Molecular Detection of Middle East Respiratory Syndrome Coronavirus from Dromedary Camels Illegally Transferred to Iran
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Original Article Acta Vet Eurasia 2022; 48(2): 117-122
Molecular Detection of Middle East Respiratory Syndrome
Coronavirus from Dromedary Camels Illegally Transferred to Iran
Laleh MOAZEMİ-GOUDARZI , Zahra ZIAFATIKAFI , Fahimehsadat SEYEDASGARI , Hamideh NAJAFI ,
Masoud HASHEMZADEH , Leila AGHAEEAN , Arash GHALYANCHILANGEROUDI
Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
Cite this article as: Moazemi-Goudarzi, L., Ziafatikafi, Z., Seyedasgari, F., Najafi, H., Hashemzadeh, M., Aghaeean, L., & Ghalyanchilangeroudi, A. (2022). Molecular detection of
middle east respiratory syndrome coronavirus from dromedary camels illegally transferred to iran. Acta Veterinaria Eurasia, 48(2), 117-122.
ORCID IDs of the authors: L.M.-G. 0000-0001-8004-7869, Z.Z. 0000-0002-8824-1276, F.S. 0000-0001-5192-9395, H.N. 0000-0001-5329-5808, M.H. 0000-0002-4331-278X, L.A. 0000-0002-0392-3682, A.G.
0000-0002-3031-5084.
Abstract
After the identification of Middle East respiratory syndrome coronavirus chain reaction and sequencing. The acquired sequences were applied for
from camels in Saudi Arabia by 2012, it has been believed that camel is a phylogenetic analysis in comparison with sequences of related regional
primary reservoir of Middle East respiratory syndrome coronavirus, and human cases and non-regional camel isolates. Nasal swabs from 3 out of
viral transmission from camel to human could occur. The current study is 18 camels showed positive results in both real-time reverse transcription
the initial announcement on Middle East respiratory syndrome coronavirus polymerase chain reactions. The nucleotide sequencing revealed that N
detection from camels in Iran. Middle East respiratory syndrome genome and ORF 1a fragments of the studied viruses had a high level of similarity to
was analyzed by real-time reverse transcription polymerase chain reaction the Middle East respiratory syndrome coronaviruses isolated from camels in
in samples taken from camels that illegally entered Iran. The presence of African countries, Arabian Peninsula, Pakistan, and to those isolated from a
Middle East respiratory syndrome coronavirus was investigated in nasal person in Iran. The current study is the primary report on the characteriza-
and rectal swab samples by real-time reverse transcription polymerase tion of Middle East respiratory syndrome coronavirus from Iranian camels.
chain reaction using primers specific for upE and ORF 1a genes. Positive
samples were then subjected to ORF 1a and N gene-distinct polymerase Keywords: Camel, Iran, MERS, molecular detection
Introduction Falzarano et al., 2017; Kandeil et al., 2019). Serological and molecular
studies suggest that the primary source of most MERS-CoV infec-
Middle East respiratory syndrome coronavirus (MERS-CoV) from tions in the Arabian Peninsula is dromedary camels. Certain studies
the genus Betacoronavirus is a positive-sense, single-stranded RNA proposed that the high densities of camel populations may con-
virus, spherical or pleomorphic in appearance with club-shaped tribute to the long-term maintenance of the virus within the camel
glycoprotein. It is a principal zoonotic agent with the ability to population (Kandeil et al., 2019; Ommeh et al., 2018). Middle East
produce severe respiratory disease in humans. By April 2019, 2428 respiratory syndrome coronavirus genome includes a 5'-terminal
confirmed cases of MERS worldwide were outlined, with MERS- cap accompanying the poly (A) tail at the 3’-end; the replicase gene
CoV being extremely common in dromedary camels and human encrypting the non-constructural proteins forms the 5’-most two-
infections resulting from direct contact with infected camels (1983 thirds of the genetic data, containing 16 non-constructural proteins
cases) (Peeri et al., 2020). Interestingly, a Middle Easterner has a his- (nsp1-16). Four structural proteins, including spike (S), envelope (E),
tory of traveling to Saudi Arabia. Dromedary camel is assumed as membrane (M), and nucleocapsid (N) protein, and five accessory pro-
a potent zoonotic origin and a connate reservoir for MERS-CoV (Ba teins (ORF3, ORF4a, ORF4b, ORF5, and ORF8) make up about 10 kb
Abduallah & Hemida, 2021; Farooq et al., 2020). Surveillance studies of the 3' end of the genome. In summary, the MERS-CoV genome is
proved the existence of MERS-CoV antibodies in dromedaries from typically arranged in the order of 5’-terminal-ORF1a-ORF1b-S-EM-N
United Arab Emirates (UAE), Saudi Arabia (SA), and various African -3’-terminal, and accessory proteins are sprinkled across the struc-
countries, including Mali, Nigeria, and Egypt (Chu et al., 2015, 2018; tural genes. The viral membrane possesses S, E, and M proteins; the
Copyright@Author(s) - Available online
Corresponding Author: Arash GHALYANCHILANGEROUDI • E-mail: arashghalyanchi@gmail.com; ghalyana@ut.ac.ir at actavet.org.
