,
it into their genomes (natural transformation) (19, 40). In 30). The assay has previously been successfully applied to de-
microcosm experiments transformation was found to occur in tect nptII genes in leaf DNA extracts from several transgenic
nonsterile soils (26, 28, 37). A transfer of recombinant DNA plants including potato, rape, tobacco, tomato, and sugar beet
from transgenic plants to microbes in the soil has not been plants (5). Recently, it was also applied to the detection of
recombinant DNA from transgenic sugar beet plants in envi-
ronmental samples (23). We have now modified the genetic
* Corresponding author. Mailing address: Genetics, Institute for
Biology and Environmental Sciences, University of Oldenburg, P.O.
system for biomonitoring in order to make it specific for a
Box 2503, D-26111 Oldenburg, Germany. Phone: 49 (441) 798 2937. given recombinant construct, in our case the DNA of a trans-
Fax: 49 (441) 798 192937. E-mail: johann.de.vries@uni-oldenburg.de. genic potato having an nptII-tg4 terminator fusion (8, 31). By
44554456 DE VRIES ET AL. APPL. ENVIRON. MICROBIOL.
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
FIG. 1. (A) Construction of the marker rescue plasmid pMR30. The nptII gene, tg4 terminator, the position and size of the nptII-inactivating
deletion, and the nptII⬘-tg4 fusion are indicated. Small arrows, primer binding sites used for inverse PCR; dotted lines, cloning sites used for
deletion formation and subcloning into the broad-host-range plasmid pKT210. (B) Recombinational repair of the nptII gene on pMR30. Shaded
areas indicate homologous regions available for recombinational nptII completion. The product is the filled-up marker rescue cassette of pMR30
that confers kanamycin resistance.
monitoring samples from soil and rhizospheres of field plot- centration of 10 g ml⫺1 for the XmnI-linearized plasmid DNA in the transfor-
and greenhouse-grown transgenic potato plants we found that mation culture, kanamycin-sensitive transformants arose at a frequency of about
3.4%, as determined by replica plating colonies grown on Luria broth (LB) agar
DNA is spread during the growth of the plants and not only plates onto LB agar plates containing 50 g of kanamycin ml⫺1. Five of the
during the decay of plant litter deposited in soil. transformants were characterized by PCR with primers specific for alkM, nptII,
tg4, and the deleted region. The results showed the deletion in the marker rescue
MATERIALS AND METHODS cassette in the chromosomes of all of them. One of the strains was termed JV28.
Plants, field plots, and preparation of extracts. Samples were obtained from
Construction of plasmids and bacterial strains. Escherichia coli DH5␣ (12) potato plants grown in a randomized block design in field plots at Groß Lüsewitz
and XL10 Gold (Stratagene, La Jolla, Calif.) were the recipients for cloning
near Rostock, Germany, from 1996 until 2000. Different areas of the field were
experiments. Plasmid DNA was purified by alkaline lysis with plasmid purifica-
used for planting out the tubers every year. The parental potato line was Désirée;
tion kits (Qiagen, Hilden, Germany) or by rapid boiling (15). The nptII gene of
the transgenic control line (DC1) contained the nptII-tg4 fusion, and the trans-
pBlue-Km1 (located on a 1.8-kb BamHI-HindIII fragment of Tn5 [4]) was fused
genic lines DL4, DL5, DL10, and DL12 additionally contained a T4 lysozyme
with the tg4 terminator by replacement of the 0.96-kb NcoI-XbaI fragment
gene. The soil, field plot design, and sampling procedure have been described
(containing a part of nptII and downstream nucleotides) with the 0.90-kb NcoI-
(14). In short, “rhizosphere extracts” were prepared from 5 g of freshly harvested
SphI fragment from pSR8-36 (31), giving pBlue-Km-tg4 (Fig. 1A; the incompat-
root material with adhering soil (often combined from five plants per plot) by
ible SphI and XbaI ends were fused as blunt ends produced by treatment with T4
aqueous extraction with a stomacher blender in a total volume of 50 ml and
DNA polymerase [MBI Fermentas, St. Leon-Rot, Germany]). A deletion of 233
purification from most soil particles by low-speed centrifugation (2 min; 500 ⫻ g;
nucleotides covering nptII codons for the C-terminal 16 amino acids (resulting in
20°C). Aliquots of the rhizosphere extracts were stored at ⫺20°C. They were
nptII⬘) and the spacer DNA in front of tg4 was introduced into pBlue-Km-tg4 by
used for transformation immediately after thawing without further purification.
inverse PCR of the 5,180-bp plasmid with primers del-0 (AGCGGCGATACC
Soil extracts were also prepared by the rhizosphere extraction protocol using soil
GTAAAGCA), complementary to nucleotides 744 to 725 of the nptII open
material equivalent to 5 g dry weight and yielding 50 ml of extract (referred to as
reading frame and del-3 (AGCCGCTTTCGACGGATTCG), complementary to
nucleotides 9 to 28 of the tg4 terminator, and ligation of the product, yielding stomacher soil extracts). Alternatively, for the extraction of total DNA from soil
pMR13 (Fig. 1A). The deletion cassette (1,555 bp) was amplified by PCR with samples the protocol of Widmer et al. (42) including hot sodium dodecyl sulfate
primers npt-Eco1 (ggaaTTCACGCTGCCGCAAGCACTCAG; EcoRI site un- (SDS) and ultrasonic treatments was applied with the modifications described
derlined, noncomplementary nucleotides in lowercase) and npt-Eco2 (ggaattc previously (23). This method yields 100 l of extract from 100 mg of soil (dry
GTTTACCCGCCAATATATCCTG), treated with EcoRI, and cloned into the weight). These extracts are referred to as SDS soil extracts. Leaf DNA was
EcoRI site of the broad-host-range IncQ vector pKT210 (1), yielding pMR30 extracted as described previously (5) from the potato plant lines listed above and
(Fig. 1). This plasmid was introduced into Acinetobacter sp. strain BD413 by from the following plant lines: Beta vulgaris subsp. vulgaris, L5 (parental) and L3
electroporation (5), and transformants were selected on medium with chloram- (transgenic; beet necrotic yellow vein virus resistance) (21); Lycopersicon escu-
phenicol (25 g ml⫺1). The plasmid pKm1 (5) was linearized with EcoO109I lentum, wild type (parental) and FLAVR SAVR (transgenic; antisense polyga-
(cutting four times outside of nptII) to prevent cointegrate formation during lacturonase gene; Calgene, Davis, Calif.); Nicotiana tabacum cv. Samsun, wild
transformation. type (parental), XynZ-34, and XynZ-46 (transgenic; xylanase production) (13);
For increased strain stability the marker rescue cassette of pMR30 was inte- Brassica napus cv. Drakkar, wild type (parental), B600, and B675 (transgenic;
grated into the chromosome of Acinetobacter sp. strain BD413 with the alkM fatty acid production; R. Töpfer, Bundesanstalt für Züchtungsforschung, Groß
gene (32) as the insertion site. The Acinetobacter alkM gene was amplified with Lüsewitz, Germany). Purified plant DNA was stored in TE buffer (10 mM
primers alkM-f (ccaccggtaccATGAATGCACCTGTACATGTC; noncomple- Tris-HCl, 1 mM EDTA, pH 8.0) (36) at 4°C.
