GENETIC POLYMORPHISMS OF GNRH AND GONADOTROPHIC HORMONE RECEPTORS AFFECT THE PHENOTYPE OF POLYCYSTIC OVARY SYNDROME
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Human Reproduction, Vol.24, No.8 pp. 2014– 2022, 2009
Advanced Access publication on April 29, 2009 doi:10.1093/humrep/dep113
ORIGINAL ARTICLE Reproductive genetics
Genetic polymorphisms of GnRH and
gonadotrophic hormone receptors
affect the phenotype of polycystic
ovary syndrome
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
O. Valkenburg 1,5, A.G. Uitterlinden 2,3, D. Piersma 2, A. Hofman 3,
A.P.N. Themmen 2, F.H. de Jong 2, B.C.J.M. Fauser 4, and J.S.E. Laven 1
1
Division of Reproductive Medicine, Department of Obstetrics and Gynaecology, Erasmus MC, University Medical Center, Room HS508,
P.O. Box 2040, 3000 CA Rotterdam, The Netherlands 2Department of Internal Medicine, Erasmus MC, University Medical Center,
Rotterdam, The Netherlands 3Department of Epidemiology, Erasmus MC, University Medical Center, Rotterdam, The Netherlands
4
Department of Reproductive Medicine and Gynaecology, University Medical Center, Utrecht, The Netherlands
5
Correspondence address. Tel: þ31-10-4633571; E-mail: o.valkenburg@erasmusmc.nl
background: Polycystic ovary syndrome (PCOS) is a complex genetic disorder. Multiple functional polymorphisms have been ident-
ified in genes that regulate the hypothalamic –pituitary– gonadal (HPG) axis that regulates ovarian function. The present study aims to
examine the influence of genetic variants of the HPG-axis on the severity of clinical features of PCOS and disease susceptibility.
methods: We included 518 Caucasian PCOS women and 2996 unselected controls from the general population (the Rotterdam study).
Genotype distributions were compared between patients and controls. Subsequently, associations with clinical features of PCOS were
studied. Single nucleotide polymorphisms were selected in GnRH (Trp16Ser [rs6185]), the FSH-receptor (FSHR, Ala307Thr [rs6165] and
Asn680Ser [rs6166]) and the LH-receptor (18insLQ, Asn291Ser [rs12470652] and Ser312Asn [rs2293275]).
results: FSHR Ser680 was associated with higher levels of gonadotrophic hormones (FSH: P , 0.01, LH: P ¼ 0.01), and testosterone
(P ¼ 0.05) and a higher frequency of hyperandrogenism (P ¼ 0.04). No differences in risk for PCOS in association with the FSH-receptor
variants were observed.
conclusion: Genetic variants of the HPG-axis were associated with a modest but significant effect on the phenotype of PCOS. FSHR
variants were strongly associated with the severity of clinical features of PCOS, such as levels of gonadotrophic hormones and the presence
of hyperandrogenism, but not disease risk.
Key words: polycystic ovary syndrome / FSH receptor / LH receptor / GnRH / polymorphism
pathogenesis of PCOS is not fully understood. Although an intrinsic
Introduction abnormality of the hypothalamic GnRH pulse generator in women
Polycystic ovary syndrome (PCOS) is a common endocrinopathy that with PCOS has been proposed in the past (Zumoff et al., 1983;
occurs in 5–8% of women of reproductive age (Azziz et al., 2004). Venturoli et al., 1992), more recent evidence suggests that this
PCOS constitutes a syndrome of ovarian dysfunction characterized should be regarded as a secondary phenomenon due to disturbed
by anovulation, hyperandrogenism and polycystic ovary (PCO) mor- feedback at the level of the hypothalamus (Chhabra et al., 2005).
phology. PCOS is associated with alterations in the function of the Notwithstanding the uncertainty with regard to the role of the
hypothalamic –pituitary –gonadal (HPG) axis that may result from HPG-axis in the pathogenesis of PCOS, this pathway does play a
increased frequency and amplitude of the hypothalamic GnRH pulse central role in the pathophysiology of the syndrome. Therefore, we
generator (Dalkin et al., 1989). Changes in the secretion of gonado- hypothesized that common genetic variants of the HPG-axis may
trophic hormones consist of elevated LH levels in combination with affect the phenotype of PCOS and possibly disease susceptibility.
normal serum FSH concentrations (Yen et al., 1970). However, the A number of functional single nucleotide polymorphisms (SNPs)
extent to which changes in the HPG-axis contribute to the have been described in genes that are involved in the HPG-axis.