Content of this journal is licensed under
Received: August 20, 2021 • Accepted: January 20, 2022 • Available Online Date: April 7, 2022 • DOI: 10.54614/actavet.2022.21076 a Creative Commons Attribution-
NonCommercial 4.0
Available online at actavet.org International License.
117MOAZEMI-GOUDARZI et al. MERS in Camels
Acta Veterinaria Eurasia 2022; 48(2): 117-122
spike protein plays a critical role in viral entry, while M and E proteins Confirmatory Real-Time Reverse Transcription-Polymerase
take part in viral assembly, and N protein is needed for RNA synthesis Chain Reaction Assay Targeting ORF 1a
(Rohaim et al., 2021). Presently, real-time reverse transcription-poly- A 25-µL final volume of each reaction mixture contained 5 µL of
merase chain reaction (rRT-PCR) is employed to detect MERS-CoV RNA, 12.5 µL of 2× reaction buffer from the Superscript III one-step
in respiratory, blood, and stool specimens. Real-time RT-PCR assay RT-PCR system with Platinum Taq Polymerase, 1 µL of reverse tran-
is highly sensitive, allowing the detection of viruses even in small scriptase/Taq mixture from the kit, 0.4 µL of a 50 mM MgCl2 solution
amounts. The routine detection of MERS-CoV is founded on rRT-PCR (Invitrogen, Carlsbad, Canada), 1 μg of non-acetylated bovine serum
assays attacking upE and ORF 1a, both have high sensitivity, and ORF albumin (Sigma-Aldrich, Darmstadt, Germany), 10 µM of each primer
1b is less sensitive. Further confirmation can be assessed by partially EMC-Orf1a-Fwd (CCACTACTCCCATTTCGTCAG) and EMCOrf1a-Rev
sequencing the RNA-dependent RNA polymerase and nucleocap- (CAGTATGTGTAGTGCGCATATAAGCA), and 10 µM of probe EMCOrf1a-
sid (N) regions, as recommended by the World Health Organization Prb (6-carboxyfluorescein (FAM)-TTGCAAATTGGCTTGCCCCCACT-
(WHO, 2018). This study for the first time characterizes MERS-CoVs 6-carboxy-N,N,N,Nʹ-tetramethylrhodamine (Cinaclon, Tehran, Iran)).
from camels in Iran, compares the sequences of detected viruses Thermal cycling included 55°C for 20 minutes for the RT, followed by
with those from other countries (reports available on NCBI) so as to 94°C for 3 minutes, and a subsequent 45 cycles of 94°C for 15 sec-
describe the similarities and possible origin of the virus. onds and 58°C for 30 seconds. If the result was positive, the presence
of MERS-CoV was confirmed, and negative samples were submitted
Methods for NSeq assay (Corman et al., 2012b).
