Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
1 Manufacturer
Instructions for Use for the
SURVEYOR® Scan NRAS Kit
Exons 2, 3 & 4 CE IVD
for DHPLC Systems
Please read these Instructions for Use thoroughly before you use
this product.
Keep these Instructions for Use for future reference.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 0
This page is intentionally left blank
Table of Contents 1 Manufacturer .................................................................................................................................. 3 2 SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD ................................................................... 3 2.1 Intended Use ............................................................................................................................................... 3 2.2 Indications for Use ...................................................................................................................................... 3 3 Principles of the SURVEYOR Scan NRAS Mutation Detection Assay ..................................... 4 3.1 KRAS and NRAS ............................................................................................................................................ 4 3.2 Analysis of Patient Samples using SURVEYOR Scan Kits .............................................................................. 4 3.3 SURVEYOR Nuclease .................................................................................................................................... 5 4 Traceability of Kit Controls ........................................................................................................... 5 5 Components ................................................................................................................................... 6 5.1 Number of Samples that can be tested with one Kit .................................................................................. 6 5.2 DNA Sequencing .......................................................................................................................................... 7 6 Additional Required Equipment and Reagents .......................................................................... 7 7 Reagent Preparation ...................................................................................................................... 7 8 Storage and Shelf Life ................................................................................................................... 8 9 Warnings & Precautions ............................................................................................................... 8 10 Primary Sample Collection, Handling and Storage .................................................................. 8 11 Assay Procedure ......................................................................................................................... 9 11.1 Somatic Mutation Detection with SURVEYOR Scan Kits - An Overview .................................................... 9 12 Step-by-Step Instructions ........................................................................................................... 9 12.1 DHPLC INITIAL Setup/Calibration ............................................................................................................ 9 12.2 Considerations prior to NRAS Sample Analysis ......................................................................................... 9 12.3 Template Considerations ........................................................................................................................ 10 12.4 Workflow Considerations ........................................................................................................................ 10 12.5 Amplification Protocol ............................................................................................................................. 12 12.6 Thermal Cycler Program for Amplification Protocol ............................................................................... 14 12.7 Quality Control of PCR Products.............................................................................................................. 14 12.8 SURVEYOR Nuclease Digestion ................................................................................................................ 15 13 Control Procedures ................................................................................................................... 16 13.1 Quality Control of the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD ................................................. 16 13.2 Using Control Plasmid DNAs.................................................................................................................... 16 14 Interpretation of Results ........................................................................................................... 17 14.1 Analysis of NRAS Exons 2, 3 & 4 using SURVEYOR Nuclease ................................................................... 17 14.2 Data Review of SURVEYOR Scan Results ................................................................................................. 17 14.3 Examples of Results ................................................................................................................................. 18 15 Performance Characteristics .................................................................................................... 21 15.1 Level of Detection of Mutations by SURVEYOR Scan Kits ....................................................................... 21 15.2 Sequence Confirmation ........................................................................................................................... 21 15.3 Limitations of the Assay Procedure ......................................................................................................... 21 Appendix A ...................................................................................................................................... 23 A.1 Plate Layout Plan for SURVEYOR Scan Kits................................................................................................ 23 A.2 Control DNA Stamps ................................................................................................................................. 23 A.3 Denaturing HPLC (DHPLC) System Requirements ..................................................................................... 24 A.4 Laboratory Set-Up for PCR Assays............................................................................................................. 24 A.5 Literature References................................................................................................................................ 26 Appendix B ...................................................................................................................................... 27 Troubleshooting Guide .................................................................................................................................... 27 Ordering Details .............................................................................................................................. 32 Contact Details ................................................................................................................................ 32 Licenses, Trademarks & Copyright .............................................................................................. 32
1 Manufacturer
1 Manufacturer
Transgenomic, Inc.
Manufacturer M 12325 Emmet Street, Omaha, NE 68164, USA
Tel 1-402-452-5400
EC Transgenomic Limited
Representative P 40 Watt Road, Hillington Park, Glasgow G52 4RY, UK
Tel +44-141-892-8800
2 SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD
2.1 Intended Use
For professional use only. Transgenomic’s SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is
an in vitro diagnostic assay that detects somatic mutations in Exons 2, 3 & 4 of the NRAS gene.
These mutations are indicated by SURVEYOR Nuclease cleavage peaks and include those
mutations with known potential for clinical significance. This kit is designed to be used in a clinical
diagnostic laboratory by suitably trained personnel testing DNA extracted from formalin-fixed
paraffin embedded tissues.
This kit, catalog number 710400, is supplied as a single box containing the components indicated
below. These Instructions for Use are available as a download at
http://world.transgenomic.com/files/literature/482296-EN.pdf.
2.2 Indications for Use
Clinicians can use the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD with DHPLC Systems
to aid in deciding if patients’ colorectal cancer tumours may not respond to an anti-EGFR
(epidermal growth factor receptor) therapeutic like panitumumab.
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is to be used in conjunction with either
the SURVEYOR Scan KRAS Kit Exon 2 CE IVD and the SURVEYOR Scan Kit KRAS Exons 3 & 4
CE IVD or with the SURVEYOR Scan Kit KRAS Exons 2, 3 & 4 CE IVD.
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD should not be used for diagnosis of
colorectal or any other cancer.
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is an assay that detects the presence of
potential somatic mutations in Exons 2, 3 & 4 of the NRAS gene but does not confirm the
sequence identity of the mutation. To confirm the precise mutation detected, further analysis,
such as DNA sequencing, would be required.
Although the results of analysis with this kit will indicate the mutation status of the patient, other
clinical factors, including mutations in NRAS Exons 2, 3 & 4, should be taken into account. Results
obtained using the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD should not be the sole
method used in making decisions regarding any treatment of colorectal cancer patients.
It is important to note that the use of DHPLC to identify samples testing positive for an NRAS
mutation with this kit should be used only as a guideline and all mutations must be confirmed
by further analysis, such as DNA sequencing.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 3
3 Principles of the SURVEYOR Scan NRAS Mutation Detection Assay
3 Principles of the SURVEYOR Scan NRAS Mutation
Detection Assay
3.1 KRAS and NRAS
Therapeutic agents targeting the epidermal growth factor receptor (EGFR) have proven to be
effective against colorectal cancer. Research has indicated that around 40% of colorectal tumors
carry somatic KRAS gene mutations and clinical studies demonstrated that mutations in KRAS
exon 2 (codons 12 and 13) predict lack of response to anti-EGFR therapies. Recent exploratory
studies have demonstrated that the patient population can be further refined as patients whose
mCRC tumors harbor an additional mutation in KRAS exons 3 and 4 or NRAS exons 2, 3 and 4
1-7
also did not tend to respond to anti-EGFR-containing therapy . This kit is designed for use in
diagnostic analysis of somatic NRAS Exons 2, 3 & 4 mutations.