& The Author 2009. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: journals.permissions@oxfordjournals.orgGene polymorphisms and polycystic ovary syndrome 2015
GnRH1 is an important candidate gene for delayed puberty and Subjects and Methods
idiopathic hypogonadotrophic hypogonadism. Thus far, no major
defects within GnRH1 have been found in these patients (Sedlmeyer Subjects and phenotyping
et al., 2005; Vagenakis et al., 2005). However, a polymorphism in
Anovulatory subjects attended our infertility outpatient clinic between
the first exon of GnRH1 has been described, constituting an amino
1994 and 2004. Inclusion criteria were oligomenorrhea (interval
acid variation at codon 16 (Trp16Ser). This genetic variant has been
between consecutive menstrual periods .35 days) or amenorrhea
examined recently in two studies focusing on clinical end-points in
(absence of vaginal bleeding for at least 6 months) and serum FSH con-
relation to altered estrogen exposure. Rather contradictory, the
centrations within normal range (1–10 IU/l) (van Santbrink et al., 1997;
results of these studies were consistent with both decreased exposure
Schipper et al., 1998). The diagnosis of PCOS was established on the
to endogenous estrogens (decreased bone mineral density Iwasaki
basis of the 2003 European Society for Human Reproduction and
et al., 2003), as well as increased estrogen exposure (shorter disease-
Embryology/American Society for Reproductive Medicine Rotterdam
free survival in breast cancer patients Piersma et al., 2007a). However,
criteria (2004). In agreement with these criteria hyperandrogenism
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
direct assessment of estrogen exposure was not reported in either
was defined as the presence of either biochemical or clinical signs of
study.
androgen excess. For the purpose of this study clinical hyperandrogen-
A well-known combination of two polymorphisms in the FSH
ism was assessed by means of the Ferriman Gallway (FG) score, and
receptor (FSHR) gene has been of particular interest with regard to
was defined as FG-score 8. Biochemical hyperandrogenism was
PCOS. Both polymorphisms, which are in near total linkage-
determined by calculation of the free androgen index (FAI) as: (Testo-
disequilibrium, have been identified as coding SNPs at codon-positions
sterone [nmol/l]/sex hormone-binding globulin [(SHBG)nmol/l]) *
307 and 680 in exon 10 (Simoni et al., 1999). This exon covers the
100. A cutoff level of 4.5 was used for the definition of hyperandrogen-
signal transducing transmembrane domain. It was shown that the pres-
ism (van Santbrink et al., 1997). The presence of PCO was detected by
ence of the minor allele at position 680 (Ser680) is associated with sig-
vaginal ultrasound examination. PCO was defined as the presence of
nificantly higher basal FSH levels and altered response to ovarian
12 follicles in one or both ovaries, and/or increased ovarian
stimulation using exogenous FSH for IVF (Perez Mayorga et al.,
volume (.10 ml) (Balen et al., 2003). Ethnicity and country of birth
2000). A subsequent comparison of allele frequencies in normogona-
were registered. Exclusion criteria were non-Caucasian ethnic origin
dotrophic anovulatory patients and controls showed a higher fre-
and/or the presence of related disorders with similar clinical presen-
quency of Ser680 in anovulatory subjects (Laven et al., 2003).
tation, such as congenital adrenal hyperplasia and Cushing’s syndrome.
However, the presence of this allele did not negatively affect the
Controls were derived from the Rotterdam study. The design of
chances of success for ovulation induction using recombinant FSH.
this study has been described previously (Hofman et al., 1991,
Apparently, although the Ser680 allele is associated with a less respon-
2007). In short, this is a single-center, prospective, population based
sive FSH receptor, its influence can be overcome relatively easily by
study of determinants of chronic disabling diseases in the elderly,
the administration of exogenous FSH.
aged 55 years and over (n ¼ 7012). Participants from the Rotterdam
Like FSH, multiple polymorphisms have been described in the LH
study derive from a specific area near Rotterdam (Ommoord) that
receptor (LHR) that are associated with altered LHR functionality.
constitutes a homogeneous population-based sample of Caucasian
LHR is overexpressed in theca cells from PCOS patients (Jakimiuk
elderly men and women. All women with age at onset of menopause
et al., 2001). LH promotes the secretion of androgens by ovarian
.45 years and available DNA (n ¼ 2996) were included in the
theca cells, which may result in follicular maturation arrest (Laven
present analysis. Written informed consent was obtained from all ano-
et al., 2002). An insertion of two amino acids (leucine [L] and gluta-
vulatory patients as well as controls. This study was approved by the
mine [Q]) in the signal peptide of LHR (18insLQ) was shown in vitro
institutional review board at the ErasmusMC Medical Center.
