Identification of a Mutation in the CHAT Gene of Old Danish Pointing Dogs Affected with Congenital Myasthenic Syndrome
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Journal of Heredity 2007:98(5):539–543 ª The American Genetic Association. 2007. All rights reserved.
doi:10.1093/jhered/esm026 For permissions, please email: journals.permissions@oxfordjournals.org.
Advance Access publication June 22, 2007
Identification of a Mutation in the CHAT
Gene of Old Danish Pointing Dogs
Affected with Congenital Myasthenic
Syndrome
HELLE FRIIS PROSCHOWSKY, ANNETTE FLAGSTAD, SUSANNA CIRERA, CLAUS B. JOERGENSEN, AND
Downloaded from https://academic.oup.com/jhered/article/98/5/539/2187876 by guest on 06 July 2022
MERETE FREDHOLM
From the Department of Animal and Veterinary Basic Sciences, Groennegaardsvej 3, the Royal Veterinary and Agricultural
University, 1870 Frederiksberg C, Denmark (Proschowsky, Cirera, Joergensen, and Fredholm); and the Department of
Small Animal Clinical Sciences, Dyrlaegevej 16, the Royal Veterinary and Agricultural University, 1870 Frederiksberg C,
Denmark (Flagstad).
Address correspondence to H. F. Proschowsky at the address above, or e-mail: hfp@kvl.dk.
Abstract
The presence of a recessive inherited muscle disease in Old Danish Pointing Dogs has been well known for years. Compar-
isons of this disease with myasthenic diseases of other dog breeds and humans have pointed toward a defect in the synthesis of
the neurotransmitter acetylcholine possibly due to decreased activity of the enzyme choline acetyltransferase. We sequenced
exons 5–18 of the gene encoding choline acetyltransferase (CHAT ) in 2 affected and 2 unaffected dogs and identified a G to
A missense mutation in exon 6. The mutation causes a valine to methionine substitution and segregates in agreement with the
inheritance of the disease. The mutation was not detected in 50 dogs representing 25 other dog breeds. A DNA test has been
developed and is now available to the breeders of Old Danish Pointing Dogs.
An autosomal recessive neuromuscular transmission defect Pointing Dogs (Engel AG, personal communication). In
known as congenital myasthenic syndrome (CMS) has been most cases of myasthenic diseases, the administration of anti-
observed in the Danish dog breed Old Danish Pointing Dog cholinesterases have a dramatic effect on generalized weak-
since 1977 (Flagstad 1982). Affected dogs are able to run nor- ness, and daily oral treatment improves the condition
mally for 5–30 min after which they take shorter and shorter (Johnson et al. 1975; Miller et al. 1983; Dickinson et al.
strides and eventually fall down with flexed fore- and hind- 2005). Neither edrophonium nor neostigmine administered
legs. After some minutes rest, they are able to walk and run intravenously during attacks of weakness or prolonged oral
again for variable periods of time before the signs reappear. neostigmine treatment were shown to have any clinical or
Myasthenic diseases are usually referred to as either acquired electrophysiological effect on affected Old Danish Pointing
or congenital myasthenia gravis. The acquired myasthenia Dogs (Flagstad et al. 1989).
gravis is an autoimmune disease characterized by circulating The diagnosis of the CMS in Old Danish Pointing Dogs
autoantibodies directed toward the acetylcholine receptors has been based on an electrophysiological test to examine
(Drachman et al. 1978). No antibodies toward acetylcholine neuromuscular function using repetitive stimulation. The
receptors have been detected in the plasma of affected Old electrophysiological test showed a myasthenic decrement us-
Danish Pointing Dogs, thus distinguishing the syndrome ing 3-Hz stimulation also seen in acquired and congenital my-
from the acquired form (Flagstad et al. 1989). In the congen- asthenia gravis. However, the decrement at 3 Hz did not
ital myasthenia gravis, there is a decreased number of acetyl- occur until fatigue had been induced by a long stimulation
choline receptors as demonstrated in smooth fox terriers train. (Trojaborg and Flagstad 1982). A similar stimulation
(Jenkins et al. 1976), Jack Russel terriers (Wallace and Palmer technique is necessary to demonstrate a myasthenic decrease
1984), and smooth-haired miniature dachshunds (Dickinson in humans affected with congenital myasthenic syndrome
et al. 2005). In contrast to this, a normal number of acetyl- with episodic apnea (CMS-EA) (Engel and Sine 2005). Also,
choline receptors have been shown in affected Old Danish the synthesis of acetylcholine has been evaluated in
539Journal of Heredity 2007:98(5)
Materials and Methods
A G A G A G
Animals and Diagnostics
Three litters of Old Danish Pointing Dogs comprising 5 pa-
rental animals and 13 offspring were included in the study
(Figure 1). All animals were diagnosed affected or unaffected
by an electrophysiological examination as previously de-
A A A A A G A G G G A A A A G G A G scribed (Flagstad 1993). The 13 offspring were distributed
as 6 affected and 7 unaffected. Additional animal material
comprised 50 dogs representing 25 different dog breeds.