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is an assay for detecting all sequence
and small insertion/deletion alterations in Exons 2, 3 & 4 of the NRAS gene. Mutations in NRAS
codons 12, 13, 59, 61 and 146 have been associated with the lack of effectiveness of
panitumumab. Positive Controls are supplied in this kit for mutations in codons 12, 61 and 146.
This kit uses Transgenomic’s proprietary SURVEYOR Nuclease technology and, when coupled
with DHPLC, gives simple and sensitive detection of potential mutations. It is capable of detecting
a mixture of 2-5% mutant in a background of non-mutant DNA. Validation studies have
demonstrated extremely high concordance with sequencing in well-characterized colorectal cancer
samples. Use of the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD will both decrease the
user’s sequencing burden and aid sequence calling where automated sequencing software fails to
resolve the presence of a low-level mutation.
Due to the high sensitivity of this assay relative to Sanger sequencing, it is recommended that
laboratory set-up is optimized for avoiding sample or control cross-contamination. For an example
of an ideal laboratory set-up, see Appendix A.4 Laboratory Set-Up for PCR Assays.
3.2 Analysis of Patient Samples using SURVEYOR Scan Kits
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD should only be used in the context of one
of the workflows indicated below.
Workflow A Workflow B
Patient Sample Patient Sample
Result
Test KRAS Exons 2, 3 & 4 Test KRAS Exon 2 KRAS Codon 12
and or 13 Mutation
NRAS Exons 2, 3 & 4
Result
Report Result
KRAS Codon 12
Report Result or 13 Wild-Type
Test KRAS Exons 3 & 4
and Report Result
NRAS Exons 2, 3 & 4
Figure 1 SURVEYOR Scan Mutation Detection Kit workflows
for screening of KRAS and NRAS
For a suggestion of how to set up 96-well plates for analysis of all KRAS and NRAS Exons 2-4 see
Appendix A.1 Plate Layout Plan for SURVEYOR Scan Kits.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 4
3 Principles of the SURVEYOR Scan NRAS Mutation Detection Assay
3.3 SURVEYOR Nuclease
Transgenomic’s SURVEYOR Nuclease is a mismatch-specific plant DNA endonuclease that can
8
scan for known and unknown mutations and polymorphisms in heteroduplex DNA . The enzyme
cleaves DNA with high specificity at sites of base-substitution mismatch and other distortions. This
DNA endonuclease cuts both strands of a DNA heteroduplex on the 3’-side of the mismatch site.
Insertion/deletion mismatches and all base-substitution mismatches are recognized, but the
efficiency of cleavage varies with the sequence of the mismatch.
Figure 2. Mode of action of
SURVEYOR Nuclease. The
endonuclease recognizes a
mismatch and cleaves at the 3’ side
of each base in the mismatch. This
cleaves the DNA double strand,
leaving a single base 3’ overhang.
SURVEYOR Nuclease has been used in a wide range of contexts to detect accurately a variety of
mutations and polymorphisms in genes. Notably, SURVEYOR Nuclease has been used to verify
the presence of known mutations in a number of genes associated with renal cancer, lung cancer,
9,10,11
head & neck cancer, leukemia, endometrial cancer and in radiotherapy outcome prediction .
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD has been designed to cleave
mismatches in NRAS Exons 2, 3 & 4 for subsequent analysis by DHPLC.
Note: if a sample is 100% mutant DNA, no heteroduplexes can be formed and the sample
will appear “Wild-Type”. However, tumor biopsy samples will contain Wild-Type cells due
to tumor heterogeneity and/or contaminating normal tissue; note that samples with 5% and
95% mutant DNA will have identical electropherograms.
Note: Only the DNA Polymerase supplied with this kit should be used for the PCR portion
of assay.
Note: Please follow the specific instructions in your DHPLC system’s manual.
To use this kit successfully, we strongly recommend that you read this manual thoroughly
and carefully follow the instructions and guidelines provided. First time users should
perform the control experiments outlined in the section Using Control Plasmid DNAs.
If you have further questions or need assistance, please call (888) 233-9283 (North America only),
+1 (402) 452-5400 or +44 (0) 141 892 8800 (Europe) and ask for “NRAS support”. Alternatively
you can e-mail us at:
SURVEYORscan@Transgenomic.com
4 Traceability of Kit Controls
The controls supplied with this kit are plasmid clones of NRAS Exons 2, 3 & 4 sequences. All
clones have been sequenced to check the fidelity of the sequence by comparison to NCBI
Reference Sequence: NG_007572.
The controls have a genetic “stamp”. See Appendix A.2 Control DNA Stamps; this variation from
the NRAS Wild-Type sequence, in a region not expected to have mutations, can be used to
troubleshoot sample contamination by Positive Controls. See Appendix B - Troubleshooting
Guide, Problem 8, for an example of a SURVEYOR Scan trace of such contamination.
The “NRAS Control Wild-Type” was constructed by synthesis and cloning of NRAS Exons 2, 3
and 4 using the NCBI reference sequence above.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 5
4 Traceability of Kit Controls
The “NRAS Positive Control Exon 2” was constructed by synthesis of NRAS Exon 2 using the
reference above but containing the G12D mutation. DNA sequencing confirmed that the only
change to the sequence is at codon 12 with a G12D, GGT>GAT, alteration. This clone is then
blended with NRAS Control Wild-Type DNA to create a heterozygous blend.
The “NRAS Positive Control Exon 3” was constructed by synthesis of NRAS Exon 3 using the
reference sequence above but containing the Q61K mutation. DNA sequencing confirmed that the
only change to the sequence is at codon 61 with a Q61K, CAA>AAA, alteration. This clone is then
blended with NRAS Control Wild-Type DNA to create a heterozygous blend.
The “NRAS Positive Control Exon 4” was constructed by synthesis of NRAS Exon 4 using the
reference sequence above but containing the A146T mutation. DNA sequencing confirmed that
the only change to the sequence is at codon 146 with an A146T, GCC>ACC, alteration. This clone
is then blended with NRAS Control Wild-Type DNA to create a heterozygous blend.
5 Components
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is composed of (1) a SURVEYOR
Digestion Components Box with 10 reagent tubes with no empty holes and (2) an outer PCR
Components and Controls Tube-Holder containing 13 reagent tubes and 7 empty holes.
