Indoleamine 2,3-dioxygenase (IDO) expression promotes renal ischemia reperfusion injury
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Page 1 of 32Articles in PresS. Am J Physiol Renal Physiol (May 14, 2008). doi:10.1152/ajprenal.00567.2007
Indoleamine 2,3-dioxygenase (IDO) expression promotes renal
ischemia reperfusion injury
KANISHKA MOHIB1,2, SHUANG WANG2, QIUNONG GUAN3, ANDREW L. MELLOR,4
HONGTAO SUN5,6, CAIGAN DU3, ANTHONY M. JEVNIKAR1,2,5,6
1
Departments of Medicine and Microbiology & Immunology, The University of Western
Ontario, London, Ontario, Canada
2
The Robarts Research Institute, London, Ontario, Canada
3
Department of Urologic Sciences, The University of British Columbia, Vancouver, British
Columbia, Canada
4
Department of Medicine, Medical College of Georgia, Augusta, Georgia
5
The Lawson Health Research Institute, London, Ontario, Canada
6
The Multi-Organ Transplant Program, London Health Sciences Center, London, Ontario,
Canada
Running Head: IDO expression enhances ischemia/reperfusion injury
Reprint requests to Dr. Anthony M. Jevnikar, Division of Nephrology, University Hospital, 339
Windermere Road, Room A10-113, London, ON, Canada N6A 5A5
E-mail: jevnikar@uwo.ca
Copyright © 2008 by the American Physiological Society.
Page 2 of 32
2
ABSTRACT
Indoleamine 2,3-dioxygenase (IDO) catabolizes tryptophan to N-formyl kunurenine and has a
pro-apoptotic role in renal tubular epithelial cells (TEC) in response to IFN- and TNF- in-
vitro. TEC produce abundant amounts of IDO in vitro in response to inflammation but a
pathological role for IDO in renal injury remains unknown. We investigated the role of IDO in a
mouse model of renal ischemia-reperfusion injury (IRI). IRI was induced by clamping the renal
pedicle of C57BL/6 mice for 45 minutes at 32°C. Here we demonstrate up-regulation of IDO in
renal tissue at 2 hrs after reperfusion which reached maximal levels at 24 hrs. Inhibition of IDO
following IRI prevented the increase in serum creatinine observed in vehicle treated mice
(86.4±25 µmol/L, n=11) when compared to mice treated with 1-methyl-d-tryptophan (1-MT), a
specific inhibitor of IDO, (33.7±8.7µmol/L, n=10, p=0.031). The role of IDO in renal IRI was
further supported by results in IDO-KO mice which maintained normal serum creatinine levels
(32.5±2.0µmol/L, n= 6) following IRI as compared to wild type (WT) mice (123±30µmol/L, n=
9, p= 0.008). Our data suggest that attenuation of IDO expression within the kidney may
represent a novel strategy to reduce renal injury as a result of ischemia/reperfusion.
Key words: tubular epithelial cell, apoptosis, renal function
Page 3 of 32
3
INTRODUCTION
Ischemia reperfusion injury (IRI) is invariably associated with solid organ
transplantation. As therapeutic agents that completely or predictably prevent IRI are currently
unavailable, IRI remains a major problem in renal transplantation. The degree of injury sustained
under such conditions influences both the immediate and potentially the long-term outcome of a
transplant [17, 36, 44]. One of the deleterious consequences of renal IR involves tubular
epithelial cell (TEC) injury and death [25, 26, 42]. Kidney TEC undergo apoptosis as well as
necrosis as a result of IRI [26, 37, 43]. As TEC are central to the function of the nephron and
thus the kidney, strategies that limit or prevent TEC death may improve long-term renal allograft
function.
Indoleamine 2,3-dioxygenase (IDO) is the rate-limiting enzyme in the kynurenine
enzymatic pathway and is expressed in various tissues and cells including dendritic cells and
macrophages in response to IFN- , TNF- , and LPS [3, 8, 21, 38, 46-50]. IDO expression has
been shown to cause activation induced cell death (AICD) of T cells by enhancing Fas mediated
apoptosis [24]. The activity of the enzyme has also been demonstrated to augment anti-Fas
mediated cell death of human tumor cell lines [19]. Previous studies have associated IDO
expression in the kidney with renal acute rejection and chronic failure [5, 39, 45]. Specifically,
the expression of IDO in renal tubules and the presence of high concentration of kynurenine,
found in sera and urine of recipients, during acute rejection and chronic renal failure suggest IDO
may participate in graft injury [5, 39, 45]. Recently, we have demonstrated that IDO augments
Fas/FasL mediated self injury and death of TEC in response to IFN- and TNF- in-vitro [32].
However a role for IDO in promoting renal injury following IRI has not been determined in-vivo.
The aim of this study was to determine if renal expression of IDO could promote IRI by
Page 4 of 32
4
augmenting tubular cell death and worsening function. Using IDO-KO mice as well as the IDO
specific inhibitor 1-methyl-d-tryptophan (1-MT) in wild type mice, we tested for renal injury
following renal artery clamping in uni-nephrectomized mice. Our studies demonstrate that renal
IDO expression is deleterious during renal IR and elimination or inhibition of IDO prevented
injury with maintenance of normal histology and renal function. Therapeutic inhibition of IDO is
clinically feasible in the time frame of IRI, and as such these results may be considerably
significant in renal transplantation.
METHODS
Animals:
C57BL/6 (B6) mice (male, 8–10 weeks old) were obtained from the Jackson Laboratory
(Bar Harbor, ME,). Both wild type (WT) B6 and IDO KO mice [31] (C57BL/6 background)
were maintained in the animal facility at the University of Western Ontario (London Ontario,
Canada). Animal experiments were conducted in accordance with the Canadian Council on
Animal Care guidelines under protocols approved by the Animal Use Subcommittee at our
institution.