Case Background, Symptoms, and Sampling Reverse Transcription Polymerase Chain Reaction for
Eighteen Dromedary camels, illegally imported via Pakistan-Iran Generating Amplicons for N Gene and ORF 1a Sequencing
border in 2014, were captured by Iran Veterinary organization in Reverse transcription polymerase chain reaction assays for
Sistan-Baluchistan province, Iran (the event was reported to The both genes were applied as described by Corman et al. (2012a).
International Office of Epizootics (OIE) and were transferred to a
quarantine facility in Zahedan city, Iran, for further evaluation. Upon Sequencing and Comparing
examination, camels showed high temperature and mild respiratory ORF 1a and N gene amplicons were subjected to sequencing and
involvement accompanied by nasal discharge. Swab samples from polygenetic analysis. Sequencing reactions were performed by
the nasal cavity and rectum were collected and transferred to the BioNeer Co. (South Korea). Through nBLAST (http://blast.ncbi.nl
lab on ice. m.nih.gov/Blast.cgi), the nucleotide sequences of N and ORF 1a
genes determined in this investigation were compared to the
RNA Extraction MERS-CoV sequence data available in the National Center for
Swab samples were treated with 2× lysis buffer (10 g of Biotechnology Information database (http://ncbi.nlm.nih. gov), and
N-acetylcysteine/L, 0.9% sodium chloride) for 30 minutes in a shak- the phylogenetic relationships were established via MEGA7 soft-
ing incubator. RNA was extracted from the samples by use of a viral ware. All sequences were aligned with the use of ClustalW. Distance-
RNA mini kit (Qiagen) according to the manufacturer’s instructions. based neighbor-joining trees were constructed by use of P-Distance
An rRT-PCR targeting the upE gene was first performed with the test. The nucleotide sequence data reported here have already
extracted RNA. Positive upE rRT-PCR samples were then subjected contended to the GenBank sequence database, and their accession
to an rRT-PCR assay amplifying ORF 1a. In the next steps, positive numbers are KM044032, KM044033, and KM044034 for ORF 1a gene
products from both ORF 1a and N gene amplification experiments and MK905764 and MK905765 for gene N.
were submitted for sequencing.
Results
Real-Time Reverse Transcription-Polymerase Chain Reaction
Screening Assay for upE Gene In 3 out of 18 samples tested, both real-time RT-PCR assays gave
The previously described one-step rRT-PCR assay was performed positive results. The positive samples were then submitted for ampli-
using the OneStep RT-PCR Kit (Qiagen, Heiden, Germany) on fying the N and ORF 1a genes and sequencing (ORF 1a amplifica-
Rotor Q (Qiagen, Heiden, Germany) real-time PCR instrument. tion was done on two positive samples). Thereafter, the obtained
Each reaction was 25 µL containing 12.5 µL of 2× reaction buffer nucleotide sequences were compared with other MERS-CoV isolates.
from the Superscript III one-step RT-PCR system with Platinum Taq About 97.8–99.5% of nucleic acid sequence similarity of the N gene
Polymerase (Invitrogen, Carlsbad, Canada), 1 µL of reverse tran- and 97.6–100% of nucleic acid sequence homology of the ORF 1a
scriptase/Taq DNA polymerase mixture, 0.4 mM of each dNTP and gene were observed between newly identified viruses and the previ-
50 mM magnesium sulfate (Invitrogen—not provided with the ously known viruses isolated from camels. Moreover, compared to a
kit), 1 μg of non-acetylated bovine serum albumin (Sigma-Aldrich, MERS-CoV isolated from a person in Iran, the similarities were 49.5–