Catalog Tube Cap 100-Reaction Kit
Component
Number Color Volume Provided
SURVEYOR Digestion Components Box
710160 SURVEYOR Nuclease W Purple 2 x 105 µL
710161 SURVEYOR Enhancer W2 Black 105 µL
708049 SURVEYOR Enhancer Cofactor Pink 105 µL
708027 0.15 M MgCl2 Solution Brown 105 µL
708030 SURVEYOR Stop Solution Red 250 µL
710153F Universal Sequencing Primer 1 (10 µM) Orange 2 x 125 µL
710153R Universal Sequencing Primer 2 (10 µM) Orange 2 x 125 µL
PCR Components and Controls Box
703310 DNA Polymerase (250U) Red 100 µL
703312 DNA Polymerase (50U) Red 20 µL
703315 DNA Polymerase 10X PCR Buffer Clear 1 mL
703065 dNTPs (10 mM) Clear 500 µL
710452F NRAS Primer Exon 2 Forward (10 µM) Blue 90 µL
710452R NRAS Primer Exon 2 Reverse (10 µM) Blue 90 µL
710453F NRAS Primer Exon 3 Forward (10 µM) Blue 90 µL
710453R NRAS Primer Exon 3 Reverse (10 µM) Blue 90 µL
710454F NRAS Primer Exon 4 Forward (10 µM) Blue 90 µL
710454R NRAS Primer Exon 4 Reverse (10 µM) Blue 90 µL
710441 NRAS Control Wild-Type Mix Yellow 120 µL
710442 NRAS Positive Control Exon 2 Green 40 µL
710443 NRAS Positive Control Exon 3 Green 40 µL
710444 NRAS Positive Control Exon 4 Green 40 µL
482296 Instructions for Use Download from web site*
http://world.transgenomic.com/files/literature/482296-EN.pdf
5.1 Number of Samples that can be tested with one Kit
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD is designed to allow testing of 100
reactions. The total number of samples that can be tested with the kit depends upon the average
sample batch size tested at any one time because one set of control reactions (Wild-Type
Controls, Positive Controls and No Template Controls) must be included in each reaction plate.
The table below shows the number of samples that can be analyzed with the NRAS kit depending
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 65 Components
on the average batch size. This takes into account (a) the 9 controls (3x Wild-Type, 3x Positive
Controls, 3x No Template Controls) that are required for every run and (b) the limit of 100
reactions per kit.
Note: If multiple plates are run, then a set of the 9 controls listed above must be run on each plate.
Therefore two plates will require a total of 18 control reactions, 3 plates will require 27 control
reactions, etc.
When the sample batch size is increased, the number of samples that can be tested with one kit is
increased, reducing the average reagent cost per sample. The table below is a guide to the
number of samples that can be tested with a single kit.
Number of
Batch Tests Total Runs Samples
Controls + Sample
Size per Run per Kit Tested per Kit
Amplicons
1 9+3 12 8 8
2 9+6 15 6 12
3 9+9 18 5 15
4 9 + 12 21 4 16
5 9 + 15 24 4 20
5.2 DNA Sequencing
Universal Sequencing Primers (PNs 710153F and 710153R) are supplied for use for DNA
sequencing of all samples tested. The PCR amplicons created prior to SURVEYOR Nuclease
digestion should be used for sequencing.
6 Additional Required Equipment and Reagents
Additional components and equipment required to use the SURVEYOR Scan NRAS Kit Exons 2, 3
& 4 CE IVD for DHPLC includes the following:
DHPLC system, column, buffers, DNA size standard
- see Appendix A.3.1 DHPLC Specifications for SURVEYOR SCAN Applications for
characteristics of a suitable DHPLC system for use with this kit
Molecular biology grade water
0.2 mL-PCR tubes, strips or 96 well plate
Micropipettors
Pipette tips
Ice bath
Vortex mixer
Microcentrifuge
Thermal cycler
Agarose gels and agarose gel electrophoresis equipment
10% bleach or similar cleaning agent
7 Reagent Preparation
All reagents supplied with this kit are ready to use. Some components will need to be thawed,
vortexed or spun in a microcentrifuge before use; check details in Assay Procedure below.
Reagents do need to be combined to produce Master Mixes and reaction mixtures; full details are
given in the Assay Procedure below.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 78 Storage and Shell Life
8 Storage and Shelf Life
The kit should be stored at between -18 ºC and -25 °C in a constant temperature freezer until use.
Note the Expiry Date of each kit received. Do not use the kit after the Expiry Date has elapsed.
The SURVEYOR Nuclease mixture prepared in Step 7 of SURVEYOR Nuclease Digestion
should be used immediately as SURVEYOR Nuclease W is inactivated over time when in the
presence of the other SURVEYOR Nuclease reaction mixture components.
9 Warnings & Precautions
None of the reagents in this kit present a hazard to health in the quantities supplied.
Transgenomic’s document number MSD-710400 can be downloaded from
http://world.transgenomic.com/files/literature/710400-EN.pdf
There are no substances in this kit of animal or human origin that present a risk of infection.
This kit should be used only by those persons who have been trained in the appropriate laboratory
techniques. When working with the components of this kit, always wear a suitable lab coat,
disposable gloves and eye protection. After use, the kit components should be disposed of as
clinical waste and in accordance with your local rules and regulations.
Aliquots of reagents pipetted from the tubes in this kit are intended for single use only. The
components of this kit have been shown to maintain stability through 25 freeze-thaw cycles. Do
not use this kit if this number of freeze-thaw cycles is exceeded.
10 Primary Sample Collection, Handling and Storage
The SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC System has been validated
for use with DNA extracted from formalin-fixed paraffin-embedded (FFPE) colorectal cancer tumor
samples. For optimal DNA extraction, the tissue should be fixed in formalin for 14–24 hours prior
to embedding in paraffin.
Tumors biopsies are a heterogeneous mixture of tumor cells and non-tumor cells. In addition the
tumor itself is a heterogeneous mixture of tumor cells with mutations and tumor cells without
mutations. Because these somatic mutations may not be evenly distributed throughout the tumor,
the resultant mutational analysis of different sections from the same tumor may be different. To
increase the probability of detecting a mutation, DNA from the tumor region of the tissue should be
isolated by scraping only the tumor area from the glass slide using a fresh, sterile scalpel for each
new slide.
For successful use of this kit, the extracted DNA should meet the criteria listed in Template
Considerations.