Renal ischemia reperfusion injury induction:
Ischemic injury was induced by clamping the renal pedicle of the left kidney for 45
minutes at 32°C. After the clamps were released, reperfusion of the kidneys was confirmed
visually, and the right kidney was removed. For the IDO inhibitor treatment, wild type B6 mice
received intra peritoneal injections of 3mg of 1-MT (Sigma-Aldrich, Mississauga, ON) dissolved
Page 5 of 32
5
in PBS or PBS alone (vehicle) twice a day for a total period of 48 hours following reperfusion.
Some mice received 1-MT one hour prior to ischemia as well as following reperfusion. After 48
hours of reperfusion the mice were sacrificed at which point serum and tissue samples were
collected. Uni-nephrectomized mice that did not undergo IR were also included in the study as
sham operated controls. Renal tubular epithelial cells (TEC) were subjected to ischemic
conditions in vitro. NG 1.1 [32] TEC (2.0 x 106) were seeded to each well of 6-well plates
overnight. Medium was replaced in confluent monolayer cultures with K1 medium without
serum or growth factors to arrest cell division. To mimic ischemia injury in vitro, sterile mineral
oil (sigma) was added to the wells to cover the medium, followed by continued culture at 37 C,
At various time points, oil was removed and TEC RNA was collected by using TRIzol at the
different time points (Baseline, 0h, 1h, 2h, 4h, 8h, 24h).
RNA isolation and RT-PCR:
Kidney tissue pooled from 3 mice were added to 1-2 mL of Trizol (Invitrogen GIBCO,
Burlington, ON) and ground up using a tissue sonicator. RNA was isolated according to
manufacturer’s instructions. RT-PCR was carried out using total isolated RNA. Briefly, 5Lg of
RNA from each sample was used to carry out reverse transcription with Superscript II
(Invitrogen GIBCO). Subsequently PCR amplification of IDO cDNA was carried out using a
specific pair of primers 5’-CATAAGACAGAATAGGAGGC (sense) and 5’-
GAAGATGTGGGCTTTGCTCTA (anti-sense) for 32 cycles. Glyceraldehyde-3-phospate
dehydrogenase (GAPDH) mRNA levels were used as an internal control for the amount of RNA
loaded in each sample. PCR products were visualized on a 1% agrose gel with 0.5Lg/mL-
Page 6 of 32
6
ethidiumbromide. Although semi-quantitative, comparisons of expression of IDO mRNA levels
between sample times were made using densitometry with GAPDH mRNA expression levels.
Western blot analysis:
Kidney tissue samples pooled from 3 different mice were added to lysis buffer [10mM
HEPES (pH 7.9), 10m KCl, 0.10 mM EDTA, 0.10 mM EGTA, 0.10% NP 40, 1.0 mM DTT and
a protease cocktail (Roche Diagnostics, Mannheim Germany)] and ground up using a sonicator.
An equal amount of 4x SDS sample buffer [20mM Tris- HCl (pH 6.8), 5.0% (wt/vol) SDS, 10%
vol/vol beta-mercaptoethanol, 2.0 mM EDTA, and 0.020% bromophenol blue) was added to the
ground up tissue. The samples were run on a 12% SDS-polyacrylamide gel and subsequently
transferred to a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, CA). The membrane
was blocked using 5.0% milk in TBS-T (20 mM Tris-HCl, pH 7.6, 0.14 M NaCl, 0.10% Tween
20) for one hour. The IDO protein (~45kda) was detected using a primary polyclonal rabbit anti-
IDO antibody [31] (1:3000), in TBS-T containing 2.5% milk and a goat anti-rabbit peroxidase
conjugated secondary antibody (Sigma Aldrich). The bound protein on the membrane was
visualized by an enhanced chemiluminescence assay (ECL, Amersham Pharmacia Biotech,
Buckinghamshire, England). Blots were re-probed using total ERK antibody (Sigma-Aldrich) as
a loading control. Quantification of IDO protein levels at various sample times was made using
densitometry and comparing IDO levels to total ERK levels.
Densitometry analysis:
RT-PCR or western blot images were scanned using a GS700 Imaging densitometry
scanner (BioRad Inc. Mississauga, Ontario). Analysis of the images was carried out with BioRad
Page 7 of 32
7
Densitometry software (BioRad Inc.). Individual blot/gel images were examined by analyzing
the intensity of each band within a fixed volume. The density ratio was determined by dividing
the intensity of the target mRNA/protein by the respective GAPDH/total ERK band intensities.
Tissue immuno-histochemical staining:
Paraffin embedded tissue sections were immersed for 5 minutes in 100% xylene twice, 1:1
(xylene:ethanol), 100%, 90%, 75% ethanol and washed 3 times in Tris buffer saline (TBS) (pH
7.4). The slides were transferred into already boiling 10mM sodium citrate buffer (pH 6.0) for 40
minutes and then left to cool in room temperature for 20 minutes. Three 5 minutes washes in
TBS were carried out and the sections were treated with 100µL of 2.0% H2O2 for a period of 10
minutes followed by permeabilization with 0.20% Triton X-100 for 10 min at room temperature.
The sections were washed 2 times with TBS and blocked for 1 hour using 4.0% rabbit and 2.0%
goat serum. Subsequently the slides were incubated with 1:100 of primary anti-IDO antibody
overnight at 4°C. Three 10 minutes TBS washes were carried out and the samples were
incubated with 1:200 of secondary biotin conjugated antibody for 2 hours. Three TBS washes
were carried out and the slides were incubated with 1:200 of avidin solution for 45 minutes at
RT. Antibody binding was visualized using 3,3'-diaminobenzidine (DAB) as substrate (Sigma
Aldrich) followed by counterstaining with hematoxylin for 5 minutes. All slides contained
duplicate sections from which one served as a control for secondary-antibody binding specificity.