to result in increased receptor activity (Piersma et al., 2006). The
18insLQ insertion polymorphism was also associated with shorter
disease-free survival in breast cancer patients (Powell et al., 2003; Hormones
Piersma et al., 2006). In addition, exon 10 of LHR contains two Anovulatory patients underwent a standardized initial screening that
coding SNPs that cause a change in amino acids (Asn291Ser and was performed after an overnight fasting period on a random
Ser312Asn). Although in vitro the Asn291Ser polymorphism was cycle-day between 9 a.m. and 11 a.m. Clinical examination included
associated with increased receptor sensitivity, this variant was not a structured interview and physical examination. Transvaginal ultraso-
associated with tumor characteristics or survival of breast cancer nography was performed in order to assess ovarian volume and follicle
patients (Piersma et al., 2007b). A slightly higher frequency of the count for both ovaries. Blood samples were drawn on the day of clini-
Asn312 allele was noted among breast cancer patients, possibly cal examination and processed within 2 h after withdrawal. Serum was
because of increased action of ovarian steroid hormones (Piersma stored at 2208C until assayed. Endocrine evaluation included serum
et al., 2007b). In a different study in men, a lower frequency of the levels of gonadotrophic hormones (LH, FSH) and estradiol (E2), tes-
Asn312 allele was found in association with impaired spermatogenesis tosterone, androstenedione (AD), dehydroepiandrosterone (DHEA)
(Simoni et al., 2008b), further substantiating the hypothesis of and dehydroepiandrosterone sulfate (DHEAS), progesterone and
increased receptor activity in association with this polymorphism. 17-hydroxyprogesterone (17-OHP), SHBG, fasting glucose and
The present analysis of functional polymorphisms of the HPG insulin, thyrotropin (TSH) and prolactin. Hormone assays have been
pathway in patients with PCOS examines the extent to which these described in detail elsewhere (Imani et al., 1998). LH, FSH, TSH,
subtle genetic variations affect the severity of clinical features of SHBG, progesterone, AD, DHEA, prolactin and insulin were
PCOS and disease susceptibility. measured by immunoradiometric assay (Immulitew platform,2016 Valkenburg et al.
Diagnostic Products Corporation, Breda, the Netherlands). Testoster- Statistical analysis
one and E2 were determined by radioimmunoassay (RIA, Diagnostic
Genotype and allele frequencies were determined for all polymorph-
Products Corporation) and 17-OHP was determined using an
isms and subsequently tested for Hardy–Weinberg equilibrium
in-house assay. Intra- and inter-assay coefficients of variation were
(HWE). Calculation of linkage disequilibrium (D0 ) and correlation
,5 and ,15% for LH, ,3 and ,8% for FSH, ,3 and ,5% for tes-
(r 2) between multiple SNPs in the same gene was performed using
tosterone, ,8 and ,11% for AD, ,5 and ,7% for E2 and ,4 and
the EMLD software package (https://epi.mdanderson.org/,qhuang/
,5% for SHBG, respectively. Anti-Mullerian hormone (AMH) levels
Software/pub.htm). LHR haplotypes were inferred on the basis of
were determined in a subgroup of 354 patients using an in-house
Bayesian linkage disequilibrium analyses (Stephens et al., 2001).
double-antibody enzyme-linked immunosorbent assay (ELISA). Intra-
Genotype frequency comparisons were conducted using logistic
and inter-assay coefficients of variation were ,10 and ,5%, respect-
regression analysis. P 0.05 was considered statistically significant.
ively. Glucose levels were measured using a Hitachiw 917 analyzer
Odds ratios (OR) and 95% confidence intervals (CI) were calculated
(Roche Diagnostics, Almere, the Netherlands).
to assess risk. For the cross-sectional analysis of anthropometric
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
data, medians and ranges were computed and compared between
Genotyping the different genotypes. Variables were checked for normal distri-
butions with the one-sample Kolmogorov–Smirnov test and log-
Genomic DNA was extracted from peripheral venous blood according
transformed when necessary. Analysis of variance was used to test
to standard procedures. Genotypes were determined using the
for differences between genotype groups and Bonferroni’s correction
Taqman allelic discrimination assay. The Assay-by-Design service
was used to adjust for the number of SNPs tested. In order to test for
(www.appliedbiosystems.com) was used to set up a Taqman allelic
allele-dose effects, the between group variation was tested for linear
discrimination assay for the FSHR Asn680Ser, GnRH1 Ser16Trp,
association. Statistical analysis was performed using a commercially
LHR Asn291Ser and LHR Ser312Asn polymorphisms. Rs numbers,
available software package (Statistical Package for the Social Sciences
primer and probe sequences are provided in Table I. The PCR reac-
version 12; SPSS Inc., Chicago, USA).
tion mixture included 2 ng of genomic DNA in a 2 ml volume and the
following reagents: probes (200 nM), primers (0.9 mM), 2 Taqman
PCR master mixes (ABgene, Epsom, UK). PCR cycling reactions Results
were performed on an ABI 9700 PCR system (Applied Biosystems
Inc., Foster City, CA, USA) and consisted of initial denaturation at Subjects
958C (15 min), and 40 cycles with denaturation (15 s at 958C) and From a total of 580 normogonadotrophic anovulatory women, 518
annealing and extension (60 s at 608C). women were diagnosed with PCOS. Hyperandrogenism was present
In addition, all PCOS patients and a sub-set of 2419 controls were in 51% of all anovulatory women although PCO was present in 81%
genotyped for a six base pair insertion polymorphism in exon 1 of LHR of subjects. Baseline characteristics, endocrine and ultrasound par-
(LHR insLQ). Exon 1 was amplified as described by Atger and col- ameters of the study group are shown in Table II.
leagues (1995) using a 50 -hexachlorofluorescein-labeled forward
primer. Separation and sizing of the PCR fragments and assignment Genotyping
of LHR insLQ genotype was performed on an ABI Prism 3100 auto- All polymorphisms were in HWE within the PCOS population and
mated capillary DNA sequencer using Genescan and Genotyper soft- controls, except for LHR Asn291Ser in the control population. Homo-
ware packages (Applied Biosystems Inc., Foster City, CA, USA). zygosity for the presence of the minor allele (Ser291) at this locus did
Table I Primers and probe sequences used in the study of polymorphisms in PCOS women and controls
Gene variant Rs number PCR primers Taqman probes
.............................................................................................................................................................................................