A G A G
DNA Extraction and Sequence Analysis
Ethylenediaminetetraacetic acid–stabilized blood from all
Downloaded from https://academic.oup.com/jhered/article/98/5/539/2187876 by guest on 06 July 2022
individuals was available, and DNA was extracted using a salt-
ing-out protocol (Miller et al. 1988). The human CHAT gene
A A A A A G G G has been mapped to HSA10q11.2 (Viegas-Pequignot et al.
1991). A BLASTN search with the human mRNA sequence
against the canine genome showed the highest identity to
Figure 1. Three litters of Old Danish Pointing dogs CFA28 (96% identity, Genbank accession number
segregating for CMS. Squares represent males and circles NW_876285.1). The CHAT gene consists of 18 exons;
represent females. Affected animals are indicated with filled R, N, M, S, and 5–18. Translation of the first 4 exons has
symbols. The genotype of the G to A polymorphism in exon 6 not been described in animals, but a transcript including exon
is indicated for each individual. M and S have been amplified from a human spinal cord
cDNA library (Ohno et al. 2001). Human sequence (Gen-
bank accession numbers AF305895–AF305906) was used
myasthenic, clinically normal heterozygous, and unaffected to localize the exons in the canine genome, and primers
control dogs. This study indicated that the synthesis of ace- for each exon were subsequently designed from intron se-
tylcholine in affected Old Danish Pointing Dogs was de- quence. The primers were located within a distance of ap-
creased compared with the other groups (Flagstad A, in proximately 75–100 bp from the exons and all donor and
preparation). All these results point to a presynaptic defect acceptor splice sites were sequenced. Primer sequences
related to synthesis of acetylcholine in affected Old Danish and locations are listed in Table 1. Exons 5–18 representing
Pointing Dogs. The best characterized presynaptic defect in the translated parts of the canine CHAT gene were polymer-
humans is caused by mutations in choline acetyltransferase ase chain reaction (PCR) amplified in 2 affected and 2 unaf-
(CHAT ), the gene encoding the enzyme choline acetyltrans- fected dogs. Each reaction consisted of 25 ll containing
ferase, resulting in impaired resynthesis of acetylcholine 2 ll of genomic DNA, 10 pmol of each primer, 1.5 mM
(Maselli et al. 2001; Ohno et al. 2001). In the present study, MgCl2 (2.5 mM MgCl2 for exon 15 and 16), and 0.5 units of
the canine ortholog of the human CHAT gene was se- TEMPase Hot Start DNA polymerase (Ampliqon/Bie &
quenced in affected and unaffected Old Danish Pointing Berntsen A-S, Herlev, Denmark). The cycling conditions
Dogs and searched for polymorphisms. were 1 cycle of denaturation at 95 C/10 min, followed by
Table 1. Sequences of primers used for amplification and sequencing exon 5–18 of the canine CHAT gene. The position of each primer
in megabases is referring to the canis familiaris chromosome 28 genomic contig, whole-genome shotgun sequence, NW_876285.1, build 2.1.