Determination of renal function, injury and cellular infiltration:
Kidney function was determined through measurement of serum creatinine and blood
urea nitrogen (BUN), by a Jaffe reaction method with an automated CX5 clinical analyzer
Page 8 of 32
8
(Beckman Instruments, Fullerton, CA, USA). Histological evaluation of tubular injury in kidney
sections was performed in a blinded fashion. Formalin-fixed and paraffin-embedded sections
(5µm thickness) were stained by hematoxylin and eosin (H&E) and periodic acid Schiff (PAS)
method. These sections were examined in a blinded fashion by a pathologist. Kidney injury was
assessed as percentage of tissue involved with histological changes in the cortex and medulla
using a semi-quantitative scale and an evaluation of area involved with tubular injury and
neutrophil infiltration on a 5-point scale as follows: 0, no change ; 1, 10–25%; 2, 25–50%; 3, 50–
75% and 4, 75–100%. Scores were averaged for at least 10 non-overlapping fields for each
kidney. Neutrophil (PMN) infiltration was assessed by direct counting of sections at 400x.
Results are expressed as PMN ± SEM per 5 high power fields (hpf).
TUNEL assay:
Buffered-formalin-fixed sections were processed with proteinase K (30 min at 37°C),
followed by quenching endogenous peroxidase in 3.0% H2O2 in TBS (pH 7.4) for 30 min at
room temperature, then permeabilizing with 0.20% Triton X-100 for 10 min at room
temperature. After washing with TBS, the sections were incubated with terminal transferase and
FITC-conjugated dUTP (Roche Diagnostics) for 60 min at 37°C. FITC-dUTP-labeled nuclei
were detected using anti-FITC antibody conjugated with phosphatase (Sigma-Aldrich), and
visualized with phosphatase substrate Sigma Fast Red (Sigma-Aldrich). The number of TUNEL-
positive cells representing apoptotic/necrotic cells in the section of each kidney were counted in
at least 10 non-overlapping high power fields (hpf) under 400x magnification and averaged in a
blinded fashion.
Page 9 of 32
9
Statistical analysis:
Two-way ANOVA and t-tests (two-tailed distribution) were used for comparisons
between groups using Statview software (SAS Institute, Cary, CA, USA). A p-value of S0.05
was considered significant.
RESULTS
Upregulation of IDO following renal ischemia/reperfusion:
The activity of IDO has diverse physiological functions including suppression of
activated T cells by placental tissues in fetal-maternal tolerance, tryptophan starvation of
intracellular pathogens and UV protection in the cornea [33, 41, 46]. Recently, we have
demonstrated the ability of IDO to enhance renal TEC fratricide mediated through TEC
expression of Fas/FasL in response to inflammatory cytokines [32]. Therefore, we hypothesized
that if IDO is expressed in the kidney in response to inflammation following IRI, it may promote
this form of TEC self-injury. In order to determine whether the expression of IDO is up regulated
in response to renal IRI, wild type mice were subjected to renal IRI and sacrificed at various
times points. Sham operated mice, used as controls, displayed basal expression levels of IDO
mRNA and those levels remained unchanged in mice that were subjected to 45 minutes of
ischemia and 0.5 hour, and 1 hour of reperfusion (Fig. 1a). However, at 2 hours post reperfusion
there was a noticeable increase in the level of IDO mRNA that became most pronounced at 4
hours and 24 hours (Fig. 1a). Similar to IDO mRNA expression kinetics, the level of IDO protein
Page 10 of 32
10
initially increased at 2 hours post reperfusion and remained up regulated at 4 and 24 hours as
compared to sham control (Fig. 1b). IDO mRNA was detected in quiescent TEC but was not
increased following ischemic conditioning in vitro (not shown), suggesting enhanced IDO
expression in TEC is related to the reperfusion associated inflammation, rather than ischemia
alone. Although RT-PCR and western blot analysis are sensitive in detecting mRNA and protein
levels of the desired target, these methods do not distinguish location of expression within the
kidney. Immuno-staining was performed on sections obtained from sham operated and IR treated
mice that were sacrificed 24 hours following reperfusion. IDO staining was detected very weakly
within TEC of control mice (Fig. 2a). In contrast, IR subjected mice had intense and diffuse IDO
staining within the TEC of the renal cortex (Fig. 2b). These results suggest that tubular cells
appear to be primarily responsible for the elevated expression of IDO noted, but do not
distinguish proximal or distal tubules. IDO expression in TEC was not clearly localized to
specific cellular compartments in these tissue sections, although expression appeared to be
primarily cytoplasmic in cultured TEC (not shown). It is unknown whether IDO can translocate
in epithelial cells to possibly facilitate immune-modulation given its reported role in promoting T
cell apoptosis.
IDO deficient kidneys have improved function following IRI:
Previous studies of renal IDO expression have established an association with acute
rejection, decreased glomerular filtration and renal insufficiency. However these studies have not
directly linked renal IDO to acute or chronic injury [5, 39, 45]. To address this, we carried out
IRI studies using IDO-KO mice [31]. Following 48 hours of reperfusion, sera from the mice
were collected and creatinine and BUN levels were measured to assess kidney function. ClampedPage 11 of 32
11
IDO-KO mice had markedly lower level of creatinine (32.5 ± 2.0 µmole/L, n = 6) compared to
(123 ± 30 µmole/L, n = 9, p = 0.008) in wild type mice (Fig. 3a) reflecting protection of these
kidneys from IRI. Clamped IDO-KO mice also had improved kidney function reflected by
preserved sera BUN concentrations. IDO-KO mice had significantly lower levels of urea (13.0 ±
2.0 mmol/L, n = 6) versus wild type mice (49.6 ± 11 mmol/L, n = 9, p = 0.006) (Fig. 3b).