mentary nucleotides in lowercase) and alkM-r2 (atcaactcgAGGTCTGATTACT Experimental designs to distinguish between DNA spread by roots and pollen.
TGCCG) and cloned into the EcoRV site of pBluescript II SK(⫹) (Stratagene), For each of the experiments of Table 2, several nontransgenic (line Désirée) or
giving pBlue-alkM1. From pBlue-Km-tg4 (Fig. 1A) a 2.28-kb SalI-NotI fragment transgenic potato plants (line DL10) or plants from both lines were grown in the
containing the nptII-tg4 fusion was excised, blunted, and cloned into the single field or greenhouse. Depending on the experiment the plants were grown sep-
BsgI site within alkM, giving plasmid pMR30R-cw. Natural transformation of arately (distance greater than 10 m) or side by side. For experiment 1, rhizo-
strain BD413 Rifr (a spontaneously rifampin-resistant BD413 mutant) with sphere extracts were prepared from four plants grown in the field (summer 2002)
EcoRV-linearized pMR30R-cw and selection for kanamycin resistance resulted and six plants grown in the greenhouse (two plants in 2001, four plants in 2002).
in strain JV28-Kmr, which carried the nptII-tg4 fusion in the chromosomal alkM Experiment 2 was carried out with eight plants (DL10) grown in 2002 in the
gene. The nptII-tg4 cassette was replaced by the nptII⬘-tg4 cassette through allelic greenhouse. For experiment 3, six rhizosphere extracts were prepared each from
exchange by nonselective natural transformation with pMR13 DNA. At a con- five combined Désirée plants of the 1999 field plots sampled in spring (beforeVOL. 69, 2003 BIOMONITORING OF RECOMBINANT PLANT DNA SPREAD 4457
flowering). Due to the randomized block design, each plot of nontransgenic determined with pSR8-36 (31) added to the rhizosphere extract prior to dena-
plants was neighbored by plots of transgenic lines on at least one side. The turation and was between 10 and 50 molecules.
transgenic roots could thus invade the Désirée plots. For experiment 4, nine
rhizosphere extracts were used; each of them was obtained from five combined
DL10 plants from the 1999 field plots. The plants of experiments 5 to 9 were RESULTS
grown in summer 2002 in plastic containers to prevent invasion of their soil by
roots of neighboring plants. In the field plot, the containers were installed in the The transgene-specific marker rescue system. The trans-
field soil in order to provide the same growth conditions as those for plants genic potato lines used in this study were constructed by
growing without plastic containers. Plants for experiment 6 were grown in a
separate greenhouse in which no transgenic flowering potato plants were
Agrobacterium tumefaciens-mediated transformation of potato
present. Side to side with the four Désirée plants several DL10 plants were leaf disks with the plasmid pSR8-36 (31). The transferred
grown, but their flowers were removed immediately after appearance and before DNA (T-DNA) of this plasmid contains the marker gene nptII,
opening. Roots of the Désirée plants from this experiment were also used for which is expressed from a nos promoter and which is followed
experiment 7. The parental or transgenic genotypes of all individual plants of by the eukaryotic tg4 terminator. We have exploited the nptII-
experiments 1, 2, and 5 to 9 were verified by PCR amplification of the nptII-tg4
fusion and/or by marker rescue transformation of strain JV28 with leaf-extracted
tg4 region of the T-DNA for a specific biomonitoring of DNA
DNA. from the transgenic potato plants. For this, inverse PCR was
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
Marker rescue transformation and PCR control of transformants. Concen- used to truncate the nptII gene by 51 bp at the downstream end
trated competent-cell suspensions of Acinetobacter sp. strain BD413(pMR30) or and by the deletion of a further 182 bp directly fused to the tg4
Acinetobacter sp. strain JV28 were prepared as described previously (5) and terminator (Fig. 1A; see Materials and Methods). The deletion
stored at ⫺80°C until use. The transformation cultures (20 ml each; recipient
titer, 2.5 ⫻ 108 ml⫺1) were prepared by dilution of 0.5 ml of freshly thawed
cassette was cloned into a broad-host-range plasmid, giving
competent-cell suspension into LB (36). Extract volumes corresponding to 100 plasmid pMR30 (Fig. 1A). The truncation of nptII caused
mg of fresh root material (1.0 ml of rhizosphere extract) or 200 mg of dry soil (2.0 kanamycin sensitivity.
ml of stomacher soil extract or 0.2 ml of SDS soil extract) were added to a When cells of Acinetobacter sp. strain BD413 containing
transformation culture, followed by aeration for 90 min at 30°C. In transforma- pMR30 take up DNA with the full-length nptII fused to tg4 (i.e.,
tion assays with purified plasmid or plant DNA the transformation culture
volumes ranged from 0.2 to 20 ml and various DNA concentrations were used.
the construct present in chromosomal DNA from the transgenic
Transformants were selected on LB agar containing kanamycin (10 g ml⫺1) potato plants or in pSR8-36), this DNA can lead to the fill up of
and, when strain JV28 and nonsterile extracts were used, rifampin (100 g ml⫺1) the deletion by recombination events in the two homologous
and cycloheximide (75 g ml⫺1). Typically, the cells of a 20-ml assay mixture regions upstream and downstream of the deletion (i.e., in the
were concentrated by centrifugation and spread on four selective plates. The nptII⬘ and tg4 sequences; Fig. 1B), which were 775 and 456 bp,
recipient titers were determined on LB agar. Transformants obtained from
nonsterile soil or rhizosphere extracts were checked by PCR in two ways. First,
respectively. This results in a restoration of nptII, measurable by
the identity of the transformants was verified by randomly amplified polymorphic the formation of kanamycin-resistant transformants.