GNRH1
Ser16Trp rs6185 Fw AATTCAAAAACTCCTAGCTGGCCTTA VIC CACGCACCAAGTCA
Rv CATAGGACCAGTGCTGGCT FAM ACGCACGAAGTCA
FSHR
Ala307Thr rs6165 Fw GCAACAAATCTATTTTAAGGCAAGAAGTTGA VIC TGACCCCTAGTCTGAGTC
Rv TGTCTTCTGCCAGAGAGGATCT FAM ACCCCTAGCCTGAGTC
Asn680Ser rs6166 Assay on demand (Applied Biosystems, C_2676874_10)
LHR
Asn291Ser rs12470652 Fw CTGAAGTCCAAAAGCTCAAATGCT VIC CAGACAGAATTTTTC
Rv TGTGCTTTCACATTGTTTGGAAAAGT FAM CAGACAGAGTTTTTC
Ser312Asn rs2293275 Fw TTTTCCAAACAATGTGAAAGCACAGT VIC TTACAGTGTTTTGTTATTCACTT
Rv GATACGACTTCTGAGTTTCCTTGCA FAM CAGTGTTTTGTTACTCACTT
FSHR: FSH receptor, LHR: LH receptor.Gene polymorphisms and polycystic ovary syndrome 2017
Table II Clinical and endocrine parameters of 518
FSH receptor
Caucasian women with PCOS In 399 PCOS cases, linkage disequilibrium (D0 ) for the two SNPs in
exon 10 of FSHR (Ala307Thr and Asn680Ser) was 0.98 (r 2 ¼ 0.94),
Median Interquartile range indicating near-complete linkage disequilibrium. All remaining PCOS
........................................................................................
cases and controls were genotyped for the Asn680Ser polymorphism
Baseline characteristics and ultrasound parameters
only. The frequency of the minor allele (Ser680) and the distribution of
Age (years) 28.7 (25– 31.7)
genotypes at this locus were similar in women with PCOS and con-
BMI (kg/m2) 26.2 (22.4– 31.2)
trols (Table III).
Mean number of folliclesa 18 (13– 25) There was a strong association of this FSHR polymorphism with
Mean ovarian volume (ml)a 8.8 (6.5–11.6) phenotypic characteristics of PCOS patients. The Ser680 allele was
Endocrine parameters associated with higher levels of gonadotrophic hormones: FSH
LH (IU/l) 7.6 (4.9–11.4) (0.6 IU/l increase per allele copy, P 0.01) and LH (1.1 IU/l increase
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
FSH (IU/l) 4.9 (3.6–6.4) per allele copy, P 0.01) (Table IV). Likewise, the Ser680 allele was
Estradiol (pmol/l) 231 (169– 345) associated with a higher frequency of hyperandrogenism (OR [per
Progesterone (nmol/l) 1.6 (1.0–2.9) minor allele copy] 1.41 [95% CI 1.09 –1.82], P ¼ 0.04) ranging from
17 (OH) Progesterone (nmol/l) 2.6 (1.9–4.0) 53.7% among non-carriers to 70.2% among homozygous carriers of
Testosterone (nmol/l) 1.9 (1.4–2.4)
the Ser680 allele.
SHBG (nmol/l) 37 (25– 57)
FAI 5.0 (2.9–8.2)
LH receptor
AD (nmol/l) 11.8 (9.2–15.1 MAF for the insertion polymorphism at codon 18 of exon 1 (insLQ) in
PCOS subjects and controls were 24.9 and 28.0%, respectively (P ¼
DHEA (nmol/l) 40 (28– 59)
0.04). Genotype frequency comparisons revealed a significant negative
DHEAS (mmol/l) 5.1 (3.6–7.1)
association of the minor allele (LHR 18insLQ) with PCOS, showing
Glucose (mmol/l) 4.0 (3.7–4.4)
15% lower risk for PCOS per minor allele copy (OR 0.85 [95% CI
Fasting insulin (pmol/l) 58 (38– 91)
0.73 –0.99], P ¼ 0.04). However, the slightly lower frequency of the
Clinical and endocrine parameters of 518 Caucasian women with PCOS. 18 insLQ insertion polymorphism among PCOS cases compared
AD: androstenedione; SHBG: sex hormone-binding globulin; DHEA: with controls was not significant after Bonferroni’s correction for
dehydroepiandrosterone; DHEAS: dehydroepiandrosterone sulfate; FAI: free androgen
the total number of SNPs that were tested. Among women with
index.