NOTE: Extracted DNA samples not intended for immediate analysis with this kit should be stored
frozen at -20 ºC to -80 ºC.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 811 Assay Procedure
11 Assay Procedure
11.1 Somatic Mutation Detection with SURVEYOR Scan Kits - An Overview
Mutation detection and confirmation with SURVEYOR Nuclease involves three steps:
Step 1 - Prepare PCR amplicons from mutant (test) and normal (reference) DNA,
continuing on from the final PCR amplification cycle to melt all double strands and then
cool slowly for optimal formation of hetero- and homoduplexes (heteroduplexes occur
when one strand of a Wild-Type sequence anneals with one strand of a mutant
sequence).
Step 2 - Treat a portion of the annealed heteroduplex/homoduplex mixture with
SURVEYOR Nuclease. SURVEYOR Nuclease will cut both strands of heteroduplex DNA
giving rise to DNA fragments. The Control Wild-Type DNA, treated similarly, serves as a
background control.
Step 3 - Analyze the DNA fragments on a DHPLC system. The formation of new cleavage
products, due to the presence of one or more mismatches, is indicated by the presence of
additional chromatographic peaks. The migration times of the cleavage products indicate
the size of the fragments and therefore the approximate location of the mismatch or
mismatches.
12 Step-by-Step Instructions
12.1 DHPLC INITIAL Setup/Calibration
When setting up the SURVEYOR Nuclease plate for analysis by DHPLC, please refer to the
Appendix A.3 Denaturing HPLC (DHPLC) System Requirements.
12.2 Considerations prior to NRAS Sample Analysis
Prior to running samples on a DHPLC system, an appropriate DNA Size Standard must be run to
ensure the system is functioning properly. Laboratory personnel using the instrument should check
the quality of the DNA Size Standard resolution before proceeding to analysis.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 912 Step-by-Step Instructions
12.3 Template Considerations
1. For FFPE isolated template DNA, use normal laboratory procedures to assess quality and
quantity of extracted DNA to ensure there is sufficient template for PCR.
2. The 260/280 absorbance ratio should be greater than 1.80.
3. To expedite PCR setup, adjust the working template concentration to be approximately
12.5 ng/µL. Dilute the template DNA in molecular biology grade water, when required.
12.4 Workflow Considerations
The kit is designed to allow analysis of 100 reactions. Smaller batches of samples can be run, but
the kit controls and a “no template control” must be included with each batch of samples. There
are sufficient control materials in the kit for 100 reactions of all combinations of sample batch sizes
to be used.
In general, processing of samples should be carried out from start to finish as described in these
Instructions for Use. If processing of a sample has to be stopped before completion of all steps,
the DNA should be stored at -20 °C at the indicated points. However, exposure of any frozen
sample to repeated freeze-thaw cycles should be avoided and frozen storage (-18 to -25 °C) of
PCR-amplified DNA or SURVEYOR Nuclease digestion products for extended periods (>1 week)
should be avoided.
Analysis of samples should follow the workflow illustrated below:
DNA
Scrape
1 Isolation 2 Gel Electrophoresis
Tissue
& PCR
3
Score Robust/Faint PCR
4
SURVEYOR SURVEYOR Nuclease &
5 Scan Failed DHPLC Analysis
SURVEYOR Scan SURVEYOR Scan
Positive Negative
7 6
NVD
Sequence
Confirmation
8 Sequence Sequence
Quality Fail Quality Pass
9
Mutation in codons NVD
G12, G13, A59,
Q61, K117 or A146
Figure 3 Workflow of SURVEYOR Scan NRAS Kit analysis
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1012 Step-by-Step Instructions Notes to Figure 3 1. Isolate the DNA from FFPE using standard laboratory procedures. 2. Perform PCR and check DNA quality by gel electrophoresis. 3. Record if PCR band is Robust (≥20 ng/µL) or Faint (
12 Step-by-Step Instructions
Note: positive SURVEYOR Scan results can be due to base changes other than those that have
been found to be NRAS-activating. While these mutations are rare, confirmation by another
method, such as DNA sequencing, will be required to determine whether or not a positive
SURVEYOR Scan result is a NRAS-activating mutation.
Note: the formalin-fixation process used in preparing FFPE tumor biopsy samples may result in
deamination of cytosines. This deamination converts cytosine to uracil. The polymerase will “read”
this uracil as a thymine and incorporate an adenine into the copied strands. This will then seem to
be a mutation where the normal G is now replaced with an A causing a G/C to A/T mutation that is
an artefact mutation resulting from the fixation process and not a true somatic mutation. These are
rare events, but if copied early in the PCR cycling, they will “look” like mutations. They do not
repeat upon reanalysis.
An example of a potential cytosine deamination mutation that would be considered for determining
patient treatment is NRAS A146T.
- Codon 146: GCC>ACC (A146T)
Therefore, it is recommended that any such mutation be confirmed by duplicate analysis of the
same genomic DNA or that all samples are subject to duplicate analysis from the start of analysis.
12.5 Amplification Protocol
1. The Transgenomic premixed dNTP solution (PN 703065) is supplied at a working
concentration of 10 mM total deoxynucleotide (2.5 mM of each of the four
deoxynucleotides).
2. The NRAS Exon 2, Exon 3 and Exon 4 Forward and Reverse PCR primers (PNs
710452F/R, 710453F/R and 710454F/R) are supplied at 10 µM.
3. Remove the 10 µM primers, 10 mM dNTPs and DNA Polymerase 10X PCR Buffer (PN
703315) from the freezer and thaw on ice.
4. Once thawed, vortex all the kit components (~10 seconds) to mix thoroughly, briefly
centrifuge (~10 seconds) to insure no liquid remains on the lids of the tubes and place on
ice.
5. Prepare the Master Mixes on ice.
6. Use the following table as a guide for preparing a Master Mix for each of NRAS Exon 2,
NRAS Exon 3 and NRAS Exon 4 reactions:
Number of Reactions: (7 Samples + 3 Controls): 10
Volume Calculation:
Volume of Water (µL) 330**
DNA Polymerase 10X PCR Buffer (µL) 50
dNTPs (µL) 40
NRAS Primer Exon 2, 3 or 4 Forward (µL) 25
NRAS Primer Exon 2, 3 or 4 Reverse (µL) 25
DNA Polymerase (µL) 10
Total Volume Master Mix 48.0
**Note: The user should aim to have a minimum of 25 ng of DNA per 50 µL reaction.
When extracted DNA concentrations are less than 12.5 ng/µL, increase the volume of
extracted DNA proportionately to ensure 25 ng per reaction. Also decrease the volume of
water in the Master Mixes by this same amount to result in 50 µL per reaction. All
samples prepared with these Master Mixes will need to have extracted DNA diluted
to approximately the same lowest concentration level. Use of extracted DNA
concentrations less than 5 ng/µL is not recommended.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1212 Step-by-Step Instructions
7. Calculate the required volumes for any given Master Mix by reference to the chart above;
note that:
(a) For Master Mix 1, NRAS Exon 2 three additional reactions will be required for the
NRAS Control Wild-Type, NRAS Positive Control Exon 2 and the NRAS Exon 2 No
Template Control (NTC1).