Position of primers,
Exon number Forward primer Reward primer forward–reward
5 AGATTGGGACCTGCAGTGAG CTTCATGCCCAAGAGAGGAC 1.481.086–1.481.482
6 TGATGGAGACACCAACTGGA CTTACCTGCCCTTCATCCAA 1.483.344–1.483.770
7 ATGGGACTGGCACTCTTCAC CTCTGTCTCAGGGGCATTTG 1.484.321–1.484.663
8 CTTGTGAAAGACTGGCAGCA GGAGTCTACCTGCCCTGTGA 1.485.772–1.486.118
9 GTGGCTCTTTGACTGCCATC TCACTGAGTGCCTCCAAGG 1.487.366–1.487.771
10 AGGTCCCCAACTTGTGACTG CTATGGCAAATGGGGATGAG 1.489.524–1.489.950
11 CCACTGGATTTGGGAGAGAA ACATTTCCAGTGCCTTCAGC 1.508.660–1.509.084
12 CTCAGGTCATGGCAATTTCA CCACCCACATTTTTCTTGGT 1.511.369–1.511.734
13 TGAAGCTCCACCAGCTAGGA TGATGGAGACCTCTGCAATG 1.512.440–1.512.877
14 CCGTGTCCTCGAGAGTCATA AAAGTCGTTCCTCCCTCCAG 1.514.999–1.515.329
15 and 16 GCCTGCAGAGGCTATTTTTC TATGCCTGCAGATCCAGCTT 1.518.077–1.518.585
17 AAGCTGTGGCCCTAGCAGTA AGCCAGTGGGCTGTAGTCAC 1.525.075–1.525.430
18 AGGCCTCAGGGTCATTGAA GCCTCAGTGTGGTCTCTGTG 1.526.982–1.527.482
540Proschowsky et al. Congenital Myasthenic Syndrome in Old Danish Pointing Dogs
Downloaded from https://academic.oup.com/jhered/article/98/5/539/2187876 by guest on 06 July 2022
Figure 2. Alignment of the amino acid sequence of human 83-kDa ChAT and of dog, pig, mouse, and rat ChAT. Dots indicate
residues identical to the human ChAT. The position of the valine that is exchanged with a methionine in the affected dogs is
indicated with an arrowhead.
541Journal of Heredity 2007:98(5)
35 three-segment cycles of amplification (95 C/30 s, 55 C/ dogs were homozygous for the normal allele or heterozygous
30 s, 72 C/30 s), and a final extension cycle at 72 C/10 min. carriers. The mutation was not identified in any of 25 other
The PCR products were purified by Qiaquick PCR purification dog breeds. The single-base substitution resulted in a methi-
kit (Qiagen, West Sussex, UK) and, subsequently, sequenced onine residue instead of a valine residue. At least 14 different
on both strands. The same PCR primers and a BigDye ter- mutations have been identified in the CHAT gene of human
minator sequencing system were used according to the man- patients with CMS-EA (Ohno et al. 2001; Kraner et al. 2003;
ufacturers recommendations (Applied Biosystems, Foster Maselli et al. 2003; Schmidt et al. 2003). Two of the mutations
City, CA). After ethanol precipitation, the sequencing products abolish ChAT expression either through a frameshift muta-
were run on an ABI3130XL (Applied Biosystems). tion or through insertion of a stop codon. The other 12 muta-
The generated trace files were base called and quality tions affect expression levels or kinetic parameters. A
checked using PHRED (Ewing et al. 1998). Subsequentley, frequently reported effect is an increase of the Michaelis–
the sequences were assembled into contigs using PHRAP Menten constant (Km) of ChAT leading to decreased affinity
(http://www.phrap.org/) and viewed using CONSED between enzyme and substrate (Ohno et al. 2001; Cai et al.
(Gordon et al. 1998). The amino acid sequence of the 2004). The 3-dimensional structure of the ChAT protein with
Downloaded from https://academic.oup.com/jhered/article/98/5/539/2187876 by guest on 06 July 2022
canine ChAT protein was obtained by translating each the position of 12 human mutations have been published (Cai
exon in OPEN READING FRAME FINDER (http:// et al. 2004). With respect to the 3-dimensional structure, the
www.ncbi.nlm.nih.gov/), and a sequence alignment of the closest human mutations are V194L (Maselli et al. 2003),
ChAT proteins from human, dog, pig, mouse, and rat was E441K, and R560H (Ohno et al. 2001). All 3 human muta-
performed using CLUSTALW (http://www.ch.embnet.org/ tions alter the acetylcoenzyme A or choline-binding sites (Cai
cgi-bin/clustalw_parser) and BOXSHADE (http://www.ch. et al. 2004), but further studies have to be carried out to con-
embnet.org/software/BOX_form.html). In addition, all the firm or disconfirm a similar effect of the canine mutation on
sequences containing the exons with some surrounding in- enzyme-substrate binding.