Collectively these data demonstrate that enhanced IDO expression occurs with IRI and that renal
expression of IDO can have a deleterious effect on kidney function.
Administration of IDO specific inhibitor 1-MT improves renal function following IRI:
Down regulation of IDO expression might be useful as a strategy to prevent renal injury
including transplantation. 1-MT is a potent inhibitor of IDO [7] and hence we used this agent to
substantiate data obtained with IDO-KO mice. Wild type mice subjected to IR and treated with
1-MT pre and post ischemia had creatinine levels (33.7 ± 8.7 µmole/L, n=10) substantially lower
than vehicle treated mice (86.4 ± 25 µmole/L, n=11, p = 0.031) (Fig. 4a) and was equivalent to
that observed in IDO-null mice. Similarly BUN concentrations in 1-MT treated mice (20.9 ± 4.6
mmol/L, n=10) were lower than those from wild type mice (43.4 ± 8.3 mmol/L, n=11, p = 0.036)
(Fig. 4b). Therefore, pharmacological inhibition of IDO with 1-MT is consistent with the benefit
observed using IDO-KO mice when administered 1 hour prior to ischemia induction. However
no benefit was observed with 1-MT treatment post ischemia as creatinine levels (111.7 ± 30
umol/l, n=4) were not different from control mice. Higher levels and greater delivery of 1-MT
post ischemia was limited by its low solubility and its rapid clearance, and the relatively large
volumes required for injection.Page 12 of 32
12
IDO expression contributes to tubular epithelial cell damage:
Histological assessments were carried out to establish a correlation between the
functional protection observed and the degree of injury sustained by the kidney. Tissue sections
were paraffin embedded, and stained with hematoxylin and eosin (H&E) or PAS for scoring,
which was in a blinded fashion as previously described [11]. Wild type kidney sections were
characterized by extensive damage that included disrupted tubules, loss of normal architecture,
flattening of cells with loss of tubular brush border, non cellular cast formation and changes
consistent with acute tubular necrosis (ATN) (Fig. 5b). In contrast, sections obtained from IDO-
KO mice showed preservation of normal architecture of cells with subtle injury in comparison to
wild type mice. Accordingly, tubular necrosis and vacuolization (%) scoring confirmed a
considerable difference in tissue involved in wild type kidneys (51 ± 5.1%, n = 9) versus IDO-
KO kidneys (23 ± 2.1 %, n = 6) p = 0.001 (Fig. 5d). Histology was also improved in mice
treated with 1-MT prior to ischemia (Fig. 6c) with less tubular damage and minimal cast
formation compared to vehicle treated mice (Fig. 6b). Scoring of the sections and subsequent
comparison confirmed that WT-PBS treated mice had higher amounts of tubular necrosis and
vacuolization (45 ± 3.0%, n =11) compared to pre and post 1-MT treated mice (29 ± 3.3%, n =
10), p = 0.002 (Fig 6d). As IR injury has been associated with cellular infiltration, we also
carried out H&E staining to assess this. WT PBS treated kidney sections had greater neutrophil
infiltration (10.4±9/ 5hpf, n=8) than pre-ischemia 1-MT treated mice (2.4±5, n=7, p=0.02 vs WT
control) or IDO null kidneys (0±0.5/5hpf, n=6, p=0.007 vs WT control) (Fig 7 a, b, c). Hence,
the functional improvement in IDO-KO and 1-MT mice following IRI is consistent with a
reduction in histological kidney injury compared to their respective controls.Page 13 of 32
13
IDO-KO kidneys have reduced cellular apoptosis/necrosis following IRI:
TUNEL staining of the fixed sections was performed to study the effect of IDO
elimination on kidney apoptosis and necrosis, in relation to the observed protection in IDO null
kidneys. Wild type mice had significantly higher numbers of TUNEL positive cells (6.5 ±
0.9/hpf, n = 9) in the tubular compartment, than IDO-KO mice (2.1 ± 0.6/hpf, n = 6, p = 0.03)
(Fig 8). These data suggest IDO expression contributes to apoptosis/necrosis within the kidney
following IR. As control kidneys had significantly more infiltrate than either 1-MT or IDO null
kidneys, it is difficult to unequivocally identify which cells were undergoing apoptosis in tissue
sections. However the absence of diffuse and prominent infiltrates in control sections and
morphology of cells, would suggest that apoptosis was largely occurring within TEC. Apoptosis
was also largely absent in ischemic IDO null kidneys, consistent with reduced TEC injury and
correlation to improved function .
DISCUSSION
Ischemia reperfusion injury in kidneys represents an orchestrated series of inflammatory
events leading to organ injury in which there is rapid and significant upregulation of numerous
pro-inflammatory factors that are relevant to renal injury including IFN- , TNF- , and MHC I,
II, as well as Fas/FasL [9, 15, 14, 18, 30, 29]. The degree of injury sustained to the kidney as a
result of IR may not only influence graft acceptance through links between innate and adaptive
immunity but also the longevity of the graft as nephrons continue to be injured by inflammation
[1-3].
There are several key observations that suggest IDO may be in a position to affect renal
IRI. TEC express basal levels of both Fas and FasL and increase Fas expression in response toPage 14 of 32
14
LPS, inflammatory cytokines such as IFN- and TNF- , as well oxidative stress, which may lead
to injury [1, 4, 10, 20, 22, 23, 28, 34, 35, 40]. IRI and transplant studies carried out with MRL-
lpr and MRL-gld mice have established that loss of functional Fas/FasL can limit IRI and
consequently be beneficial to the organ [34]. Recently, we have shown that IDO promotes
Fas/FasL mediated TEC death in response to IFN- /TNF- in-vitro [32]. Moreover, the
expression and activity of IDO associated with renal acute rejection and chronic failure indirectly
implicates a role for IDO in immune injury following transplantation. In the present study, we
have found that increased IDO expression is part of the acute response of IR as both mRNA and
protein levels of the enzyme noticeably increased within 2 hours post reperfusion and peaked
between 4 hours and 24 hours. The expression of IDO appears to be in response to reperfusion
associated inflammatory cells and the cytokines that they produce, rather than ischemia per se.