(b) For Master Mix 2, NRAS Exon 3 three additional reactions will be required for the
NRAS Control Wild-Type, the NRAS Positive Control Exon 3 and the NRAS Exon 3
No Template Control (NTC2).
(c) For Master Mix 3, NRAS Exon 4 three additional reactions will be required for the
NRAS Control Wild-Type, the NRAS Positive Control Exon 4 and the NRAS Exon 4
No Template Control (NTC3).
Note: take into consideration that a Master Mix volume slightly greater than this
calculation will be required to allow for losses during pipetting.
8. Label 0.2 mL-PCR tubes, or wells of a 96-well plate, with the appropriate sample
information.
9. Label 2.0 mL-centrifuge tubes for Master Mix preparation.
10. Add the required volume of molecular biology grade water to the 2.0 mL-centrifuge tubes
labeled “Master Mix”.
11. Add the required amount of DNA Polymerase 10X PCR Buffer to the Master Mix tubes.
12. Add the required volume of the 10 mM dNTPs to the Master Mix tubes.
13. Add the required volume of the NRAS Forward Primers to their respective Master Mix
tubes.
14. Add the required volume of the NRAS Reverse Primers to their respective Master Mix
tubes.
15. Take the DNA Polymerase (PN 703310) out of the freezer.
16. Centrifuge the DNA Polymerase for ~10 seconds.
17. Vortex the DNA Polymerase for ~10 seconds.
18. Add the required volume of DNA Polymerase to the Master Mix tubes.
19. Cap the Master Mix tubes.
20. Before use, vortex the Master Mix tubes for ~30 seconds and then briefly centrifuge for
~10 seconds.
21. Store on ice until use.
22. Pipette 48.0 µL (see note above in step 6) of Master Mix into the appropriate wells,
changing pipette tips in between if using a single channel pipettor. If using a repeat
pipettor, ensure that there is no spillage or splashing from well to well. Keep the plate on
ice.
23. To the appropriate wells, add 2.0 µL (see note above in step 6) of each sample template
DNA, or water (no template control, NTC). Use separate pipette tips for each sample and
avoid cross contamination of the samples by splashing. Cap the wells containing the
sample DNAs and the NTC with the 8-cap strips (if using a 96-well plate) or cap the 0.2
mL-PCR tubes. Make sure the caps are sealed securely.
24. Only then open the kit’s control template DNAs (PNs 710131, 710136, 710137, 710138)
tubes one at a time. Pipette 2.0 µL of each of the control templates last so as to lessen the
chance of contaminating any sample DNA. Again, cap each well with the 8-cap strips (if
using a 96-well plate) or cap the 0.2 mL-PCR tubes. Make sure the caps are sealed
securely.
NOTE: Good practice is to place the no template controls (NTC) in wells that are not
adjacent to Positive Controls or samples.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1312 Step-by-Step Instructions
NOTE: For a suggestion of how to set up 96-well plates for analysis of all KRAS and
NRAS exons 2-4 see Appendix A.1 Plate Layout Plan for SURVEYOR Scan Kits.
25. Vortex (~1/2 speed) for 10 seconds.
26. Centrifuge for 1-2 minutes to ensure all solutions are collected at the bottom of the wells or
tubes. Verify that the solutions are at the bottom of each well or tube. If not, repeat the
centrifugation.
12.6 Thermal Cycler Program for Amplification Protocol
1. Use the following thermal cycler protocol for PCR Amplification and heteroduplex
formation:
Initial Denaturation
95 C 5 minutes
Touchdown Amplification
95 C 30 seconds
15 cycles 62 C, -0.5 ºC/cycle 30 seconds
72 C 25 seconds
Amplification
95 C 30 seconds
30 cycles 55 C 30 seconds
72 C 25 seconds
Final Extension
1 cycle 72 C 2 minutes
Heteroduplex Formation
95 ºC 2 minutes
≤12 C Hold
12.7 Quality Control of PCR Products
1. It is recommended that amplicon quality and quantity be checked by gel electrophoresis
(or equivalent means) before proceeding to SURVEYOR Nuclease digestion.
2. Analyze an aliquot of the PCR product along with several different amounts of a 100-bp DNA
mass ladder.
3. Use the ladder to estimate the concentration of the amplified DNA.
4. Only a single band greater than 20 ng/µL corresponding to the main PCR product should
be observed.
5. If multiple bands are present, ensure quality of input template DNA was sufficient (see
Appendix B – Troubleshooting Guide).
6. If no product is observed, ensure quality of input template DNA was sufficient (see
Appendix B – Troubleshooting Guide). If quality meets specifications, increase the
volume of template to 4.0 µL per 50 µL reaction (reduce water per reaction to 31.0 µL).
7. No PCR products should be visible in the no template control sample. If DNA products are
visible with this control, contamination is likely; see Appendix B - Troubleshooting
Guide.
8. Score the PCR as Robust PCR or Faint PCR.
a. Robust PCR should have a single band of greater than or equal to 20 ng/µL.
b. Faint PCR should have a single band of less than 20 ng/µL.
c. Proceed to SURVEYOR Nuclease digestion with both Robust and Faint PCR
scores.
TIP: at this stage PCR products can be stored at less than or equal to -20 ºC for up
to one week.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1412 Step-by-Step Instructions
12.8 SURVEYOR Nuclease Digestion
1. After the sample PCR is deemed of sufficient quality and quantity, perform the
SURVEYOR Nuclease digestion reaction as described below. A sample concentration of
greater than or equal to 40 ng/µL is needed for optimal digestion by SURVEYOR
Nuclease.
2. Thaw the tubes containing the 0.15 M MgCl2 Solution and SURVEYOR Enhancer Cofactor
on ice.
3. Add 10.0 µL of each PCR-amplified sample from above to a new 0.2 mL-PCR tube or well
of a 96-well plate.
4. Prepare a fresh mixture of 0.15 M MgCl2 Solution, SURVEYOR Enhancer Cofactor,
SURVEYOR Enhancer W2 and SURVEYOR Nuclease W (SURVEYOR Nuclease
mixture).