Darmstadt, Germany), 5 µL of RNA, 10 µM concentrations of upE 52.4% and 98.2% in genes N and ORF 1a, respectively (Tables 1 and
forward primer (GCAACGCGCGATTCAGTT) and upE reverse primer 2). As shown in Table 1, ORF 1a gene from newly identified viruses
(GCCTCTACACGGGACCCATA), and 10 µM of upE probe (6-carboxy- had almost 97% homology with previously known MERS-CoVs iso-
fluorescein [FAM]-CTCTTCACATAATCGCCCCGAGCTCG-6-carbo lated from camels in UAE, 98% similarity with isolates from Nigeria,
xy-N,N, N, Nʹ-tetramethylrhodamine (TAMRA)). Thermal cycling SA, and Amibara, and the highest sequence similarity of 99.16%
included 55°C for 20 minutes, followed by 94°C for 3 minutes and with Moroccan and Nigerian isolates. It shared also 98% sequence
then 45 cycles of 94°C for 15 seconds and 58°C for 30 seconds. similarity with a human MERC-CoV previously isolated in Iran. There
Afterward, the positive samples were used for the detection of ORF was no difference between the two viruses detected in the current
1a (Corman et al., 2012a). study regarding ORF 1a gene. As seen in Table 2, which investigates
118MOAZEMI-GOUDARZI et al. MERS in Camels
Acta Veterinaria Eurasia 2022; 48(2): 117-122
Table 1
Evolutionary Analyses Conducted in MEGA7, Comparing the Homology of Gene ORF 1a Among Different Isolates
UT-IVO_1 1
UT-IVO_2 100 2
MERS-CoV, Human, KM874455 , Iran 98.21 98.21 3
MERS-CoV, Camel, MG923469.1, Morocco, 2015 99.16 99.16 100 4
MERS-CoV, camel, MG923475.1, Nigeria, 2016 99.16 99.16 100 100 5
MERS-CoV, camel, MK564474, Amibara, 2017 98.21 98.21 98.81 100 100 6
MERS-CoV, camel, KT368885.1, Taif, KSA, 2015 98.21 98.21 98.81 100 100 100 7
MERS-CoV, camel, KT368876.1, Riyadh, KSA, 2015 98.21 98.21 98.81 100 100 100 100 8
MERS-CoV, camel, MG923472.1, Nigeria, 2015 98.05 98.05 98.70 100 100 100 100 100 9
MERS-CoV, camel, MF598657.1, UAE, 2015 97.62 97.62 98.21 100 100 99.40 99.40 99.40 99.35
Note: MERS-CoV, Middle East respiratory syndrome coronavirus.
the homology of the N gene, the similarities between the three new study and a Pakistani isolate which was expected since the samples
viruses and other isolates from camels ranged from 97.8% to 99.5%, of the current study were taken from the illegally imported cam-
although this parameter was considerably lower, 49.5–52.3.4%, els from Pakistan; this issue is also hinting the probable presence
compared to the human isolate. As ORF 1a-based phylogenetic tree of MERS-CoV among camels in Pakistan. Consistent with this con-
(Figure 1) shows, both viruses detected in this work were clustered in jecture, there is a study proving elevated seroprevalence of MERS-
a distinct branch different from the one in which the Iranian human CoV among camels in Pakistan (Zohaib et al., 2018); while the study
isolate is located. This result was further confirmed by phylogeny explored a restricted area of Punjab province of Pakistan which
analysis of the N gene (Figure 2). shares no border with Iran, another investigation performed during
2015 and 2018 found IgG-positive animals in Khyber Pakhtunkhwa
Discussion, Conclusion and Recommendations and Balochistan provinces of Pakistan, which share borders with
Afghanistan and Iran. The relatively large population of camels in
This work is the initial report of the detection and characterization
these regions can facilitate the spread of the virus, posing a serious
of MERS-CoV from dromedary camels in Iran. The viruses detected
threat to the inhabitants (Hemida et al., 2020; Zohaib et al., 2018).
in this study were phylogenetically linked to MERS-CoVs recovered
In 2018, Aghazadeh-Attari et al. compared the influences of a vari-
from camels in African countries, SA, and UAE.