a
Mean of left and right ovary. PCOS, homozygous carriers of the minor allele showed 24.1%
lower levels of E2 (179 versus 236 pmol/l, P ¼ 0.01), in combination
with 21.3% lower ovarian volume (7.0 versus 8.9 ml, P ¼ 0.01) com-
not occur in PCOS patients and in only 16 controls. As the chi-square pared with the other genotypes.
test is more prone towards type I errors in case of very low minor The frequency of the minor allele of LHR Ser312Asn (Asn312) was
allele frequencies (MAF), HWE was recalculated with an exact test similar in PCOS patients and controls. A significant trend towards
(Wigginton et al., 2005) using the Pedstat software package (Wiggin- higher FSH levels in carriers of the Asn312 allele did not persist after cor-
ton and Abecasis, 2005). Again the LHR Asn291Ser polymorphism rection for the total number of polymorphic variants (P ¼ 0.10). As
was out of HWE (P ¼ 0.006). Consequently, this polymorphism was multiple polymorphisms were genotyped within the LHR gene, we
not used for the comparison of allele frequencies and haplotype distri- explored the possibility that specific combinations of allelic variants
butions in PCOS cases and controls. may have a more pronounced influence on phenotype. To this
purpose, the allele frequencies of four possible LHR haplotypes were
GnRH calculated in PCOS cases, i.e. H1 (nonLQ18/Ser312, 50.4%), H2
The distribution of the Trp16Ser alleles of GnRH1 was similar in PCOS (nonLQ18/Asn312, 23.6%), H3 (insLQ18/Ser312, 9.3%) and H4
cases and controls. Results for the comparison of genotype frequen- (insLQ18/Asn312, 16.7%). The distribution of LHR haplotypes was
cies in PCOS cases and controls are summarized in Table III. similar in women with PCOS and controls. The presence of H1,
GnRH1 Trp16Ser was not associated with gonadotrophic hormone which is characterized by the absence of polymorphic variants, was
levels. The influence of this polymorphism and others on the pheno- associated with lower levels of FSH. Median FSH levels were 5.1 IU/l
type of PCOS patients was primarily tested using a model for allele- (complete absence of H1), 4.5 IU/l (one copy of H1) and 4.4 IU/l (2
dose effects. In this way, no significant associations were observed copies of H1) (P for allele dose effect ¼ 0.02). Linear regression analysis
for this polymorphism. However, a somewhat more benign phenotype showed no additional benefit for the use of haplotype 1 over LHR
was noted in carriers (homozygous or heterozygous) of the minor Ser312Asn genotype in predicting FSH levels (P ¼ 0.69). No other
allele (Ser16) compared with non-carriers, showing 5.3% lower levels associations were observed for the presence of haplotypes one to
of testosterone (1.8 versus 1.9 nmol/l, P 0.01), lower FAI (4.7 four with the phenotype (including LH levels) of PCOS patients.
versus 5.4, P 0.01), lower fasting insulin levels (54 versus
65 pmol/l, P 0.01) and lower follicle count (18 versus 19, P ¼ Interaction of FSHR and LHR polymorphisms
0.05). No differences in the frequency of PCO or hyperandrogenism Both genetic variants of FSHR (Ser680) and LHR (Asn312) showed evi-
were observed among the various genotype groups (Table IV). dence of an association with higher FSH levels. Therefore, the2018 Valkenburg et al.
Table III Distribution of genotypes and MAF in 518 Caucasian PCOS women and 2996 healthy controls
Genotypes PCOS Control OR (95% CI) Pb
........................... .............................
N % N %
.............................................................................................................................................................................................
GNRH1 16
Trp/Trp 282 54.9 1570 53.3 1 (reference)
Trp/Ser 187 36.4 1172 39.8 0.89 (0.73– 1.09) 0.25
Ser/Ser 45 8.8 202 6.9 1.24 (0.88– 1.78) 0.22
MAF (Ser) 26.9 26.8 1.01 (0.87– 1.17) 0.91
FSHR 680
Asn/Asn 123 24.8 782 26.9 1 (reference)
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
Asn/Ser 248 50.1 1500 51.5 1.05 (0.83– 1.33) 0.68
Ser/Ser 124 25.1 630 21.6 1.25 (0.96– 1.64) 0.10
MAF (Ser) 50.1 47.4 1.12 (0.97– 1.28) 0.12
LHR InsLQ a
non/non 283 55.4 1220 52.0 1 (reference)
non/ins 202 39.5 934 39.8 0.93 (0.76– 1.14) 0.49
ins/ins 26 5.1 190 8.1 0.59 (0.38– 0.91) 0.02
MAF (ins) 24.9 28.0 0.85 (0.73– 0.99) 0.04
LHR 291
Asn/Asn 466 92.5 2630 89.8 1 (reference)
Asn/Ser 38 7.5 283 9.7 0.76 (0.53– 1.08) 0.12
Ser/Ser 0 0.0 16 0.5
MAF (Ser) 3.8 5.4 0.69 (0.49– 0.97) 0.03
LHR 312
Ser/Ser 184 36.6 978 33.5 1 (reference)
Ser/Asn 240 47.7 1426 48.9 0.90 (0.73– 1.10) 0.30
Asn/Asn 79 15.7 512 17.6 0.82 (0.62– 1.09) 0.17
MAF (Asn) 39.6 42.0 0.90 (0.79– 1.04) 0.15
OR: odds ratio, CI: confidence interval.