Use the following table as a guide for preparing a SURVEYOR Nuclease Digest Master Mix for
analysis of multiple samples. The example below has the volumes for a 10 sample Master Mix.
Take into consideration that a Master Mix volume slightly greater than this calculation will be
required to allow for losses during pipetting.
Number of SURVEYOR Nuclease Digest Reactions: 10
Volume Calculation:
0.15 M MgCl2 Solution (µL) 10.0
SURVEYOR Enhancer Cofactor (µL) 10.0
SURVEYOR Enhancer W2 (µL) 10.0
SURVEYOR Nuclease W (µL) 20.0
Total Volume Master Mix: 50.0
Add 5 µL SURVEYOR Nuclease Master Mix to each
PCR-amplified sample (µL) 10.0
Total Volume SURVEYOR Nuclease Digest Reaction: 15.0
a. Centrifuge each reagent before use.
b. Gently vortex each reagent before pipetting; briefly centrifuge for ~10 seconds after
each vortex step.
c. For each digestion, add the following components to a 0.2 mL-PCR (or larger)
microcentrifuge tube.
1.0 µL 0.15 M MgCl2 Solution (PN 708027)
1.0 µL SURVEYOR Enhancer Cofactor (PN 708049)
1.0 µL SURVEYOR Enhancer W2 (PN 710161)
2.0 µL SURVEYOR Nuclease W (PN 710160)
Or, add 5 µL of Master Mix as prepared in the table above.
5. Gently vortex the SURVEYOR Nuclease Digest Master Mix for 10 seconds on low speed
6. Centrifuge the SURVEYOR Nuclease Digest Master Mix for 10 seconds on low speed.
7. Place the SURVEYOR Nuclease Digest Master Mix on ice until use.
Note: The SURVEYOR Nuclease Digest Master Mix prepared in Step 7 should be used
immediately as SURVEYOR Nuclease W is inactivated over time when in the presence
of the other SURVEYOR Nuclease Digest Master Mix components.
8. Pipette 5.0 µL-aliquot of the SURVEYOR Nuclease Digest Master Mix into each tube or
well containing 10.0 µL aliquot of amplified PCR product (see Step 3 above).
9. When pipetting is complete, centrifuge the 0.2 mL-PCR tubes or 96-well plate for 10
seconds.
10. Gently vortex the sample 0.2 mL-PCR tubes, or 96-well plate, for 10 seconds.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1512 Step-by-Step Instructions
11. Centrifuge for 10 seconds on low speed (this step is especially important if the digestion is
performed in an instrument without a heated lid).
12. Incubate at 42 °C for 30 minutes.
13. Add 1.0 µL SURVEYOR Stop Solution (PN 708030) to each tube or well and vortex gently
(total SURVEYOR Nuclease reaction volume is 16.0 µL).
TIP: SURVEYOR digestion products can be stored at ≤ -20 ºC for up to one week.
14. Load the sample digests onto a DHPLC system.
Note: For suggested DHPLC system gradient settings for analysing SURVEYOR Nuclease
digests, please visit http://world.transgenomic.com/diagnostic-tools/genetic-analysis-kits/crc-
rascan-kits-eu/dhplcsystemsettings.
13 Control Procedures
13.1 Quality Control of the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD
Control Plasmid DNAs are included in the kit to provide quality control checks at specific steps in
the assay procedure. For the Amplification Protocol, these controls provide a means to ensure
that the Master Mixes are correctly prepared and amplification is functioning properly. No template
controls (where water is added in place of template DNA) are also required to check for possible
contamination of kit components with any extraneous DNA template.
At the SURVEYOR Nuclease digestion stage, the amplicons from these Control Plasmid DNAs
provide an effective check that the cleavage reaction conditions (SURVEYOR Nuclease Digest
Master Mix preparation and incubation conditions) were satisfactory. At the analysis stage, the
DHPLC system chromatograms of the SURVEYOR Nuclease digested control amplicons provide
guidance as to where the cleavage product peaks corresponding to those mutations in NRAS
Exons 2, 3 and 4, even at low levels, will elute (see Figures 4-6). Cleavage product peaks
corresponding to other mutations in NRAS Exons 2, 3 and 4 may elute in slightly different
positions.
If the PCR amplicons do not match the results outlined in Quality Control of PCR Products,
consult the Appendix B - Troubleshooting Guide or contact Transgenomic Technical Support
before proceeding with further steps in the analysis of samples.
13.2 Using Control Plasmid DNAs
The kit is supplied with four control DNAs:
NRAS Control Wild-Type; PN 710441
NRAS Positive Control Exon 2; PN 710442
NRAS Positive Control Exon 3; PN 710443
NRAS Positive Control Exon 4; PN 710444
These control DNAs are plasmids with inserts. The Positive Controls each contain two plasmids: a
mix of the NRAS Control Wild-Type and a mutation clone differing from the Wild-Type at a single
5
base pair. The controls are provided in separate vials, each at a concentration of 10 copies/µL.
NRAS Exons 2, 3 and 4 Forward and Reverse PCR primers needed for PCR amplification are
supplied separately in the kit. Please follow the instructions found in Amplification Protocol,
SURVEYOR Nuclease Digestion and Analysis of NRAS Exons 2, 3 & 4 using SURVEYOR
Nuclease for use of these controls.
WE STRONGLY RECOMMEND THAT FIRST TIME USERS PERFORM EXPERIMENTS
WITH THE CONTROLS ALONE BEFORE TESTING GENOMIC SAMPLES
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1614 Interpretation of Results
14 Interpretation of Results
14.1 Analysis of NRAS Exons 2, 3 & 4 using SURVEYOR Nuclease
For comparison and control purposes, ALWAYS perform SURVEYOR Nuclease digestion on each
of the controls (Wild-Type and Positive Controls), a no template control (NTC), as well as the
sample DNAs, and run in the same DHPLC system sample plate.
At the SURVEYOR Nuclease digestion stage, the amplicons from these Control Plasmid DNAs
provide an effective check that the cleavage reaction conditions (SURVEYOR Nuclease mixture
preparation and incubation conditions) were satisfactory. At the analysis stage, the DHPLC system
traces of these SURVEYOR Nuclease digested control amplicons provide guidance of where the
DNA fragments resulting from cleavage at these specific mutations’ mismatch sites, even at low
levels, will elute (see Figures 4-6).
If either the PCR amplicons or the SURVEYOR Nuclease cleavage fragments derived from the
Control DNAs do not match the results outlined, consult the Appendix B -Troubleshooting Guide
or contact Transgenomic Technical Support before proceeding with further steps in the analysis of
samples.