tron sequences were blasted against the public available ge- A routine test for genotyping has been developed using a
nomic Boxer sequence at National Center for Biotechnology TaqMan SNP assay (Roche Molecular Systems Inc., Alameda,
Information (http://www.ncbi.nlm.nih.gov/) to identify CA), and the test is now offered to the Danish breeders of Old
possible single-nucleotide polymorphisms (SNPs). Danish Pointing Dogs. Testing the dogs before breeding is
essential in order to avoid mating between heterozygous car-
riers. Previously, a breeding program was based on carrier
Results detection using the electrophysiological test (Flagstad et al.
Only one polymorphism was identified in the exon sequence 1993). With the development of a DNA test, the diagnostic
of the 2 affected and 2 unaffected Old Danish Pointing Dogs. procedure has become cheaper, easier to perform, and more
It was a G to A substitution in exon 6 of the 2 affected dogs accurate with respect to detection of carriers. The Old Danish
leading to a valine to methionine exchange at position 29 of Pointing Dog is one of the national Danish dog breeds; thus,
the protein. The 18 animals shown in Figure 1 were the Danish breeders feel a special obligation to keep the breed
subsequently genotyped. All affected dogs in the 3 litters were healthy. The breed is numerically small and has gone through
homozygous for the mutation, and the parents were hetero- a severe bottleneck around 1950. In addition, it is not possible
zygous carriers. Both homozygotes for the normal allele and to import new breeding animals from other countries. In con-
heterozygous carriers were identified among the healthy lit- cordance with the experience from introducing a DNA-based
termates. A total of 50 dogs representing 25 different dog breeding program in Danish Bedlington terriers (Proschowsky
breeds were genotyped with respect to the mutation, but et al. 2003), and to avoid a dramatic reduction of the number
it was not identified in any of these breeds. Two intronic of available breeding dogs, the Danish breeders association of
polymorphisms were identified in the Old Danish Pointing Old Danish Pointing Dogs have decided to include heterozy-
Dog sequence compared with the Boxer sequence. The SNPs gous carriers for controlled matings with homozygous normal
were located in intron 9 at position 1.487.690 (T in Old Dan- individuals for a period of time.
ish Pointing Dog and C in Boxer) and intron 11 at position
1.511.606 (A in Old Danish Pointing Dog and G in Boxer). Funding
The SNPs were not related to splice sites or branch sites. An
alignment of the amino acid sequence of ChAT from human, Carsten Breboel Foundation; Danish breeders association of
dog, pig, mouse, and rat is shown in Figure 2. Old Danish Pointing Dogs.
Discussion Acknowledgments
The authors thank Majken Madvig Jansen for excellent technical assistance.
In the present study, we sequenced the canine CHAT gene
and report the amino acid sequence of the canine ChAT pro-
tein. We identified a mutation in exon 6, position 29, of the References
CHAT gene that may be causative for CMS in Old Danish Cai YY, Cronin CN, Engel AG, Ohno K, Hersh LB, Rodgers DW. 2004.
Pointing Dogs. All the affected Old Danish Pointing Dogs Choline acetyltransferase structure reveals distribution of mutations that
were homozygous for the mutation, whereas all unaffected cause motor disorders. EMBO J. 23:2047–2058.
542Proschowsky et al. Congenital Myasthenic Syndrome in Old Danish Pointing Dogs
Dickinson PJ, Sturges BK, Shelton GD, LeCouteur RA. 2005. Congenital Maselli RA, Kong DZ, Bowe CM, McDonald CM, Ellis WG, Agius MA,
myasthenia gravis in smooth-haired miniature dachshund dogs. J Vet Intern Gomez CM, Richman DP, Wollmann RL. 2001. Presynaptic congenital
Med. 19:920–923. myasthenic syndrome due to quantal release deficiency. Neurology. 57:
Drachman DB, Angus CW, Adams RN, Michelson JD, Hoffman GJ. 1978. 279–289.