a
Genotyped in all PCOS cases and 2419 controls.
b
P-values are not corrected for multiple testing.
hypothesis was explored that an interaction between both genetic var- at codon 18 in exon 1 of the LHR gene. Among PCOS cases, homo-
iants may have a more distinct effect on the phenotype. To this zygous carriers of this genetic variant also showed 24% lower E2 levels
purpose the PCOS population was stratified into five subgroups, i.e. and 21% lower estimates of ovarian volume. Likewise, multiple associ-
carriers of zero to four polymorphic alleles (FSHR Ser680 or LHR ations were identified between genetic variants of the HPG-axis and
Asn312). Median FSH levels rose from 3.9 IU/l in women with no poly- the phenotype of PCOS patients, including gonadotrophic hormone
morphic variants (n ¼ 45) to 6.0 IU/l in women who were homozy- levels as well as the presence of hyperandrogenism.
gous carriers of the variant allele at both polymorphic loci. The total The primary aim of the current study was to identify risk alleles
number of variant alleles was significantly associated with increasing for PCOS. With the possible exception of the LHR 18insLQ poly-
FSH levels (P 0.01) (Fig. 1). Carriership of zero to four allelic variants morphism, we observed no differences in the frequency of these
was equally distributed among PCOS women and women from the polymorphisms in PCOS cases and controls. Contrary to what was
control population (X2 test, P ¼ 0.34) with an average of two allelic expected, we observed a lower frequency of the LHR 18insLQ poly-
variants per individual (both PCOS women and controls). morphism among PCOS patients. However, this finding was not sig-
nificant after Bonferroni’s correction and should therefore be
interpreted with caution. No other differences were observed in
Discussion allele frequencies and/or genotype distributions in PCOS cases
The present study compares the presence of genetic variants of the and controls. In contrast to a prior report (Laven et al., 2003), we
HPG-axis in Caucasian PCOS patients and unselected controls. All were unable to confirm a difference in the distribution of the
polymorphisms, except LHR insLQ, were equally distributed among FSHR genotypes in PCOS cases and controls. This discrepancy
cases and controls. A 40% decrease in risk for PCOS resulted from may originate from the limited number of controls (n ¼ 30) that
the homozygous presence of a 6-nucleotide insertion polymorphism were included in the former study.Gene polymorphisms and polycystic ovary syndrome
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
Table IV Clinical and endocrine characteristics of 518 anovulatory women with PCOS, stratifications by genotype
GNRH1 TRP16 (P) FSHR 680 (P) LHR 18 InsLQ (P) LHR 291 (P) LHR 312 (P)
............................... ............................... ................................ .................... ...............................
Trp/ Trp/ Ser/ Asn/ Asn/ Ser/ Non/ Non/ Ins/ Asn/ Asn/ Ser/ Ser/ Asn/
Trp Ser Ser Asn Ser Ser Non Ins Ins Asn Ser Ser Asn Asn
..........................................................................................................................................................................................................................................................
Baseline characteristics and ultrasound parameters
BMI (kg/m2) 26.8 25.2 26.6 0.50 25.7 25.5 27.6 0.50 25.5 26.9 26.8 0.50 26.2 27.3 0.50 26.2 26.6 25.1 0.50
Mean follicle 19 18 16 0.50 19 18 19 0.50 19 18 19 0.50 18.00 17.25 0.50 18 19 16 0.50
numbera
Mean ovarian 8.8 8.8 7.9 0.50 8.8 8.8 8.5 0.50 8.5 9.2 7.0 0.50 8.57 9.32 0.50 8.4 9.1 8.2 0.50
volumea
Endocrine parameters
LH (IU/l) 7.4 7.6 7.9 0.50 7.0 7.7 8.7 0.01 7.6 7.6 7.2 0.50 7.5 8.0 0.50 7.6 7.4 8.4 0.50
FSH (IU/l) 4.6 5.1 5.4 0.35 4.2 5.0 5.6 0.00001 4.9 4.8 5.6 0.50 4.9 4.9 0.50 4.8 4.9 5.3 0.10
Estradiol (pmol/l) 232 230 228 0.50 228 231 230 0.50 232 241 179 0.50 229 259 0.50 227 231 240 0.50
Testosterone 1.9 1.7 1.9 0.30 1.7 1.9 2.0 0.08 1.8 2.0 1.9 0.50 1.8 2.2 0.50 1.8 1.9 1.8 0.50
(nmol/l)
FAI 5.4 4.3 4.8 0.50 4.7 4.6 5.8 0.22 4.6 5.6 4.7 0.50 5.0 4.8 0.50 5.0 5.1 4.2 0.50
Fasting Insulin 65 54 56 0.20 55 58 65 0.35 58 58 65 0.50 58 57 0.50 63 58 60 0.50
(pmol/l)
AMHb (mg/ll) 10.4 9.6 10.0 0.50 10.3 9.6 9.9 0.50 9.2 11.2 11.1 0.15 10.0 12.4 0.50 9.6 10.4 9.8 0.50
Features of PCOS
PCO (%) 96.0 94.3 97.6 0.50 92.1 97.9 93.3 0.50 94.4 96.9 95.8 0.50 95.3 97.2 0.50 94.9 97.0 91.9 0.50
Hyperandrogenism 60.3 49.7 68.9 0.50 53.7 52.8 70.2 0.04 53.7 61.4 53.8 0.50 56.7 68.4 0.50 58.7 57.5 51.9 0.50
(%)
Values are medians. Hyperandrogenism was defined as the presence of either clinical (FG score 8) or biochemical (FAI 4.5) signs of androgen excess. P-values were corrected for the number of SNPs tested (Bonferroni correction). P-values
were calculated for allele-dose effects using analysis of variance (continuous variables, log transformed if not normally distributed) or Chi-square (polycystic ovaries and hyperandrogenism).