TEC augment IDO expression in response to pro-inflammatory cytokines [32] but IDO mRNA
did not change with ischemic in vitro conditioning in the present study (data not shown). The in
vivo results in the present study examining kidneys of IDO wild type mice therefore are
consistent with our results in cytokine exposed TEC, although IDO expression may differ in non
TEC cells.
This study is the first to describe the induction of IDO in response to renal IR. In
addition, we elucidated that both IDO-KO and WT mice treated with the IDO inhibitor had
improved kidney function, and decreased tissue injury with reduced numbers of TEC undergoing
apoptosis/necrosis. As a result, our studies suggest that therapeutic inhibition of IDO may be
beneficial in the early stages of transplant injury that involve IR, particularly as this is when TEC
express high levels of both IDO and Fas/FasL. Although our data would suggest that inhibition
of IDO expression in kidneys is required prior to the onset of ischemia, IDO inhibition may bePage 15 of 32
15
therapeutically relevant to some forms of renal injury. With renal transplantation, the addition of
1-MT or alternate pharmacological agents to block IDO or downstream metabolites to organ
preservation solutions may be of greater benefit than treating recipients post transplant.
Traditionally IDO has been described to be beneficial to tissues expressing the enzyme as
it is able to prevent the growth of tryptophan dependent pathogens and suppress T cells by
inhibiting proliferation in addition to inducing Fas/FasL mediated cell death [3, 6, 8, 46]. Several
groups have been able to prolong survival of transplanted lungs, pancreatic beta cells, and skin
[2, 13, 27, 33]. More recently, Liu et al. have demonstrated that IDO plays a protective role in
lung IR [27]. Although, our findings are not consistent with the above studies we believe the
disparity may be explained by the differential expression of Fas/FasL in parenchymal cells of the
various organs. While over expression of IDO may have potential beneficial effects to promoting
long-term graft survival by evading the immune system, we suggest that caution should be taken
in cells such as TEC in which Fas and FasL are co-expressed. Future studies examining this
strategy are needed in order to determine potential immune protective effects of IDO bestowed to
TEC following transplantation.
The mechanism(s) by which IDO augments injury in TEC have not yet been clearly
delineated. Interestingly, the expression of IDO was associated with increased numbers of
infiltrating cells as well as greater apoptosis in tissue sections. Our previous results using
cultured TEC supports a role for IDO in promoting tubular cell self injury through Fas-FasL
expression in response to inflammatory cytokines [32] may hold true in-vivo as our data does
not exclude the possibility that IDO associated renal injury in IRI is related to enhanced cytokine
release by infiltrated cells. While we cannot exclude that apoptosis was also occurring in the
infiltrating cells, the worsened function in wild type IDO kidneys and improved function in thePage 16 of 32
16
absence of IDO would suggest that the beneficial effect was on TEC and renal parenchymal
cells. As neutrophils are observed with severe IRI, the reduction of neutrophil infiltration with
attenuation of IDO was likely due to reduced tissue injury. However the reduction of
inflammatory infiltrates may have had a further benefit in limiting renal injury. Several studies
have associated an increase in IDO related, downstream kynurenine pathway metabolites with
acute rejection and chronic renal failure [5, 39, 45]. Accordingly, our previous studies
demonstrate a potentiating effect of cytokine-mediated TEC death, upon exposure to downstream
metabolites picolinic acid and quinolinic acid [32]. These findings are substantiated by previous
reports of the ability of quinolinic acid to directly activate caspase-8 and cause the release of
cytochrome c [12, 16]. Strategies that limit down stream kynurenine pathway enzymes more
specifically than 1-MT in donor kidneys prior to transplantation may suppress TEC injury while
allowing IDO expression to persist and provide immune protection.
CONCLUSIONS
In conclusion IDO expression following IR has a deleterious effect on kidney injury and
function. Our data suggests that attenuation of IDO may represent a novel strategy to reduce
renal IRI and thereby potentially improve kidney graft function and survival.Page 17 of 32
17
ACKNOWLEDGMENTS
We thank Ms. Pamela Gardner for secretarial assistance, Drs. Joaquim Madrenas, Ewa Cairns,
and the late Dr. Robert Zhong for their invaluable advice.
Grants:
This work was supported by a grant from the Canadian Institutes of Health Research (CIHR)
(A.M.J and C.D.) and the Multi-Organ Transplant Program of London Health Sciences Centre.
Disclosures:
A.L. Mellor has intellectual property interests in the therapeutic use of IDO and IDO inhibitors
and receives consulting income from NewLink Genetics Inc.Page 18 of 32
18
References:
1. Akasaka Y, Ishikawa Y, Kato S, Ishii T, Masuda T, Fujita K, et al. Induction of
Fas-mediated apoptosis in a human renal epithelial cell line by interferon-gamma:
involvement of Fas-mediated apoptosis in acute renal rejection. Mod Pathol 11(11):
1107-14, 1998.
2. Alexander A, Crawford M, Bertera S, Rudert W, Takikawa O, Robbins P, et al.
Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft
survival after adoptive transfer of diabetogenic splenocytes. Diabetes 51(2): 356-65,
2002.
3. Beatty W, Belanger T, Desai A, Morrison R, Byrne G. Tryptophan depletion as a
mechanism of gamma interferon mediated chlamydial persistence. Infect Immun 62(9):
3705-11, 1994.