ety of risk factors on sequel (dead/survived) of affirmed MERS-CoV
On the one hand, as the majority of camels on the Arabian Peninsula cases worldwide. It was proved among possible variables under
are imported from African countries, 90% of them (from both consideration; nativity, travel history, and exposure with camel or
regions) represented MERS-CoV-specific antibodies (Corman et al., camel milk are determinant factors in predicting the disease mortal-
2014). On the other hand, UAE and Qatar are among the coun- ity (Aghazadeh-Attari et al., 2018). Middle East respiratory syndrome
tries exporting camels to Iran, which may clarify the close relation coronavirus was diagnosed by RT-PCR in 1.6–61.5% of samples col-
of detected viruses with MERS-CoVs isolated from camelids in the lected from camels in Arabian Peninsula, whereas MERS-CoV anti-
Arabian Peninsula and Africa. Camels are also imported from our bodies were found in 98–100% of them; in agreement with this
western neighbors including Pakistan and Afghanistan. The N gene finding, the occurrence of MERS-CoV increased by 15 times in shep-
sequence analysis showed high similarities between viruses of this herds and by 23 times in slaughterhouse workers compared with
Table 2
Evolutionary Analyses Conducted in MEGA7, Comparing the Homology of Gene N Among Different Isolates
UT-IVO_1 1
UT-IVO_2 98.93 2
UT-IVO_3 99.54 99.47 3
MERS CoV, camel, KU740200, Egypt, 2014 98.64 98.41 99.12 4
MERS CoV, camel, MG923467, Ethiopia, 2017 98.64 98.41 99.09 100 5
MERS CoV, camel, MG923471, Burkina Faso, 2015 98.63 98.40 99.09 100 100 6
MERS CoV, camel, MH102354, Pakistan, 2018 98.28 98.30 98.85 100 100 100 7
MERS CoV, camel, MK564474, Amibara, 2017 98.18 97.88 98.67 99.56 99.55 99.55 100 8
MERS CoV, camel, KY581700, UAE, 2014 98.18 98.41 98.64 99.55 99.55 99.55 100 99.10 9
MERS CoV, human, KM044034, Kerman, Iran, 2014 50.46 52.43 49.55 49.11 50.00 50.23 51.74 48.66 50.00
119MOAZEMI-GOUDARZI et al. MERS in Camels
Acta Veterinaria Eurasia 2022; 48(2): 117-122
Figure 1
Phylogenetic tree based on a comparison of the ORF 1a gene sequences. Tree was created by the neighbor-joining algorithm with the P-distance
model using a MEGA7 software program with 1000 replicates. Viruses detected from imported camels in this study are marked by black circles and
the one marked with a green cube is obtained from an Iranian human isolate.
the general population (Al-Osail & Al-Wazzah, 2017). Müller et al. MERS-CoV infection in animals and humans are less explored. In the
(2015) demonstrated that the significantly higher seroprevalence of last 2 decades, three coronaviruses appeared and pertained to out-
MERS-CoV antibodies in camel has exposure with individuals than breaks with significant global health consternation. The character-
other populations. Azhar et al. (2014) reported the camel to human istic electron microscopic appearance was the clue to amplify and
transmission of MERS-CoV in a Saudi man who died after close con- sequence nucleic acids from a person who died of SARS in 2003.
tact with infected camels. As our result showed, MERS-CoV was only The sequence of the virus was considerably different from other
detected in nasal swabs which agree with other reports announcing known human coronaviruses identified until that day. The virus was
higher detection rates in nasal swab specimens rather than feces. immediately named SARS-CoV as the infected patient could present
Alagaili et al. know the airborne route as the main mode of MERS- pneumonia, cough, and dyspnea. Nine years later, a new coronavi-
CoV transmission which facilitates viral spread (Alagaili et al., 2014; rus causing respiratory disease emerged in the Middle East, under
Hemida et al., 2014). It can be concluded that the higher the positive the name of MERS-CoV. The clinical signs are not specific, but many
MERS-CoV camels, the more human cases occur. patients end up with severe acute respiratory distress. In compari-
son with SARS-CoV, MERS-CoV is still circulating, and the fatality rate
Considering MERS-CoV spreading in the dromedary camels in the is much higher (approximately 35%). What has allowed control of
Middle East, attempts to do phylogenetic analysis, epidemic moni- MERS-CoV is a low R0 (around 1), which means each diseased person
toring, effective treatments, and even developing a vaccine are transmits the virus to one other person, but the R0 value is about 4 in
required to prevent public health threats caused by this virus. Despite SARS-CoV. On December 30, 2019, a group of patients with pneu-
severe acute respiratory syndrome coronavirus, virus and host inter- monia of unknown etiology was identified in Wuhan, China, and a
action as well as pathogenesis and immune responses following week later, a new coronavirus called SARS-CoV-2 was isolated from
Figure 2
Phylogenetic tree based on a comparison of the N gene sequences. Tree was created by the neighbor-joining algorithm with the P-distance model
using a MEGA7 software program with 1000 replicates. Viruses detected from imported camels in this study are marked by black circles and MERS-
CoVs isolated from humans in Iran are marked with green cubes. MERS-CoV, Middle East respiratory syndrome coronavirus.