DNA PCR (RAPD-PCR) using the primer F1G (CGGATGGGTGATTTTTA Determination of sensitivity and transgene specificity. Cells
GGA) and parameters as described previously, including four cycles with 40°C of Acinetobacter sp. strain BD413(pMR30) were transformed with
annealing temperature (38). All transformants yielded a pattern of six separate DNA of the plasmid pSR8-36 containing the nptII-tg4 fusion. As
bands, which was undistinguishable from that produced by the recipient strain
JV28. Other strains including E. coli K-12 and Pseudomonas stutzeri gave no
shown in Fig. 2, the transformation frequencies obtained with
detectable PCR products. Second, by using a primer specific for the correctly pSR8-36 DNA increased linearly up to 0.1 g ml⫺1 with an ascent
filled up deletion (R1b; AGCGCATCGCCTTCTATCGC) and a reverse primer of 1.0 (single-hit curve). In the linear range, one transformant was
binding within alkM (alkM-r1; AGCTATGCTCTGGCATGG) it was verified obtained per 1.5 ⫻ 104 nptII-tg4 fusions present in the transfor-
that the kanamycin-resistant clones indeed were transformants of JV28 with a mation culture. At higher DNA concentrations the increase of the
correctly filled up marker rescue cassette. Transformants obtained with strains
containing pMR30 were verified by PCR with primer R1b and primer L5 (CA
transformation frequency leveled off. At the highest DNA con-
ACCATATCGGTGCGCTCT; binding within the strA gene of pMR30). centration tested (100 g ml⫺1), about 3% of the recipient cells
Magnetic capture hybridization. For the detection of recombinant DNA by were transformed. Similarly high transformation frequencies
PCR, the target DNA in rhizosphere extracts was isolated by magnetic capture were previously obtained by Palmen et al. (30) using Acinetobacter
hybridization. The method was adapted from that of Jacobsen (16) with the sp. strain BD413 and a plasmid carrying an nptII gene embedded
following specifications. The target sequence was the T4 lysozyme gene present
in the transgenic potato lines except for DC1. A magnetic hybridization probe
within chromosomal DNA. Linearization of pSR8-36 by ClaI
was prepared by coupling a 5⬘-biotinylated 98-mer oligonucleotide binding to the treatment prior to transformation did not change the transforma-
center of the T4 lysozyme gene (nucleotides 373 to 470 of the sense strand of the tion frequency (e.g., transformation frequencies of 1.04 ⫻ 10⫺2
T4 lysozyme open reading frame) to paramagnetic M-280 streptavidin beads and 1.05 ⫻ 10⫺2 were obtained at a DNA concentration of 1 g
(Dynal, Skøyen, Norway). For capturing recombinant DNA, 200 l of rhizo- ml⫺1 with circular and linearized pSR8-36 DNA, respectively).
sphere extract was boiled for 10 min and centrifuged for 10 min at 16,000 ⫻ g and
4°C and 50 l of the supernatant was added to 330 l of hybridization solution
This suggests that transformation by linear DNA (e.g., as recov-
and 20 l of a 10-mg ml⫺1 suspension of the probe-carrying paramagnetic ered from plants) is as efficient as that by circular DNA.
particles. The tubes were incubated in a rotating hybridization oven for 4 h at DNA of the transgenic potato plants contains the nptII-tg4
62°C. After magnetic separation and the washing of the beads, the beads were fusion at about 106-fold-lower concentration per mole of nu-
resuspended in 25 l of sterile water. The presence of the target sequence was cleotide than pSR8-36 DNA due to the large excess of potato
determined by PCR with primers complementary to recombinant fusion sites at
both ends of the T4 lysozyme gene, namely, the fusion of the signal peptide and
DNA. In fact, the transformation frequencies with DNA from
T4 lysozyme coding sequence (CCGGGTTGGCGTCCATGAAT) and of the the transgenic potato (DC1) were nearly 106-fold lower than
35S terminator and vector sequences (CATGCCTGCAGGTCACTGGA). The those with corresponding concentrations of pSR8-36 DNA
PCR mixtures contained 5 l of the sample in a final volume of 30 l. Ampli- (Fig. 2). The limit of detection of transgenic potato DNA was
fication was carried out with PCR Ampliwax Gems (Perkin-Elmer, Weiterstadt,
20 ng ml⫺1 (200 ng total in 10 ml of transformation culture),
Germany) and 0.6 U of AmpliTaq (Perkin-Elmer) as recommended by the
supplier. PCR conditions were 5 min at 94°C; 40 cycles of 94°C for 30 s, 65°C for
corresponding to 2.7 ⫻ 104 nptII-tg4 fusion molecules, which
45 s, and 72°C for 90 s; and finally 12 min at 72°C in a DNA Thermal Cycler 480 yielded an average of 1.3 transformants. As observed with
(Perkin-Elmer). The detection limit of the magnetic capture step plus PCR was pSR8-36 DNA, at concentrations above 0.1 g ml⫺1 the in-4458 DE VRIES ET AL. APPL. ENVIRON. MICROBIOL.
TABLE 1. Specific detection of the potato transgene by natural
transformation of Acinetobacter sp. strain BD413(pMR30) by using
leaf-extracted DNA from various nontransgenic and transgenic
plants (with nptII)
No. of Kmr
Plant line n
transformantsa
Solanum tuberosum
Désirée (parental) 0 8
DC1 (transgenic) 45.8 ⫾ 10.3 4
DL4 (transgenic) 37.7 ⫾ 16.9 3
DL5 (transgenic) 40.9 ⫾ 16.2 7
Beta vulgaris subsp. vulgaris
L5 (parental) 0 2
L3 (transgenic) 0 3
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
Lycopersicon esculentum
Parental 0 1
FLAVR SAVR 0 3
(transgenic)
Nicotiana tabacum
Samsun (parental) 0 4
FIG. 2. Transformation of Acinetobacter sp. strain BD413(pMR30) XynZ-34 (transgenic) 0 2
by genomic DNA from the transgenic potato line DC1 (F), plasmid XynZ-46 (transgenic) 0 1
DNA of pSR8-36 containing the nptII-tg4 fusion of DC1 (Œ), and
pKm1 containing the nptII gene without the tg4 terminator (). The Brassica napus
numbers of nptII genes per 1 g of DNA are 1.36 ⫻ 105 (DC1), 1.02 Drakkar (parental) 0 4
⫻ 1011 (pSR8-36), and 1.58 ⫻ 1011 (pKm1). Data are from three B600 (transgenic) 0 1
determinations; error bars, standard deviations. a
Determined with 3 g of purified leaf DNA per 20-ml transformation cul-
ture; the data are means of n experiments ⫾ standard deviations.