The examples given below are for illustration purposes only and are NOT to be used to determine
the identity of any given mutation. Confirmation of the identity of a mutation is required in order to
determine unequivocally the presence of a specific base-change in Exons 2, 3 or 4 of the NRAS
gene.
SURVEYOR Nuclease cleaves at all mismatches resulting from heteroduplex formation
between Wild-Type and mutant DNAs, not just mutations in Exons 2, 3 or 4. SURVEYOR
Nuclease confirms that a mismatch is present. The mutation’s specific base-change identity is
required for determination of NRAS-activating status and it must be confirmed by another method,
such as sequencing.
14.2 Data Review of SURVEYOR Scan Results
Inspect the chromatograms and compare those of the Wild-Type and Positive Controls with that of
the sample. Determine if the chromatogram of the sample is similar to or different from the Wild-
Type pattern. If it is different, then the sample should be considered “SURVEYOR Scan Positive”
and be sent for DNA sequence analysis. See Figures 4-6 for examples and Appendix B –
Troubleshooting Guide, Problems 7 & 8 for examples of such samples.
Any sample with a SURVEYOR Nuclease pattern different from the Wild-Type should be sent for
sequence confirmation even if it is not identical to the Positive Control. See Appendix B –
Troubleshooting Guide, Problem 7 for an example of such a sample.
When required, zoom into the region of interest and overlay the sample chromatogram with the
Wild-Type Control for that amplicon.
Note any differences between the Wild-Type Control and the sample analyzed.
Important! Following a thorough review of each sample, the data reviewer should examine
whether adjacent samples in the analysis plate have identical positive SURVEYOR Scan results. If
identical positive results occur, they may be the result of sample or control cross-contamination
and analysis must be repeated.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1714 Interpretation of Results
14.3 Examples of Results
Examples of results obtained using the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for
®
DHPLC are shown in Figures 4-6 below. In these examples, using WAVE 4500 Systems with
both UV and fluorescence detectors the process outlined in the Step-by-Step Instructions
section was followed precisely. For guidance on suggested DHPLC system gradient settings for
analysing SURVEYOR Nuclease digests, please visit http://world.transgenomic.com/diagnostic-
tools/genetic-analysis-kits/crc-rascan-kits-eu/dhplcsystemsettings.
Figure 4A NRAS Control Wild-Type
NRAS Control Exon 2
Sample 1, NRAS Exon 2
Uncleaved
200-bp Sample 2, NRAS Exon 2
DHPLC flow ampliconDNA Sizing Standard
through
Uncleaved
236-bp
amplicon
G12D yields
88 and 148-bp
fragments
DHPLC
Wash-off
Figure 4B NRAS Control Wild-Type
NRAS Control Exon 2
G12D yields
Sample 1, NRAS Exon 2
Uncleaved
88 and 148-bp
200-bp Sample 2, NRAS Exon 2
fragments
ampliconDNA Sizing Standard
Uncleaved
236-bp
amplicon
Figures 4A and 4B: WAVE DHPLC analysis with UV (Figure 4A) and fluorescence (Figure
4B) detection of SURVEYOR Nuclease digests of NRAS Positive Control Exon 3 and Wild-
Type Controls and CRC DNA isolated from FFPE sections. When visually reviewing the
chromatograms, the digested samples should be compared to the NRAS Control Wild-Type (blue
line). The NRAS Positive Control Exon 2 (green line) is a mixture of Wild-Type and mutant G12D
plasmids that result in digestion peaks of 88 and 148 bp; this control indicates that the
SURVEYOR Nuclease digestion step is working and shows the region of the chromatogram that
should be visually inspected to determine if a sample should be sent for DNA sequence analysis.
In comparing digestion patterns for Samples 1 and 2 with the Wild-Type -digested
electropherogram, it is evident that Sample 1 (red line) has a probable mutation and should be
sequenced to confirm the presence or absence of a mutation at the relevant codon. Sample 2
(black line) has a similar chromatogram to that observed for the NRAS Control Wild-Type and
does not need to be sent for DNA sequence analysis. Note that the sequencing result is the
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1814 Interpretation of Results
definitive result as there may be other non-relevant mutations that can result in the same fragment
sizes.
Figure 5A NRAS Control Wild-Type
NRAS Control Exon 3
Sample 1, NRAS Exon 3
Uncleaved
200-bp Sample 2, NRAS Exon 3
DHPLC flow
ampliconDNA Sizing Standard
through
DHPLC
Wash-off
Q61K yields
78 and 125-bp
fragments
Uncleaved
203-bp
amplicon
Figure 5B
Q61K yields NRAS Control Wild-Type
78 and 125-bp NRAS Control Exon 3
fragments Sample 1, NRAS Exon 3
Uncleaved
200-bp Sample 2, NRAS Exon 3
ampliconDNA Sizing Standard
Uncleaved
203-bp
amplicon
Figures 5A and 5B: WAVE DHPLC analysis with UV (Figure 5A) and fluorescence (Figure
5B) detection of SURVEYOR Nuclease digests of NRAS Positive Control Exon 3 and Wild-
Type Controls and CRC DNA isolated from FFPE sections. When visually reviewing the
chromatograms, the digested samples should be compared to the NRAS Control Wild-Type (green
line). The NRAS Positive Control Exon 3 (blue line) is a mixture of Wild-Type and mutant Q61K
plasmids that result in digestion peaks of 78 and 125 bp; this control indicates that the
SURVEYOR Nuclease digestion step is working and shows the region of the chromatogram that
should be visually inspected to determine if a sample should be sent for DNA sequence analysis.