Myasthenic antibodies cross-link acetylcholine receptors to accelerate degra- Miller LM, Lennon VA, Lambert EH, Reed SM, Hegreberg GA, Miller JB,
dation. N Engl J Med. 298:1116–1122. Ott RL. 1983. Congenital myasthenia gravis in 13 smooth fox terriers. J Am
Engel AG, Sine SM. 2005. Current understanding of congenital myasthenic Vet Med Assoc. 182:694–697.
syndromes. Curr Opin Pharmacol. 5:308–321. Miller SA, Dykes DD, Polesky HF. 1988. A Simple salting out procedure
Ewing B, Hillier L, Wendl MC, Green P. 1998. Base-calling of automated se- for extracting DNA from human nucleated cells. Nucleic Acids Res.
quencer traces using phred. I. Accuracy assessment. Genome Res. 8:175–185. 16:1215.
Flagstad A. 1982. A New hereditary neuromuscular disease in the dog breed Ohno K, Tsujino A, Brengman JM, Harper CM, Bajzer Z, Udd B, Beyring R,
Gammel Dansk Honsehund—Genetic investigations. Hereditas. 96:211–214. Robb S, Kirkham FJ, Engel AG. 2001. Choline acetyltransferase mutations
Flagstad A. 1993. Development of the electrophysiological pattern in con- cause myasthenic syndrome associated with episodic apnea in humans. Proc
genital myasthenic syndrome. Prog Vet Neurol. 4:126–134. Natl Acad Sci USA. 98:2017–2022.
Downloaded from https://academic.oup.com/jhered/article/98/5/539/2187876 by guest on 06 July 2022
Flagstad A, Jensen AL, Trojaborg W. 1993. Detection of canine congenital Proschowsky HF, Olsen JB, Jepsen B, Fredholm M. 2003. Evaluation of the
myasthenic syndrome carriers by an electrophysiological test. Life Sci Adv present breeding programme against copper toxicosis in Danish Bedlington
Genet. 12:17–25. terriers. Anim Genet. 34:142–145.
Flagstad A, Trojaborg W, Gammeltoft S. 1989. Congenital myasthenic syn- Schmidt C, Abicht A, Krampfl K, Voss W, Stucka R, Mildner G, Petrova S,
drome in the dog breed Gammel Dansk Honsehund: clinical, electrophys- Schara U, Mortier W, Bufler J, et al. 2003. Congenital myasthenic syndrome
iological, pharmacological and immunological comparison with acquired due to a novel missense mutation in the gene encoding choline acetyltrans-
myasthenia gravis. Acta Vet Scand. 30:89–102. ferase. Neuromuscul Disord. 13:245–251.
Gordon D, Abajian C, Green P. 1998. Consed: a graphical tool for sequence Trojaborg W, Flagstad A. 1982. A hereditary neuromuscular disorder in dogs.
finishing. Genome Res. 8:195–202. Muscle Nerve. 5:S30–S38.
Jenkins WL, van Dyk E, McDonald CB. 1976. Myasthenia gravis in a fox Viegas-Pequignot E, Berrard S, Brice A, Apiou F, Mallet J. 1991. Localization
terrier litter. J S Afr Vet Assoc. 47:59–62. of a 900-bp-long fragment of the human choline acetyltransferase gene to
Johnson RP, Watson AD, Smith J, Cooper BJ. 1975. Myasthenia in springer 10q11.2 by nonradioactive in situ hybridization. Genomics. 9:210–212.
spaniel littermates. J Small Anim Pract. 16:641–647. Wallace ME, Palmer AC. 1984. Recessive mode of inheritance in myasthenia
Kraner S, Laufenberg I, Strassburg HM, Sieb JP, Steinlein OK. 2003. Con- gravis in the Jack Russell terrier. Vet Rec. 114:350.
genital myasthenic syndrome with episodic apnea in patients homozygous This paper was delivered at the 3rd International Conference on
for a CHAT missense mutation. Arch Neurol. 60:761–763. the Advances in Canine and Feline Genomics, School of Veterinary
Maselli RA, Chen D, Mo D, Bowe C, Fenton G, Wollmann RL. 2003. Cho- Medicine, University of California, Davis, CA, August 3–5, 2006.
line acetyltransferase mutations in myasthenic syndrome due to deficient ace-
tylcholine resynthesis. Muscle Nerve. 27:180–187. Corresponding Editor: Urs Giger
543You can also read