120MOAZEMI-GOUDARZI et al. MERS in Camels
Acta Veterinaria Eurasia 2022; 48(2): 117-122
these patients. At the point the virus was circulating across China, Chu, D. K. W., Hui, K. P. Y., Perera, R. A. P. M., Miguel, E., Niemeyer, D., Zhao, J.,
the R0 was calculated between 2 and 3.5 and the case fatality rate Channappanavar, R., Dudas, G., Oladipo, J. O., Traoré, A., Fassi-Fihri, O.,
Ali, A., Demissié, G. F., Muth, D., Chan, M. C. W., Nicholls, J. M., Meyerholz,
was investigated at 2–3%. However, the virus has caused many more D. K., Kuranga, S. A., Mamo, G., Zhou, Z., et al. (2018). MERS coronaviruses
deaths than its predecessors, even though its mortality rate is lower from camels in Africa exhibit region-dependent genetic diversity.
than MERS-CoV because there have been many more cases (Guarner, Proceedings of the National Academy of Sciences of the United States of
2020; Peeri et al., 2020). Understanding this basic information will America, 115(12), 3144–3149. [CrossRef]
not only enhance the emerging CoV research but will also conduce Corman, V. V., Eckerle, I., Bleicker, T., Zaki, A., Landt, O., Eschbach-Bludau, M.
to public health readiness against MERS-CoV infections. As far as M., van Boheemen, S., Gopal, R., Ballhause, M., Bestebroer, T. M., Muth,
D., Müller, M. A., Drexler, J. F., Zambon, M., Osterhaus, A. D., Fouchier, R.
the authors are concerned, the current study is the first report on M., & Drosten, C. (2012a). Detection of a novel human coronavirus
the characterization of MERS-CoV from Iranian camels. This virus is by real-time reverse-transcription polymerase chain reaction. Euro Sur-
almost new and still circulating and points to the necessity of detect- veillance: Bulletin Europeen sur les Maladies Transmissibles = European
ing and characterizing MERS-CoV strains in camels in other parts of Communicable Disease Bulletin, 17(39). [CrossRef]
Iran. This may help to trace the origin of the virus and to set the most Corman, V. V., Müller, M., Costabel, U., Timm, J., Binger, T. T., Meyer, B. B., Kreher,
optimal preventive protocols for safeguarding the human popula- P., Lattwein, E., Eschbach-Bludau, M., Nitsche, A., Bleicker, T., Landt, O.,
Schweiger, B., Drexler, J. F., Osterhaus, A. D., Haagmans, B. L., Dittmer, U.,
tion and livestock. It has been believed that bats in Sub-Saharan
Bonin, F., Wolff, T., & Drosten, C. (2012b). Assays for laboratory confirma-
Africa are the source of camel MERS-CoV infection. tion of novel human coronavirus (hCoV-EMC) infections. Euro Surveil-
lance: Bulletin Europeen sur les Maladies Transmissibles = European Com-
municable Disease Bulletin, 17(49). [CrossRef]
Corman, V. M., Ithete, N. L., Richards, L. R., Schoeman, M. C., Preiser, W., Dros-
Ethics Committee Approval: Ethics committee approval for this study has ten, C., & Drexler, J. F. (2014). Rooting the phylogenetic tree of Middle
obtained from the Ethics Committee of Iran Veterinary Organization Policy on East respiratory syndrome coronavirus by characterization of a conspe-
Animal Care and Use (Date: November 21, 2014, 2014-1963). cific virus from an African bat. Journal of Virology, 88(19), 11297–11303.