In comparing digestion patterns for Samples 1 & 2 with the Wild-Type digested electropherogram,
it is evident that Sample 1 (red line) has a probable mutation and should be sequenced to confirm
the presence or absence of a mutation at the relevant codon. Sample 2 (black line) has a similar
chromatogram to that observed for the NRAS Control Wild-Type and does not need to be sent for
DNA sequence analysis. Note that the sequencing result is the definitive result as there may be
other non-relevant mutations that can result in the same fragment sizes.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 1914 Interpretation of Results
Figure 6A NRAS Control Wild-Type
NRAS Control Exon 4
Uncleaved
Sample 1, NRAS Exon 4
200-bp Sample 2, NRAS Exon 4
DHPLC flow Uncleaved ampliconDNA Sizing Standard
through 233-bp
amplicon
DHPLC
Wash-off
A146T yields
68 and 165-bp
fragments
Figure 6B NRAS Control Wild-Type
NRAS Control Exon 4
Uncleaved
Sample 1, NRAS Exon 4
A146T yields 200-bp Sample 2, NRAS Exon 4
68 and 165-bp ampliconDNA Sizing Standard
fragments
Uncleaved
233-bp
amplicon
Figures 6A and 6B: WAVE DHPLC analysis with UV (Figure 6A) and fluorescence (Figure
6B) detection of SURVEYOR Nuclease digests of NRAS Positive Control Exon 4 and Wild-
Type Controls and CRC DNA isolated from FFPE sections. When visually reviewing the
chromatograms, the digested samples should be compared to the NRAS Control Wild-Type NRAS
Control Wild-Type (green line). The NRAS Positive Control Exon 4 (blue line) is a mixture of Wild-
Type and mutant A146T plasmids that result in digestion peaks of 68 and 165 bp; this control
indicates that the SURVEYOR Nuclease digestion step is working and shows the region of the
chromatogram that should be visually inspected to determine if a sample should be sent for DNA
sequence analysis. In comparing digestion patterns for Samples 1 & 2 with the Wild-Type digested
electropherogram, it is evident that Samples 1 & 2 (red and black lines) have similar
chromatograms to that observed for the NRAS Control Wild-Type and do not need to be sent for
DNA sequence analysis. Note that for SURVEYOR Scan positive results, the sequencing result is
the definitive result as there may be other non-relevant mutations that can result in the same
fragment sizes.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 2015 Performance Characteristics
15 Performance Characteristics
15.1 Level of Detection of Mutations by SURVEYOR Scan Kits
Validation of the SURVEYOR Scan Kits for DHPLC platforms using plasmid clones of all indicated
mutations has shown that SURVEYOR Nuclease peaks can be detected in a mixture of 2-5%
mutant in a Wild-Type background.
Automated sequencing calling of both forward and reverse strands often fails to detect mutations
at levels below 10% in mixtures with Wild-Type DNA. Together with the SURVEYOR Nuclease
results, it is possible to interpret more confidently the 5-10% mutant sequencing
electropherograms.
If a sample analysis shows a SURVEYOR Scan positive result, but there is no detectable
KRAS or NRAS mutation using DNA sequencing, we recommend that a “No Variant
Detected” result be recorded. See Workflow Considerations for more details.
15.2 Sequence Confirmation
Proceed to sequence confirmation for all SURVEYOR Scan positive results to determine the
sequence identity of the NRAS Exon 2, 3 or 4 mutations.
Do not proceed to sequencing confirmation if the SURVEYOR Scan had a negative result. The
sample can be reported as Wild-Type or no variant detected.
The Universal Sequencing Primers included in this kit are intended to be used for sequence
confirmation. The forward primer is PN 710153F (Universal Sequencing Primer 1) and the reverse
primer is PN 710153R (Universal Sequencing Primer 2).
15.3 Limitations of the Assay Procedure
Contaminating substances, carried over from extraction of formalin-fixed paraffin-embedded
samples, may interfere with the PCR amplification and SURVEYOR Nuclease digestion
procedures. The quality control procedures outlined in Quality Control of PCR Products will
ensure that the extracted DNA is suitable for use in this kit.
This kit has been validated for analysis of formalin-fixed paraffin-embedded colorectal cancer
tumor samples. It has not been validated for diagnostic use of other cancer-types or with fresh or
frozen biopsy samples.
For troubleshooting non-standard results and details of factors that can affect this assay, see the
Appendix B - Troubleshooting Guide below.
Care must be taken to avoid carryover and cross-contamination with this kit. The extreme
sensitivity of the assay method requires precautions to be taken at the following points:
Ensure that all samples are handled such that cross-contamination between samples
cannot occur.
Work in a PCR workstation or other suitable space where the work area can be exposed
to UV light prior to setting up the PCR amplification reactions.
Use a separate PCR workstation or room for opening the samples after PCR amplification
for Quality Control by gel electrophoresis.
SURVEYOR Nuclease digestion set-up should be done in a separate room or a different
PCR workstation from where the initial PCR was set up.
Ensure that the kit’s plasmid controls are handled separately from test samples at all
stages of the assay.
o Make sure all solutions, no–template-control and sample DNA wells are capped
prior to opening the tubes containing the control plasmid DNA.
o HANDLE CONTROLS LAST. Add the control plasmid DNA to the appropriate
tubes only AFTER ALL no-template-control and sample wells have been capped.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 2115 Performance Characteristics
o After capping the control DNA tubes, wipe ALL tubes and caps with a DNA
destructing agent (such as 10% bleach) prior to transfer to another area.
Ensure that when pipetting samples into 96-well plates, you do not allow sample
contamination of adjacent wells either due to splashing during mixing or by not changing
pipette tips.
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 22Appendix A
Appendix A
A.1 Plate Layout Plan for SURVEYOR Scan Kits
The plate layout plan suggested below is for performing SURVEYOR Scan analysis of all seven
KRAS and NRAS Exons simultaneously on 10 samples.
Key: Ex = Exon; WT = Wild-Type; Mut = Mutation; NTC = No Template Control.
A.2 Control DNA Stamps
The sequences with a “Stamp” are given below.
Key: The most common mutation regions are highlighted in Purple. Sequence in UPPER
case is coding bases; lower case sequence is non-coding bases.
The controls have genetic “stamp” highlighted in Yellow; this variation from the NRAS
Wild-Type sequence, in a region not expected to have mutations, can be used to
troubleshoot sample contamination by Positive Controls. See Appendix B -
Troubleshooting Guide, Problem 8, for an example of a SURVEYOR Scan trace of
such contamination.
NRAS Exon 2 “Stamp”
Amplicon Size: 236 bp. For creation of the NRAS Exon 2 control plasmid’s genetic stamp
aca is changed to tgt. Codons 12 and 13 are also highlighted below.
ccatgtggttcttgctggtgtgaaATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTT
NRAS Exon 3 “Stamp”
Amplicon Size: 203 bp. For creation of the NRAS Exon 3 control plasmid’s genetic stamp
GAC is changed to CTG. Codons 59 and 61 are also highlighted below.
ACAGCTGGACAAGAAGAGTACAGTGCCATGAGACTGCAA
NRAS Exon 4 “Stamp”
Amplicon Size: 233 bp. For creation of the NRAS Exon 4 control plasmid’s genetic stamp
CAA is changed to GTT. Codons 117 and 146 are also highlighted below.
AACAAGTGTGATTTGCCAACAAGGACAGTTGATACAAAAGTTGCCCACGAACTGGCCAAGAGTTACGGG
ATTCCATTCATTGAAACCTCAGCCAAG
Instructions for Use for the SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC Page 23You can also read