crease of the transformation frequency leveled off, indicating cluded that the novel marker rescue system is as specific for its
the beginning of saturation of the system. The results suggest cognate transgenic fusion with plant DNA as with plasmid DNA.
that the transformation frequency depends primarily on the Chromosomal integration of the marker rescue cassette in
number of target sequences in the assay, as was observed Acinetobacter. To achieve high genetic stability for the moni-
previously (5). toring strain without the need for selective pressure to main-
Compared to transformation by pSR8-36, transformation by tain pMR30, we inserted the marker rescue cassette from
pKm1 DNA was about 6,000-fold less efficient at low DNA pMR30 into the alkM gene of the chromosome of Acineto-
concentration and at least 1,000-fold less efficient at high DNA bacter sp. strain BD413 Rifr, yielding strain JV28 (see Materi-
concentration (Fig. 2). This is explained by the lack of the tg4 als and Methods). The alkM gene is involved in alkane degra-
terminator next to nptII in pKm1, which is required for the dation, which is of no relevance for growth on LB media. The
efficient repair of nptII⬘ by homologous recombination. The transformation frequency with 0.1 g of ClaI-linearized
strong preference of the recipient cells to integrate the nptII- pSR8-36 DNA ml⫺1 with strain BD413(pMR30) Rifr ([3.7 ⫾
tg4 fusion DNA indicated the high transgene specificity of the 1.3] ⫻ 10⫺3) was about equal to that with strain JV28 ([3.1 ⫾
pMR30 marker rescue system. 0.8] ⫻ 10⫺3). This indicated that recombinant DNA monitor-
Specific detection of transgenic potato DNA. We examined ing by JV28 was as sensitive as that by strain BD413(pMR30).
whether the novel system could be used to discriminate between The results suggest that (i) the recombination frequency of the
plant DNA with the nptII-tg4 fusion (i.e., the transgenic potato recipient cells was not influenced by the chromosomal or ex-
DNA) and the DNA of other transgenic plants having nptII but trachromosomal location of the target sequence and (ii) mul-
different downstream nucleotide sequences. As shown in Table 1, tiple marker rescue cassettes provided by the low-copy-number
the DNA from transgenic potato plants (DC1, DL4, and DL5) plasmid (copy number about 3) did not increase the transfor-
consistently gave Kmr transformants of Acinetobacter cells with mation frequency in comparison to that for a single cassette
pMR30 (average transformation frequency, 8 ⫻ 10⫺9). As ex- per chromosome. For the following experiments JV28 was
pected, DNA of parental plants without nptII did not yield any used as the recipient strain.
transformants. DNA from five transgenic plants containing nptII, Detection of recombinant DNA in the plant rhizosphere.
including tomato, sugar beet, tobacco, and rape plants, and five The transgenic potato lines DL4 and DL5, expressing the T4
nontransgenic parental lines also did not produce Kmr transfor- lysozyme gene, the transgenic control line DC1, and the pa-
mants (Table 1). This result is consistent with the data obtained rental line Désirée were studied in field release experiments
with pKm1 DNA in Fig. 2 showing that the absence of the second for their performance from 1996 to 1998 (14). In 1999 and 2000
homologous recombination site decreases the transformation fre- the studies were continued with two further T4 lysozyme gene-
quency strongly. In the experiments of Table 1 the transformation expressing potato lines (DL10 and DL12) and involved plant-
frequency fell below the detection limit (2 ⫻ 10⫺10). It is con- ing the tubers in a different area of the field every year. TheVOL. 69, 2003 BIOMONITORING OF RECOMBINANT PLANT DNA SPREAD 4459
corresponding result was obtained by a different DNA-moni-
toring approach in which the presence of the recombinant T4
lysozyme gene in potato rhizosphere extracts was determined
by PCR amplification of DNA recovered by magnetic capture
hybridization (16). A survey of the field plots from 1996 and
1997 by this method gave four positive scores out of 116 ex-
tracts from plots of plant lines without the T4 lysozyme gene
(Désirée and DC1). The PCR signals were obtained with sam-
ples from flowering plants (1 out of 44 samples [2.3%]) and
senescent plants (3 out of 38 samples [7.9%]), but not from
juvenile plants (34 samples). From the transgenic plant lines
with the T4 lysozyme gene (DL4 and DL5) a much higher
proportion of the rhizosphere extracts gave PCR products (98
out of 116 samples).
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
We have carefully addressed the possibility of false-positive
transformed JV28 clones by PCR analysis of 190 clones from
transformations with rhizosphere extracts from the field plots
(143 transformants) and the greenhouse (32 transformants)
and with SDS soil extracts from stored soil samples (15 trans-
formants; see “Persistence of recombinant DNA from pollen
in soil” below). Of these, 95 transformants were checked with
primers binding on both sides of the deletion and 135 were
FIG. 3. Transformation of the biomonitoring strain Acinetobacter checked with primers binding on one side and within the de-
sp. strain JV28 with rhizosphere extracts from a field release experi-
ment with potato plants. The fractions of samples yielding transfor-
letion (primers specified in Materials and Methods). All 190
mants and the average transformation frequencies of the positive sam- transformants yielded the expected products. In addition, 20
ples for the transgenic potato plants (DC1, DL10, and DL12) and transformants composed from these three groups were char-
parental plants (Désirée) are given separately. Tubers were planted on acterized by RAPD-PCR and were not distinguishable from
19 May 1999. Sampling dates were 30 June (juvenile), 11 August the parental strain Acinetobacter sp. strain JV28 (see Materials
(flowering), and 20 September (senescent) 1999.
and Methods).