4. Boonstra J, van der Woude F, Wever P, Laterveer J, Daha M, van Kooten C.
Expression and function of Fas (CD95) on human renal tubular epithelial cells. J Am Soc
Nephrol 8(10): 1517-24, 1997.
5. Brandacher G, Cakar F, Winkler C, Schneeberger S, Obrist P, Bosmuller C, et al.
Non-invasive monitoring of kidney allograft rejection through IDO metabolism
evaluation. Kidney Int 70(1): 60-67, 2006.
6. Byrne GI Lehmann LK, Landry GJ. Induction of tryptophan catabolism in the
mechanism for gamma-interferon mediated inhibition of intracellular Chlamydia psittaci
replication in T24 cells. Infect Immun 53: 347-51, 1986.
7. Cady SG, Sono M. 1-Methyl-DL-tryptophan, beta-(3-benzofuranyl)-DL-alanine (the
oxygen analog of tryptophan), and beta-[3-benzo(b)thienyl]-DL-alanine (the sulfur
analog of tryptophan) are competitive inhibitors for indoleamine 2,3-dioxygenase. Arch
Biochem Biophys 291(2): 326-33, 1991.
8. Currier A, Ziegler M, Riley M, Babcock T, Telbis V, Carlin J. Tumor necrosis
factor-alpha and lipopolysaccharide enhance interferon-induced anti-chlamydial
indoleamine dioxygenase activity independently. J Interferon Cytokine Res 20: 369-376,
2000.
9. Dannahoo K, Meng X, Ayala A, Cain M, Harken A, Medrum D. Early kidney
TNF-alpha expression mediates neutrophil infiltration and injury after renal ischemia–
reperfusion. AmJ Physiol 277: R922-29, 1999.
10. Du C, Jiang J, Guan Q, Yin Z, Masterson M, Parbtani A, et al. Renal tubular
epithelial cell self-injury through Fas/Fas ligand interaction promotes renal allograft
injury. Am J Transplant 4(10): 1583-94, 2004.
11. Du C, Jiang J, Guan Q, Diao H, Yin Z, Wang S, et al. NOS2 (iNOS) deficiency in
kidney donor accelerates allograft loss in a murine model. Am J Transplant 7(1): 17-26,
2007.
12. Fallarino F, Grohnmann U, Vacca C, Bianchi R, Orabona C, Spreca A, et al. T
cell apoptosis by tryptophan catabolism. Cell Death Diff 9: 069-77, 2002.Page 19 of 32
19
13. Ghahary A, Li Y, Tredget E, Kilani R, Iwashina T, Karami A, et al. Expression
of Indolemaine 2,3-dioxygenase in dermal fibroblasts functions as a local
immunosuppressive factor. J Invest Dermatol 122(4): 953-64, 2004.
14. Goes N, Urmson J, Ramassar V, Halloran P. Ischemic acute tubular necrosis
induces an extensive local cytokine response. Evidence for induction of interferon-
gamma, transforming growth factor-beta 1, granulocyte-macrophage colony-stimulating
factor, interleukin-2, and interleukin-10. Transplantation 59(4): 565-72, 1995.
15. Goes N, Sims T, Urmson J, Vincent D, Ramassar V, Halloran P. Disturbed MHC
regulation in the IFN-y knockout mouse, evidence for three states of MHC expression
with distinct roles for IFN-gamma. Immunlogy 155: 4559-66, 1995.
16. Grohmann U, Fallarino F, Puccetti P. Tolerance, DCs and tryptophan: much ado
about IDO. Trends Immunol 24: 242-248, 2003.
17. Gueler F, Gwinner W, Schwarz A, Haller H. Long-term effects of acute ischemia
and reperfusion injury. Kidney Int 66: 523-27, 2004.
18. Halloran P, Autehried P, Ramassar V, Urmson J, Cockfiled S. Local T cell
responses induce widespread MHC expression evidence that IFN-y induces its own
expression in remote sites. Immunlogy 148(12): 3837-46, 1992.
19. Hassan M, Mirmohammadsadegh A, Selimovic D, Nambiar S, Tannapfel A,
Hengge U. Identification of functional genes during Fas-mediated apoptosis using a
randomly fragmented cDNA library. Cell Mol Life Sci 62(17): 2015-26, 2005.
20. Jo S, Cha D, Cho W, Kim H, Chang K, Yun S, et al. Inflammatory cytokines and
lipopolysaccharide induce Fas mediated apoptosis in renal tubular cells. Nephron 91(3):
4112-18, 2002.
21. Kallio R, Berg C. Tryptophan metabolism: tryptophan, kynurenine, and related
compounds as precursors of nicotinic acid. J BIol Chem 181(1): 333-341, 1949.
22. Kato S, Akasaka Y, Kawamura S. Fas antigen expression and its relationship with
apoptosis in transplanted kidney. Pathol Int 47(4): 230-237, 1997.
23. Koide N, Narita K, Kato Y. Expression of Fas and Fas ligand on mouse renal
tubular epithelial cells in the generalized schwartzman reaction and its relationship to
apoptosis. Infect Immun 67: 4112-18, 1999.
24. Lee G, Park H, Macleod M, Chandler P, Munn D, Mellor A. Tryptophan
deprivation sensitizes activated T cells to apoptosis prior to cell division. Immunlogy
107(4): 452-460, 2002.
25. Liberthal W, Levine J. Mechanisms of apoptosis and its potential role in renal
tubular epithelial cell injury. Am J Physiol 271(43): F477-F488, 1996.
26. Liberthal W, Menza S, Levine J. Graded ATP depletion can cause necrosis or
apoptosis of cultured mouse proximal tubular cells. Am J Physiol Renal Physiol 274(43):
315-327, 1998.
27. Liu H, Liu L, Fletcher B, Visner G. Novel action of indoleamine 2,3-dioxygenase
attenuating acute lung allograft injury. Am J Resir Crit Care Med 173(5): 566-72, 2005.