a
Mean of left and right ovary.
b
AMH levels available in a subgroup of 354 PCOS-patients.
20192020 Valkenburg et al.
1987). Therefore, decreased FSHR sensitivity may disturb normal fol-
liculogenesis causing a decrease in the production of E2 and inhibin B
that exert an inhibitory feedback action at the level of the pituitary
gland. The resultant increase in FSH and LH levels can also explain
the finding of increased androgen levels due to persistent stimulation
of ovarian theca cells by LH. Indeed we observed a significant corre-
lation between LH level and the level of ovarian androgens (testoster-
one [P 0.01] and AD [P 0.01]), but not with adrenal androgens
(DHEA and DHEAS). Although the influence of the FSHR variants
on gonadotrophic hormone levels and hyperandrogenism is relatively
large and consistent with an allele-dose effect, a more subtle influence
was observed for the GnRH1 Trp16Ser polymorphism. The presence
of either one or two copies of the Ser16 allele, which is the minor allele
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
in the European population, is associated with a somewhat more
benign phenotype with regard to carbohydrate metabolism and hyper-
androgenism (slightly lower testosterone levels and fasting insulin).
Figure 1 Median FSH levels in women with PCOS, stratified However, no significant differences in gonadotrophic hormone levels
according to number of allelic variants (FSH receptor Ser680 and LH
are noted, which would argue against a direct influence of this poly-
receptor Asn312).
morphism on the function of GnRH as a stimulant at the level of
the pituitary. Evidently, this genetic variant does not influence PCOS
The present study is limited by the absence of phenotype data in susceptibility as we found similar genotype distributions in PCOS
controls. Therefore, controls could not be selected for the absence cases and controls.
of PCOS. As it is known that 5–8% of women in the general popu- We have shown that genetic variations in the HPG-axis are capable
lation will develop PCOS, we expect that the current results will rep- of altering the phenotype of women with PCOS. More specifically
resent an underestimation of the actual difference between cases and these changes seem to be centered on the levels of gonadotrophic
controls. The concomitant loss-of-power will be partially overcome by hormones, insulin sensitivity and the presence of hyperandrogenism
the relatively large number of patients and controls that were included (either clinical or biochemical). The contribution of these polymorph-
in the present study. Secondly, there is an apparent age difference isms to the phenotype of PCOS is small and may only be relevant in
between controls (.55 years) and PCOS cases of reproductive age. conjunction with other genetic variants that contribute to minor phe-
However, it is known that the distribution of genotypes will be notypical variation (Simoni et al., 2008a). Therefore, the combined
stable in subsequent generations of a large population. Therefore, pro- influence of multiple polymorphisms can be expected to be much
vided that the presence of these polymorphisms does not shorten life- more pronounced. This is clearly illustrated by the results for FSH
span significantly, the higher age of controls is not regarded as a likely levels, showing nearly two times higher levels in compound homozy-
confounder. Hence, the lower frequency of the LHR insLQ variant in gous carriers of FSHR-Ser680 and LHR-Asn312 compared with non-
PCOS cases cannot be easily explained in such a fashion. carriers. Although there is a clear association with FSH levels, this
The secondary aim of this study was to assess the extent to which interaction of genotypes does not seem to influence PCOS suscepti-
these genetic variants influence the severity of clinical features of bility, as we observed no differences in the distribution of these
PCOS. In this regard, the most striking associations were observed allelic variants in PCOS cases and controls. These findings show that
for the FSHR polymorphisms. The present results are consistent polymorphic variants of the FSHR and LHR are important determi-
with prior reports concerning the role of FSHR variants in normogo- nants of the physiological setpoint of the HPG-axis that might contrib-
nadotrophic anovulation (Simoni et al., 2002; Laven et al., 2003). Both ute to the pathophysiology of PCOS.