[CrossRef]
Peer-review: Externally peer-reviewed. Falzarano, D., Kamissoko, B., de Wit, E., Maïga, O., Cronin, J., Samaké, K., Traoré,
A., Milne-Price, S., Munster, V. J., Sogoba, N., Niang, M., Safronetz, D., &
Author Contributions: Concept – A.G.H.; Design – L.M.G.; Supervision – Feldmann, H. (2017). Dromedary camels in northern Mali have high
A.G.H.; Resources – M.H.; Materials – F.S.; Data Collection and/or Processing – seropositivity to MERS-CoV. One Health, 3, 41–43. [CrossRef]
L.M.G., F.S.; Analysis and/or Interpretation – Z.Z.; Literature Search – H.N., L.A.; Farooq, H. Z., Davies, E., Ahmad, S., Machin, N., Hesketh, L., Guiver, M., & Turner,
Writing Manuscript – H.N., L.A.; Critical Review – H.N.. A. J. (2020). Middle East respiratory syndrome coronavirus (MERS-
CoV)—Surveillance and testing in North England from 2012
Declaration of Interests: The authors have no conflicts of interest to declare. to 2019. International Journal of Infectious Diseases , 93, 237–244.
[CrossRef]
Funding: The authors declared that this study has received no financial Guarner, J. (2020). Three emerging coronaviruses in two decades: The story of
SARS, MERS, and now COVID-19 (Vol. 153). Oxford: Oxford University
support.
Press.
Hemida, M. G., Chu, D. K. W., Chor, Y. Y., Cheng, S. M. S., Poon, L. L. M., Alnaeem,
References A., & Peiris, M. (2020). Phylogenetic analysis of MERS-CoV in a camel
abattoir, Saudi Arabia, 2016–2018. Emerging Infectious Diseases, 26(12),
Aghazadeh-Attari, J., Mohebbi, I., Mansorian, B., Ahmadzadeh, J., Mirza- 3089–3091. [CrossRef]
Aghazadeh-Attari, M., Mobaraki, K., & Oshnouei, S. (2018). Epidemiologi-
Hemida, M. G., Chu, D. K., Poon, L. L., Perera, R. A., Alhammadi, M. A., Ng, H.
cal factors and worldwide pattern of Middle East respiratory syndrome
Y., Siu, L. Y., Guan, Y., Alnaeem, A., & Peiris, M. (2014). MERS coronavirus
coronavirus from 2013 to 2016. International Journal of General Medicine,
in dromedary camel herd, Saudi Arabia. Emerging Infectious Diseases,
11, 121–125. [CrossRef]
20(7), 1231–1234. [CrossRef]
Al-Osail, A. M., & Al-Wazzah, M. J. (2017) The history and epidemiology of Kandeil, A., Gomaa, M., Nageh, A., Shehata, M. M., Kayed, A. E., Sabir, J. S. M.,
Middle East respiratory syndrome corona virus. Multidisciplinary Respira- Abiadh, A., Jrijer, J., Amr, Z., Said, M. A., Byarugaba, D. K., Wabwire-Man-
tory Medicine, 12(1), 20. [CrossRef] gen, F., Tugume, T., Mohamed, N. S., Attar, R., Hassan, S. M., Linjawi, S. A.,
Alagaili, A. N., Briese, T., Mishra, N., Kapoor, V., Sameroff, S. C., Burbelo, P. D., de Moatassim, Y., Kutkat, O., Mahmoud, S., et al. (2019). Middle East respira-
Wit, E., Munster, V. J., Hensely, L. E., Zalmout, L. S., Kapoor, A., Epstein, J. tory syndrome coronavirus (MERS-CoV) in dromedary camels in Africa
H., Karesh, W. B., Daszak, P., Mohammed, O. B., & Lipkin, W. I. (2014). Mid- and Middle East. Viruses, 11(8), 717. [CrossRef]
dle East respiratory syndrome coronavirus infection in dromedary cam- Müller, M. A., Meyer, B., Corman, V. M., Al-Masri, M., Turkestani, A., Ritz, D.,