DNA spread by roots and pollen. Since the rhizosphere
samples from transgenic and parental plants studied in Fig. 3
field design was a randomized block design with six to nine came from a randomized block design field experiment in
plots per line, each containing 15 plants, in which each plot of which plants grew in close proximity (leaves touching), it was
the parental line was neighbored by plots of transgenic lines on suspected that the recombinant DNA detected in nontrans-
at least one side. During the field releases rhizosphere extracts genic samples was spread from the plots of transgenic plants.
were sampled for bacterial community analyses (14, 20). We Two possible routes of DNA spread into rhizosphere extracts
assayed these nonsterile extracts for their content of recombi- from other plants were considered: (i) roots of transgenic
nant DNA by the marker rescue assay. Typically, 20 ml of plants may have grown into the areas of the parental plants,
transformation culture (JV28) was mixed with 1.0 ml of rhizo- causing the presence of recombinant DNA there, and (ii) pol-
sphere extract. The Kmr transformants were identified as JV28 len of nearby flowering transgenic plants that was deposited on
by RAPD fingerprinting and PCR amplification of the filled-up the soil surface may have been transported into the rhizo-
nptII-tg4 region (see below). With rhizosphere extracts from sphere by, e.g., rain, or introduced into the rhizosphere during
juvenile plants, transformants were obtained from six out of sampling of the roots.
nine plots with transgenic plants (Fig. 3). At the stages of To identify and roughly quantify the contribution of both
flowering and senescence transformants were obtained with all possible routes to DNA spread in the field, we conducted a
of the extracts (18 of 18). The transformation frequencies series of experiments, the results of which are summarized in
increased from juvenile to flowering plants and remained at Table 2. First, rhizosphere extracts were prepared from paren-
the high level until senescence. These results indicated the tal plants (Désirée) grown separately (distance larger than
frequent presence of free transforming recombinant DNA in 10 m) from transgenic plants either in a greenhouse or in field
the rhizosphere extracts at any growth stage of the plants. The plots so that genetic cross contamination by roots and pollen
DNA may have been released from the roots into the rhizo- was excluded. No transformants were obtained in these cases
sphere or set free by cell disruption during extract preparation (Table 2, experiment 1). The absence of any transformants in
(see Discussion). these assays indicated that nptII genes from other sources such
Surprisingly, transformants were also obtained with 13 out of as soil microorganisms did not contribute to transformant for-
18 rhizosphere extracts obtained from parental plant plots at mation with JV28 recipient bacteria. Further, the absence of
early and late stages of development (Fig. 3). The average transformants in these control experiments suggested that the
transformation frequencies were, however, lower than those recombinant DNA found in the plots of the parental plants
for the transgenic plants but also increased at the time of before flowering (Fig. 3, juvenile parental plants) derived from
flowering (Fig. 3). These data clearly indicated the presence of invading roots of neighboring transgenic plants. To assess
nptII-tg4 fusion DNA in rhizospheres of parental plants. A whether DNA is actually present in rhizosphere extracts from4460 DE VRIES ET AL. APPL. ENVIRON. MICROBIOL.
TABLE 2. Analysis of the impact of transgenic root invasion and transgenic pollen dispersal on the occurrence of recombinant DNA in
rhizosphere and surface soil samples from plants in field plot and greenhouse
Presence of
No. of transformants/109 recipient
transgenic
Expt Plant line Sample type Time of sampling and experimental setupa cellsb in:
DNA from:
Pollen Roots Field plot Greenhouse
c
1 Désirée Rhizosphere Before flowering of and distant from transgenic plants ⫺ ⫺ ⱕ1.0 (4) ⱕ0.8 (6)
2 DL10 (transgenic) Rhizosphere Before flowering ⫺ ⫹ NDd 59.6 ⫾ 45.7 (8)
3 Désirée Rhizosphere Before flowering; grown close to transgenic plants ⫺ ⫹ 22.0 ⫾ 19.6 (6) ND
4 DL10 (transgenic) Rhizosphere During flowering ⫹ ⫹ 75.6 ⫾ 50.7 (9) ND
5 Désirée Rhizosphere During flowering of neighboring transgenic plants ⫹ ⫺ 9.1 ⫾ 6.6 (8) 14.4 ⫾ 14.4 (4)
6 Désirée Rhizosphere Flowers of neighboring transgenic plants removed ⫺ ⫺ ND ⱕ1.1 (4)
7 Désirée Rhizosphere Roots powdered with transgenic pollene ⫹ ⫺ ND 35.8 ⫾ 24.8 (4)
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
8 Désirée Surface soil Soil powdered with transgenic pollen; SDS soil extracts ⫹ ⫺ 26.8 ⫾ 19.2 (3) 59.8 ⫾ 10.9 (2)
9 Désirée Surface soil Samples of expt 8; stomacher soil extracts ⫹ ⫺ 22.4 ⫾ 17.1 (3) 11.8 ⫾ 5.7 (2)
a
Field plot plants of experiments 1 to 4 were grown directly in the field soil, while those of experiments 5 to 9 were grown in field soil in plastic containers (⬃25
cm in diameter) to prevent invasion of roots from neighboring plants.
b
The numbers of experiments are given in parentheses. Details on the sampled plants and the experimental design are provided in Materials and Methods.
Transformation frequencies are given with standard deviations (n ⬎ 2) or deviations from the means (n ⫽ 2). When no transformants were found, the limit of detection
obtained from four to six experiments is given.
c
Samples were taken at several time points from juvenile plants until the first buds of transgenic flowers were visible.
d
ND, not determined.
e
Pollen was introduced by gentle flicking of a fresh flower from a transgenic plant ⬃10 cm above the freshly harvested roots.
growing plants, rhizosphere extracts were prepared from juve- transformants were always obtained when pollen from flowers
nile transgenic plants (line DL10) grown in a greenhouse and of transgenic plants was directly powdered over parental root
sampled before flowering. Transformants arose at high fre- material (experiment 7). These results imply that pollen was
quency from all of the extracts (Table 2, experiment 2), indi- spread from the transgenic plants onto the soil and contributed
cating that transgenic roots can contribute to the transforming to the presence of recombinant DNA in the rhizosphere ex-
activity of rhizosphere extracts. When nontransgenic plants tracts of transgenic and parental plants.
were grown in a field plot side by side with transgenic plants To determine the efficiency of the rhizosphere extraction
and not protected from the invasion by transgenic roots, trans- procedure for the recovery of DNA from pollen, we introduced
formants arose from rhizosphere extracts from nontransgenic tiny amounts of pollen from transgenic plants into surface soil
plants before the flowering of the transgenic plants, although samples collected from parental plants, divided the samples
at low frequency (Table 2, experiment 3). This is in accordance into two fractions, and extracted these either by the rhizo-
with the data of Fig. 3 and supports the conclusion that roots sphere extraction protocol (stomacher soil extracts) or by a
of transgenic plants were a source of recombinant DNA in the protocol for total DNA extraction using hot SDS and ultra-
block design field plots of parental plants. The combined ef- sonication (42) (SDS soil extracts). Transformants were ob-
fects of transgenic roots and transgenic pollen on the transfor- tained with each of the extracts (Table 2, experiments 8 and 9).