28. Lorz C, Ortiz A, Justo P. Pro-apoptotic Fas ligand is expressed by normal kidney
tubular epithelium and injured glomeruli. J Am Soc Nephrol 11: 1266-77, 2000.Page 20 of 32
20
29. Meldrum K, Meldrum D, Meng X, Ao L, Harken A. TNF-alpha-dependent
bilateral renal injury is induced by unilateral renal ischemia–reperfusion. Am J Physiol
Heart Cir Physiol 282: H540-H46, 2002.
30. Meldrum K, Meldrum D, Hile K, Yerkes E, Ayala A, Cain M, et al. p38 MAPK
mediates renal tubular cell TNF-alpha production and TNF-alpha-dependent apoptosis
during simulated ischemia. Am J Physiol Cell Physiol 281: C563-70, 2001.
31. Mellor AL, Baban B, Chandler P, Marshall B, Jhaver K, Hansen A, et al. Cutting
edge: induced indoleamine 2,3 dioxygenase expression in dendritic cell subsets
suppresses T cell clonal expansion. J Immunol 171(4): 1652-5, 2003.
32. Mohib K, Guan Q, Diao H, Du C, Jevnikar AM. Proapoptotic activity of
indoleamine 2,3-dioxygenase expressed in renal tubular epithelial cells. Am J Physiol
Renal Physiol 293(3): F801-12, 2007.
33. Munn D, Zhou M, Attwood J, Bondarev I, Conway S, Marshall B, et al.
Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281(5380):
1191-93, 1998.
34. Nogae S, Myazaki M, Koayahsi N, Saito T, Abe K, Saito H, et al. Induction of
apoptosis in ischemia-reperfusion model of mouse kidney: possible involvement of Fas. J
Am Soc Nephrol 9(4): 620-631, 1998.
35. Ortiz-Arduan A, Dannoff T, Kalluri R, Gonzalez-Cuadrado S, Karp S, Elkon K,
et al. Regulation of Fas and Fas ligand expression in cultured murine renal cells in the
kidney during endotoxemia. Am J Physiol Renal Physiol 271(6): 1193-207, 1996.
36. Pagtalunan M, Olson J, Tilney N, Meyer T. Late consequences of acute ischemic
injury to a solitary kidney. J Am Soc Nephrol 10: 366-373, 1999.
37. Preuss H, Tourkantonis A, Hsu C, Shim P, Barzyk P, Tio F, et al. Early events in
various forms of experimental acute tubular necrosis in rats. Lab Invest 32(3): 286-94,
1975.
38. Robinson C, Hale P, Carlin J. The role of IFN-gamma and TNF-alpha-responsive
regulatory elements in the synergistic induction of indoleamine dioxygenase. J Interferon
Cytokine Res 25(1): 20-30, 2005.
39. Saito K, Fujigaki S, Heyes M, Shibata K, Takemura M, Fujii H, et al. Mechanism
of increases in L-kynurenine and quinolinic acid in renal insufficiency. Am J Physiol
Renal Physiol 279: 565-72, 2000.
40. Schelling J, Cleveland R. Involvement of Fas-dependent apoptosis in renal tubular
epithelial cell deletion in chronic renal failure. Kidney Int 56: 1313-16, 1999.
41. Serbecic N, Beutelspacher S. Indoleamine 2,3-dioxygenase protects corneal
endothelial cells from UV mediated damage. Exp Eye Res 82(3): 416-23, 2006.
42. Shimizu A, Yamanaka N. Apoptosis and cell desquamation in repair process of
ischemic tubular necrosis. Virchows Arch B Cell Path Incl Mol Pathol 64(3): 171-180,
1993.
43. Solez K, Morel-Maroger L, Sraer J. The morphology of acute tubular necrosis in
man; analysis of 57 renal biopsies and a comparison with the glycerol model. Medicine
58: 362-376, 1979.Page 21 of 32
21
44. Takada M, Nadeau K, Shaw G, Tilney N. Prevention of late renal changes after
initial ischemia/reperfusion injury by blocking early selectin binding. Transplantation 64:
1520-25, 1997.
45. Tankiewicz A, Pawlak D, Topczewska-Bruns J, Buczko W. Kidney and liver
kynurenine pathway enzymes in chronic renal failure. Adv Exp Med Biol 527: 409-414,
2003.
46. Thomas S, Garrity L, Brandt C, Schobert C, Feng G, Taylor M, et al. IFN-
gamma-mediated anti-microbial response. Indoleamine 2,3-dioxygenase deficient mutant
host cells no longer inhibit intracellular Chlamydia ssp. Or Toxoplasma growth. J
Immunol 150(12): 5529-34, 1993.
47. Yoshida R, Hayaishi O. Induction of pulmonary indoleamine 2,3-dioxygenase by
intraperitoneal injection of of bacterial lipoplysaccharide. Proc Natl Acad Sci 75(8):
3998-4000, 1978.
48. Yoshida R, Urade Y, Nakata K, Watanabe Y, Hayaishi O. Specific induction of
indoleamine 2,3-dioxygenase by bacterial lipopolysaccharide in the mouse lung. Arch
Biochem Biophys 212(2): 629-637, 1981.
49. Yoshida R, Urade Y, Tokuda M, Hayaishi O. Induction of pulmonary indoleamine
2,3-dioxygenase by interferon. Proc Natl Acad Sci 78(1): 129-132, 1981.