els in Saudi Arabia. mBio, 5(2), e00884–00814. [CrossRef] Sieberg, A., Aldabbagh, S., Bosch, B., Lattwein, E., Alhakeem, R. F., Assiri,
Azhar, E. I., El-Kafrawy, S. A., Farraj, S. A., Hassan, A. M., Al-Saeed, M. S., Hashem, A. M., Albarrak, A. M., Al-Shangiti, A. M., Al-Tawfiq, J. A., Wikramaratna, P.,
A. M., & Madani, T. A. (2014). Evidence for camel-to-human transmission Alrabeeah, A. A., Drosten, C., & Memish, Z. A. (2015). Presence of Middle
of MERS coronavirus. New England Journal of Medicine, 370(26), East respiratory syndrome coronavirus antibodies in Saudi Arabia: A
2499–2505. [CrossRef] nationwide, cross-sectional, serological study. Lancet Infectious Diseases,
Ba Abduallah, M. M., & Hemida, M. G. (2021). Comparative analysis of the 15(5), 559–564. [CrossRef]
genome structure and organization of the Middle East respiratory syn- Ommeh, S., Zhang, W., Zohaib, A., Chen, J., Zhang, H., Hu, B., Ge, X. Y., Yang, X.
drome coronavirus (MERS‐CoV) 2012 to 2019 revealing evidence for L., Masika, M., Obanda, V., Luo, Y., Li, S., Waruhiu, C., Li, B., Zhu, Y., Ouma,
virus strain barcoding, zoonotic transmission, and selection pressure. D., Odendo, V., Wang, L. F., Anderson, D. E., Lichoti, J., et al. (2018). Genetic
Reviews in Medical Virology, 31(1), 1–12. [CrossRef] evidence of Middle East respiratory syndrome coronavirus (MERS-CoV)
Chu, D. K., Oladipo, J. O., Perera, R. A., Kuranga, S. A., Chan, S. M., Poon, L. L., and widespread seroprevalence among camels in Kenya. Virologica
& Peiris, M. (2015). Middle East respiratory syndrome coronavirus (MERS- Sinica, 33(6), 484–492. [CrossRef]
CoV) in dromedary camels in Nigeria, 2015. Euro Surveillance: Bulletin Peeri, N. C., Shrestha, N., Rahman, M. S., Zaki, R., Tan, Z., Bibi, S., Baghbanzadeh,
Europeen sur les Maladies Transmissibles = European Communicable Dis- M., Aghamohammadi, N., Zhang, W., & Haque, U. (2020). The SARS, MERS
ease Bulletin, 20(49), 30086. [CrossRef] and novel coronavirus (COVID-19) epidemics, the newest and biggest
121MOAZEMI-GOUDARZI et al. MERS in Camels
Acta Veterinaria Eurasia 2022; 48(2): 117-122
global health threats: What lessons have we learned? International Jour- Zohaib, A., Saqib, M., Athar, M. A., Chen, J., Sial, A. U., Khan, S., Taj, Z., Sadia,
nal of Epidemiology, 49(3), 717–726. [CrossRef] H., Tahir, U., Tayyab, M. H., Qureshi, M. A., Mansoor, M. K., Naeem, M. A.,
Rohaim, M. A., El Naggar, R. F., Clayton, E., & Munir, M. (2021). Structural and Hu, B. J., Khan, B. A., Ujjan, I. D., Li, B., Zhang, W., Luo, Y., Zhu, Y., et al.
functional insights into non-structural proteins of coronaviruses. (2018). Countrywide survey for MERS-coronavirus antibodies in drom-
Microbial Pathogenesis, 150, 104641. [CrossRef] edaries and humans in Pakistan. Virologica Sinica, 33(5), 410–417.
[CrossRef]
World Health Organization (WHO). (2018). Laboratory testing for middle
East respiratory syndrome coronavirus: interim guidance. Geneva,
Switzerland. https://apps.who.int/iris/handle/10665/259952.
122You can also read