mation activity in rhizosphere extracts were seen with extracts With the stomacher soil extracts (experiment 9) the average
from flowering transgenic plants, which gave higher transfor- transformation frequency ranged from 20 to 80% of that ob-
mation frequencies than those observed before flowering (Ta- tained with the SDS soil extracts, indicating only partial release
ble 2, experiment 4 versus 2). This is also in accord with the and/or recovery of DNA by the stomacher method.
increasing transformation frequency obtained in Fig. 3 (trans- Persistence of recombinant DNA from pollen in soil. The
genic plants, juvenile versus flowering and senescent). fact that the transformation frequencies in the biomonitoring
To identify the effect of pollen production alone, the inva- assay increased three- to fourfold at the time of flowering but
sion of the root area of parental plants by roots of transgenic did not decrease for several weeks after pollen production
plants was prevented by the growth of both types of plants in (Fig. 3) suggested that potato pollen or the DNA from it had
plastic containers in the field plots. Containers were filled with persisted during this period. To test for DNA persistence, we
the field soil and installed in the soil surface of the plot to assayed surface soil samples that had been taken in 1998 at a
provide the same growth conditions as those for the other distance of 2 m from the field plots with transgenic and paren-
plants in the plot. Greenhouse plants were grown in plastic tal potato plants at the stage of senescence and since then had
containers without installation in soil. After the transgenic been stored moist in closed plastic bags at 4°C in the dark. SDS
plants started flowering, transformants were obtained with rhi- soil extracts were prepared from two such samples and gave
zosphere extracts from the neighboring parental plants in both transformation frequencies of 8 ⫻ 10⫺9 and 28 ⫻ 10⫺9 with
cases, i.e., when the growth occurred side by side in the field 200 l of extract added per 20-ml transformation culture. Sim-
plot and in the greenhouse (Table 2, experiment 5). No trans- ilarly, transformants were obtained with 6 out of 10 SDS soil
formants appeared at the time of flowering when all flowers extracts prepared from surface soil samples devoid of discern-
from the transgenic plants were removed before pollen spread ible plant tissue litter, which were collected from the field plot
(greenhouse experiment; Table 2, experiment 6). As a control, in 1998 at a distance of 10 to 30 cm from transgenic potatoVOL. 69, 2003 BIOMONITORING OF RECOMBINANT PLANT DNA SPREAD 4461
plants during flowering and since then had been stored at 4°C the marker rescue cassette in the chromosome or on the plas-
in the dark. The transformation frequencies ranged from 6 ⫻ mid does not affect the efficiency of transformation; this may
10⫺9 to 25 ⫻ 10⫺9. These results show that DNA presumably be explained by the rather low copy number of the plasmid.
spread by pollen can persist for at least 4 years in stored soil. The sensitivity of our biomonitoring approach, giving about
We also examined soil samples which were taken in April 1998 one transformant per 104 target molecules, irrespective of the
from field plots in which transgenic potatoes had been grown in presence of a large excess of, e.g., plant DNA, is not much less
1997. From these, 6 out of 10 gave transformation frequencies than that of routine PCR applications, which generally also
of 3 ⫻ 10⫺9 to 9 ⫻ 10⫺9. It is concluded that plant DNA either require ⬎103 target molecules (e.g., 10 ng of template DNA
enclosed in plant material or as free DNA had persisted for 8 are usually required for the amplification of single-copy genes
months during the winter period in the field site and had from eukaryotic genomes [PCR applications manual, 2nd ed.,
retained its transforming potential also during the following 4 Roche Diagnostics GmbH, Mannheim, Germany, 1999]).
years of storage. Moreover, the DNA which is introduced into the assay does
not have to be highly purified but can be present in aqueous
extracts from soil without further removal of PCR-inhibiting
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
DISCUSSION
substances such as humic acids (39).
The recombinant DNA of genetically modified organisms Do transgenic plants spread recombinant DNA into the
can be specifically detected by PCR amplification using prim- environment? Recombinant DNA has previously been de-
ers targeted to a recombinant fusion, i.e., binding to two se- tected in soil samples containing litter from transgenic tobacco
quences that are normally not contiguous. We have applied (29, 41), potato (41), and sugar beet (10) plants. Since the
this principle in the novel biomonitoring of recombinant DNA methods used in this study for the extraction of total DNA
from transgenic plants. The specificity of the marker rescue included harsh steps such as ultrasonic and hot-SDS treatment,
transformation with the nptII-tg4 fusion is based on the re- it is not clear whether the plant DNA was extracellular or
quirement of sequence identity for homologous recombination released from plant cells during the extraction procedure. The
during transformation and on the presence of the two normally specific detection of extracellular DNA in soil can be achieved
not contiguous sequences on the sides of the selective marker. by a mild aqueous elution technique not leading to cell disrup-
The nptII gene itself lends most of its sequence as one recom- tion (2). When this method was recently applied in parallel to
bination side, the fill up of the terminal nptII deletion consti- the procedure for total DNA extraction, it was demonstrated
tutes the selective marker, and the tg4 terminator is the second that a fraction of soil samples from field release experiments
recombination side. The precision of homologous recombina- with transgenic sugar beets contained free recombinant DNA
tion in the fill up of the terminal nptII deletion was underlined (23). Here we found that recombinant nptII DNA is present in
by the molecular analysis of 190 transformants from various aqueous extracts from rhizospheres of transgenic potato plants
experiments by PCR which revealed not a single case of irreg- and from soil samples taken from field plots with transgenic
ular recombination. While 14 transformation tests with potato plants or from plots without transgenic plants close by. These
DNA containing the nptII-tg4 fusion always yielded about 40 extracts were prepared without ultrasonic or hot-SDS treat-
transformants, no false positives were scored in 10 tests with ment. However, the possibility that DNA was set free from
DNA from five other transgenic plants having nptII without tg4 tissue cells or pollen present in the soil material by mechanical
(Table 2). These DNA samples had previously given hundreds forces during aqueous-extract preparation was not excluded. In
of transformants with a transformation-based bioassay (Acin- fact, the presence of transforming DNA in extracts prepared
etobacter sp. strain BD413 with pMR7) measuring the presence from samples into which transgenic pollen was introduced di-
of the nptII gene alone (5). False positives were also not ob- rectly from the potato flowers argues for a pollen breaking
tained with total DNA recovered from soil, indicating that effect. Importantly, DNA was detected by our test from juve-
nptII genes that might have been present in the soil microbiota nile to senescent growth stages and not only during the decay
were discriminated by the specificity of our marker rescue of plant litter, as was found in previous studies. The data
system. The rare false positives were found only when the suggest that roots can spread DNA in the soil during plant
transformation assay was swamped with nptII-containing plas- growth, either as free molecules or within plant tissue material.