50. Yoshiro O SR, Hamilton TA. Synergy between interferon-gamma and tumor
necrosis factor alpha in transcriptional activation is mediated by cooperation between
signal transducer and activator of transcription 1 and nuclear factor beta. J Biol Chem
272: 14899-14907, 1997.Page 22 of 32
22
Figure Legends:
Figure 1) Ischemia/reperfusion induces renal IDO expression. The renal pedicle of uni-
nephrectomized C57BL/6 mice was clamped for 45 minutes at 32°C and sacrificed at 0.5h, 1h,
2h, 4h, and 24h following reperfusion. Renal tissue was collected and pooled from 3 separate
mice for each time point. a) IDO mRNA levels were detected by RT-PCR. GAPDH was used to
control for the amount of RNA used in each sample. mRNA changes by this method are semi-
quantitative and densitometry is provided as a ratio of IDO:GAPDH to demonstrate increases
following IRI b) IDO protein (~45kDa) was detected using a rabbit-anti-IDO antibody in
Western blot. Total ERK was used as a protein loading control. Densitometry of IDO:ERK levels
is shown. Data are representative of 2 separate experiments.
Figure 2) Immuno-histochemical staining displays tubular expression of IDO in response to
IR. Paraffin embedded fixed kidney section were probed with anti-IDO antibody in order
pinpoint IDO expression by a specific cell type due to IR. (a) Sham operated mice. (b) Mice
exposed to 45 minutes of ischemia at 32 °C and sacrificed 24hrs following reperfusion. Data are
representative of 3 separate experiments.
Figure 3) IDO-KO mice have improved kidney function subsequent to IR. C57BL/6 IDO-
KO and wild type age matched C57BL/6 mice were exposed to 45 minutes of ischemia at 32°C
and sacrificed 48 hours post reperfusion. a) Serum creatinine levels of IDO-KO mice compared
to WT mice, p = 0.008. b) Serum urea levels of IDO-KO mice compared to WT mice, p = 0.006.
Data are represented as mean ± SEM, n = 6 for IDO-KO, n = 9 for WT, and n = 4 for sham
operated mice.Page 23 of 32
23
Figure 4) IDO expression contributes to renal ischemia reperfusion injury. IDO expression
contributes to renal ischemia reperfusion injury: C57BL/6 wild type mice were pre-treated with
3mg of 1-MT dissolved in PBS or PBS alone 1 hour prior to 45 minutes of ischemia at 32°C.
Following reperfusion, the mice were injected IP with the same dosage, 1-MT or PBS alone,
twice a day for 48 hours a) Serum creatinine of 1-MT treated compared to PBS treated, p =
0.031. b) Serum urea levels of 1-MT treated compared to PBS treated, p = 0.036. Data are
presented as mean ± SEM (n = 10 for 1-MT, n = 11 for WT, and n = 4 for sham operated mice).
Figure 5) IDO-KO mice are resistant to renal IRI. IDO-KO mice are resistant to renal IRI.
C57BL/6 IDO-KO and wild type mice were exposed to 45 minutes of ischemia at 32°C and
sacrificed 48 hours post reperfusion. Kidneys were formalin fixed, paraffin embedded and
sections (5µm) were PAS stained. a) sham-operated, b) WT, and c) IDO-KO d) Tubular necrosis
and vacuolization score. Blinded scoring of 10 non-overlapping fields (400x) was performed and
averaged for WT and IDO-KO sections, p = 0.001. Images are representative of each group. Data
are presented as mean ± SEM (n = 6 for IDO-KO, n = 9 for WT, and n = 4 for sham operated
mice).
Figure 6) IDO expression contributes to renal ischemia reperfusion injury: C57BL/6 wild
type mice were pre-treated with 3mg of 1-MT dissolved in PBS or PBS alone 1 hour prior to 45
minutes of ischemia at 32 °C. Following reperfusion, the mice were injected IP with the same
amount of 1-MT or PBS alone, twice a day for 48 hours. Kidneys were formalin fixed, paraffin
embedded and sections (5µm) were PAS or H&E stained. a) sham-operated, b) PBS-control,Page 24 of 32
24
and c) 1-MT treated mice d) Tubular necrosis and vacuolization score. Blinded scoring of 10
non-overlapping fields (400x) were performed for PBS control and 1-MT treated mice, p =
0.002. Data are presented as mean ± SEM. (n = 10 for 1-MT, n = 11 for WT, and n = 4 for sham
operated mice).
Figure 7) IDO-KO kidneys have reduced infiltrate following IRI: a, b, c) H&E staining of
PBS control, 1-MT pre-ischemia treated and IDO-KO kidney sections was carried out to detected
infiltration. Images are representative for each group. n=8 for WT, n=7 for 1-MT, n=6 for IDO-
KO).
Figure 8) IDO-KO kidneys have reduced apoptosis in response to IRI. Kidney sections from
a) sham, b) WT, and c) IDO-KO mice were fixed, and cell death was determined by TUNEL
staining. d) Blinded scoring of 10 non-overlapping fields was performed and averaged for WT
and IDO-KO (400x), p = 0.03. Images are representative for each group. Data are presented as
mean ± SEM. (n = 6 for IDO-KO, n = 9 for WT).Page 25 of 32
Figure 1.0
a
IRI mRNA
0.5 1 2 4 24 sham (h)
IDO
GAPDH
IDO: GAPDH
Density ratio
b
IRI Protein
0.5 1 2 4 24 sham (h)
IDO
Total ERK
IDO: ERK
Density ratioPage 26 of 32
Figure 2.0
a bPage 27 of 32
Figure 3.0
a b
* p = 0.008 * p = 0.006Page 28 of 32
Figure 4.0
a b
* p = 0.031 * p = 0.036Page 29 of 32
Figure 5.0
d
60
Tubular necrosis/vac
p = 0.001
40
(%)
20
0
WT IDO-KOPage 30 of 32
Figure 6.0
d
p = 0.002
Tubular necrosis/vac
(%)Page 31 of 32
Figure 7.0
a b c
PBS control 1-MT IDO nullPage 32 of 32
Figure 8.0
a c
b d
p = 0.03You can also read