mid DNA. These transformants probably arose from illegiti- This may occur by in situ destruction of rhizodermis or calyptra
mate recombination events, which are strongly facilitated by cells or the deposition of dead root tissue. The recovered DNA
nearby homologous recombination (6). However, in the ab- was of high molecular weight and was able to transform com-
sence of any homology, the integration of nptII into transform- petent recipient cells. With respect to horizontal gene transfer,
able bacteria is extremely rare and remained undetectable the potential for natural transformation is a more relevant
(⬍10⫺13 per nptII [4]). Note that the principle of our assay also measure than the potential for amplification by PCR, because
works with combinations of other antibiotic resistance genes it directly demonstrates that the material is still biologically
and downstream nucleotide sequences (T. Herzfeld, J. de functional. Detection by PCR and biological function may not
Vries, and W. Wackernagel, unpublished data). always coincide (34).
The effectiveness of the biomonitoring of recombinant po- The results of Table 2 suggest that, besides plant root ma-
tato DNA by Acinetobacter sp. strain JV28 carrying a single terial, pollen was a source of recombinant DNA. Pollen is
marker rescue cassette in the chromosome was equivalent to probably particularly important in terms of long-distance gene
that by a strain having the cassette on plasmid pMR30 and was spread, because as part of the reproductive system the function
similar to that by the previously described strain Acinetobacter of pollen is gene movement. The distances covered by pollen
sp. strain BD413 with pMR7 (5). Apparently, the presence of have been determined with transgenic plants carrying a nuclear4462 DE VRIES ET AL. APPL. ENVIRON. MICROBIOL.
transgene by assaying the formation of transgenic seeds by transfer of antibiotic resistance genes from transgenic (transplastomic) to-
bacco plants to bacteria. Appl. Environ. Microbiol. 68:3345–3351.
nontransgenic bait plants. While potato pollen is transported 18. Lorenz, M. G., K. Reipschläger, and W. Wackernagel. 1992. Plasmid trans-
by wind less than 10 m (22), the pollen of the sugar beet, which formation of naturally competent Acinetobacter calcoaceticus in non-sterile
is also a wind pollinator, is transported over distances of at soil extract and groundwater. Arch. Microbiol. 157:355–360.
19. Lorenz, M. G., and W. Wackernagel. 1994. Bacterial gene transfer by natural
least 200 m (35). The fact that soil containing potato pollen genetic transformation in the environment. Microbiol. Rev. 58:563–602.
and perhaps small tissue fragments retained much of its trans- 20. Lottmann, J., H. Heuer, K. Smalla, and G. Berg. 1999. Influence of trans-
forming activity over the winter period and during a subse- genic T4-lysozyme-producing potato plants on potentially beneficial plant-
associated bacteria. FEMS Microbiol. Ecol. 29:365–377.
quent storage period of four years suggests that DNA in pollen 21. Mannerlöf, M., B.-L. Lennerfors, and P. Tenning. 1996. Reduced titer of
or released from it may be particularly stable. It was recently BNYVV in transgenic sugar beets expressing the BNYVV coat protein.
Euphytica 90:293–299.
inferred that pollen of transgenic sugar beet plants was an 22. McPartlan, H. C., and P. J. Dale. 1994. An assessment of gene transfer by
important source for recombinant-DNA spread, because soil pollen from field-grown transgenic potatoes to non-transgenic potatoes and
samples taken at distances up to 50 m from the plants gave related species. Transgenic Res. 3:216–225.
23. Meier, P., and W. Wackernagel. 2003. Monitoring the spread of recombinant
positive results in PCR or transformation tests only when pol- DNA from field plots with transgenic sugar beet plants by PCR and natural
lination had occurred (23). In those studies an experimental transformation of Pseudomonas stutzeri. Transgenic Res. 12:293–304.
Downloaded from http://aem.asm.org/ on March 26, 2021 by guest
stop of the DNA dispersal through pollen by removal of flow- 24. Nap, J. P., J. Bijvoet, and W. J. Stiekema. 1992. Biosafety of kanamycin-
resistant transgenic plants. Transgenic Res. 1:239–249.
ers was not provided, as was conducted in this study. 25. Nielsen, K. M., A. M. Bones, K. Smalla, and J. D. van Elsas. 1998. Hori-
zontal gene transfer from transgenic plants to terrestrial bacteria—a rare
event? FEMS Microbiol. Rev. 22:79–103.
ACKNOWLEDGMENTS
26. Nielsen, K. M., A. M. Bones, and J. D. van Elsas. 1997. Induced natural
This work was supported by the BMBF and the Fonds der Chemis- transformation of Acinetobacter calcoaceticus in soil microcosms. Appl. En-
viron. Microbiol. 63:3972–3977.
chen Industrie.
27. Nielsen, K. M., F. Gebhard, K. Smalla, A. M. Bones, and J. D. van Elsas.
1997. Evaluation of possible horizontal gene transfer from transgenic plants
REFERENCES to the soil bacterium Acinetobacter calcoaceticus BD413. Theor. Appl. Genet.
1. Bagdasarian, M., R. Lurz, B. Rückert, F. C. H. Franklin, M. M. Bagdasar- 95:815–821.
ian, J. Frey, and K. N. Timmis. 1981. Specific purpose plasmid cloning 28. Nielsen, K. M., M. D. M. van Weerelt, T. N. Berg, A. M. Bones, A. N. Hagler,
vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and J. D. van Elsas. 1997. Natural transformation and availability of trans-
and a host-vector system for gene cloning in Pseudomonas. Gene 16:237–247. forming DNA to Acinetobacter calcoaceticus in soil microcosms. Appl. En-
2. Blum, S. A. E., M. G. Lorenz, and W. Wackernagel. 1997. Mechanism of viron. Microbiol. 63:1945–1952.
retarded DNA degradation and prokaryotic origin of DNases in nonsterile 29. Paget, E., M. Lebrun, G. Freyssinet, and P. Simonet. 1998. The fate of
soils. Syst. Appl. Microbiol. 20:513–521. recombinant plant DNA in soil. Eur. J. Soil Biol. 34:81–88.
3. Bruns, S., K. Reipschläger, M. G. Lorenz, and W. Wackernagel. 1992. Char- 30. Palmen, R., B. Vosman, P. Buijsman, C. K. D. Breek, and K. J. Hellingwerf.
acterization of natural transformation of the soil bacteria Pseudomonas 1993. Physiological characterization of natural transformation in Acineto-
stutzeri and Acinetobacter calcoaceticus by chromosomal and plasmid DNA, bacter calcoaceticus. J. Gen. Microbiol. 139:295–305.
p. 115–126. In M. J. Gauthier (ed.), Gene transfers and environment. Spring- 31. Porsch, P., A. Jahnke, and K. Düring. 1998. A plant transformation vector
er-Verlag, Berlin, Germany. with a minimal T-DNA. II. Irregular integration patterns of the T-DNA in
4. de Vries, J., P. Meier, and W. Wackernagel. 2001. The natural transforma- the plant genome. Plant Mol. Biol. 37:581–585.
tion of the soil bacteria Pseudomonas stutzeri and Acinetobacter sp. by trans- 32. Ratajczak, A., W. Geißdörfer, and W. Hillen. 1998. Expression of alkane
genic plant DNA strictly depends on homologous sequences in the recipient hydroxylase from Acinetobacter sp. strain ADP1 is induced by a broad range
cells. FEMS Microbiol. Lett. 195:211–215. of n-alkanes and requires the transcriptional activator AlkR. J. Bacteriol.
5. de Vries, J., and W. Wackernagel. 1998. Detection of nptII (kanamycin 180:5822–5827.
resistance) genes in genomes of transgenic plants by marker-rescue trans- 33. Romanowski, G., M. G. Lorenz, G. Sayler, and W. Wackernagel. 1992.
formation. Mol. Gen. Genet. 257:606–613. Persistence of free plasmid DNA in soil monitored by various methods,
6. de Vries, J., and W. Wackernagel. 2002. Integration of foreign DNA during including a transformation assay. Appl. Environ. Microbiol. 58:3012–3019.
natural transformation of Acinetobacter sp. by homology-facilitated illegiti- 34. Romanowski, G., M. G. Lorenz, and W. Wackernagel. 1993. Use of poly-
mate recombination. Proc. Natl. Acad. Sci. USA 99:2094–2099. merase chain reaction and electroporation of Escherichia coli to monitor the
7. Dietz, A. 1993. Risk assessment of genetically modified plants introduced persistence of extracellular plasmid DNA introduced into natural soils. Appl.
into the environment, p. 209–227. In K. Wöhrmann and J. Tomiuk (ed.), Environ. Microbiol. 59:3438–3446.
Transgenic organisms: risk assessment of deliberate release. Birkhäuser- 35. Saeglitz, C., M. Pohl, and D. Bartsch. 2000. Monitoring gene flow from
Verlag, Basel, Switzerland. transgenic sugar beet using cytoplasmic male-sterile bait plants. Mol. Ecol.
8. Düring, K., P. Porsch, M. Fladung, and H. Lörz. 1993. Transgenic potato 9:2035–2040.
plants resistant to the phytopathogenic bacterium Erwinia carotovora. Plant 36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
J. 3:587–598. laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
9. Flavell, R. B., E. Dart, R. L. Fuchs, and R. T. Fraley. 1992. Selectable marker Spring Harbor, N.Y.
genes: safe for plants? Bio/Technology 10:141–144. 37. Sikorski, J., S. Graupner, M. G. Lorenz, and W. Wackernagel. 1998. Natural
10. Gebhard, F., and K. Smalla. 1999. Monitoring field releases of genetically genetic transformation of Pseudomonas stutzeri in a non-sterile soil. Micro-
modified sugar beets for persistence of transgenic plant DNA and horizontal biology 144:569–576.
gene transfer. FEMS Microbiol. Ecol. 28:261–272. 38. Sikorski, J., N. Teschner, and W. Wackernagel. 2002. Highly different levels
11. Gebhard, F., and K. Smalla. 1998. Transformation of Acinetobacter sp. strain of natural transformation are associated with genomic subgroups within a
BD413 by transgenic sugar beet DNA. Appl. Environ. Microbiol. 64:1550–1554. local population of Pseudomonas stutzeri from soil. Appl. Environ. Microbiol.
12. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas- 68:865–873.
mids. J. Mol. Biol. 166:557–580. 39. Tebbe, C. C., and W. Vahjen. 1993. Interference of humic acids and DNA
13. Herbers, K., I. Wilke, and U. Sonnewald. 1995. A thermostable xylanase extracted directly from soil in detection and transformation of recombinant
from Clostridium thermocellum expressed at high levels in the apoplast of DNA from bacteria and yeast. Appl. Environ. Microbiol. 59:2657–2665.
transgenic tobacco has no detrimental effect and is easily purified. Bio/ 40. Wackernagel, W. 1996. Persistence of DNA in the environment and its
Technology 13:63–66. potential for genetic transformation, p. 137–146. In E. R. Schmidt and T.
14. Heuer, H., R. M. Kroppenstedt, J. Lottmann, G. Berg, and K. Smalla. 2002. Hankeln (ed.), Transgenic organisms and biosafety. Horizontal gene trans-
Effects of T4 lysozyme release from transgenic potato roots on bacterial fer, stability of DNA, and expression of transgenes. Springer-Verlag, Hei-
rhizosphere communities are negligible relative to natural factors. Appl. delberg, Germany.
Environ. Microbiol. 68:1325–1335. 41. Widmer, F., R. J. Seidler, K. K. Donegan, and G. L. Reed. 1997. Quantification
15. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the prep- of transgenic plant marker gene persistence in the field. Mol. Ecol. 6:1–7.
aration of bacterial plasmids. Anal. Biochem. 114:193–197. 42. Widmer, F., R. J. Seidler, and L. S. Watrud. 1996. Sensitive detection of trans-
16. Jacobsen, C. S. 1995. Microscale detection of specific bacterial DNA in soil genic plant marker gene persistence in soil microcosms. Mol. Ecol. 5:603–613.
with a magnetic capture-hybridization and PCR amplification assay. Appl. 43. Williamson, M. 1992. Environmental risks from the release of genetically
Environ. Microbiol. 61:3347–3352. modified microorganisms (GMOs)—the need for molecular ecology. Mol.
17. Kay, E., T. M. Vogel, F. Bertolla, R. Nalin, and P. Simonet. 2002. In situ Ecol. 1:3–8.You can also read