studies show higher basal FSH levels in association with the FSHR In summary, genetic variants of the HPG-axis are associated with a
Ser680 allele. In women undergoing ovarian stimulation, this receptor modest but significant effect on the phenotype of PCOS. FSHR var-
variant results in lower E2 levels following FSH stimulation, suggesting iants are strongly associated with the severity of clinical features of
lower FSHR sensitivity (Behre et al., 2005). FSH levels in women with PCOS, such as levels of gonadotrophic hormones and the presence
PCOS are within normal limits (Laven et al., 2002). Therefore, it does of hyperandrogenism, but not disease risk.
not seem likely that altered FSH sensitivity contributes to the ovula-
tory dysfunction that is usually present in PCOS. Apparently, the pitu-
itary is capable of a compensatory rise in FSH levels in carriers of the
Funding
Ser680 allele that is able to overcome the increased FSH threshold. A.P.N. Themmen has received honoraria from Diagnostic Systems
Our results further substantiate this hypothesis by the fact that this Laboratories-Beckman, B.C.J.M. Fauser has received fees and grant
variant did not constitute a risk allele for PCOS and no association support from the following companies (in alphabetical order):
with the number of antral follicles or AMH levels was observed. In Andromed, Ardana, Ferring, Merck Serono, Organon, Pantharei Bio-
addition to the finding of higher FSH levels in carriers of the FSHR science, PregLem, Schering Plough, Schering, Serono and Wyeth,
Ser680 allele, we also report higher LH levels in association with the J.S.E.L. has received fees and grant support from the following com-
FSHR Ser680 allele. During folliculogenesis, FSH stimulates the activity panies: Ferring, Genovum, Merck-Serono, Organon, Schering Plough
and synthesis of aromatase in ovarian granulosa cells (Steinkampf et al., and Serono. O.V., A.G.U., D.P. and A.H. have nothing to disclose.Gene polymorphisms and polycystic ovary syndrome 2021
luteinizing hormone receptor protein more active by improving signal
References peptide function and predicts adverse outcome in breast cancer
Atger M, Misrahi M, Sar S, Le Flem L, Dessen P, Milgrom E. Structure of patients. J Clin Endocrinol Metab 2006;91:1470 – 1476.
the human luteinizing hormone-choriogonadotropin receptor gene: Piersma D, Themmen AP, Look MP, Klijn JG, Foekens JA, Uitterlinden AG,
unusual promoter and 50 non-coding regions. Mol Cell Endocrinol 1995; Pols HA, Berns EM. GnRH and LHR gene variants predict adverse
111:113– 123. outcome in premenopausal breast cancer patients. Breast Cancer Res
Azziz R, Woods KS, Reyna R, Key TJ, Knochenhauer ES, Yildiz BO. 2007a;9:R51.
The prevalence and features of the polycystic ovary syndrome Piersma D, Verhoef-Post M, Look MP, Uitterlinden AG, Pols HA,
in an unselected population. J Clin Endocrinol Metab 2004; Berns EM, Themmen AP. Polymorphic variations in exon 10 of the
89:2745– 2749. luteinizing hormone receptor: functional consequences and
Balen AH, Laven JS, Tan SL, Dewailly D. Ultrasound assessment of the associations with breast cancer. Mol Cell Endocrinol 2007b;276:
polycystic ovary: international consensus definitions. Hum Reprod 63 – 70.
Update 2003;9:505– 514. Powell BL, Piersma D, Kevenaar ME, van Staveren IL, Themmen AP,
Behre HM, Greb RR, Mempel A, Sonntag B, Kiesel L, Kaltwasser P,
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021
Iacopetta BJ, Berns EM. Luteinizing hormone signaling and breast
Seliger E, Ropke F, Gromoll J, Nieschlag E et al. Significance of a cancer: polymorphisms and age of onset. J Clin Endocrinol Metab 2003;
common single nucleotide polymorphism in exon 10 of the 88:1653– 1657.
follicle-stimulating hormone (FSH) receptor gene for the ovarian The Rotterdam ESHRE/ASRM-Sponsored PCOS consensus workshop
response to FSH: a pharmacogenetic approach to controlled ovarian group. Revised 2003 consensus on diagnostic criteria and long-term
hyperstimulation. Pharmacogenet Genomics 2005;15:451 – 456. health risks related to polycystic ovary syndrome. Fertil Steril 2004;
Chhabra S, McCartney CR, Yoo RY, Eagleson CA, Chang RJ, Marshall JC. 81:19– 25.
Progesterone inhibition of the hypothalamic gonadotropin-releasing Schipper I, de Jong FH, Fauser BC. Lack of correlation between maximum
hormone pulse generator: evidence for varied effects in early follicular phase serum follicle stimulating hormone concentrations
hyperandrogenemic adolescent girls. J Clin Endocrinol Metab 2005; and menstrual cycle characteristics in women under the age of 35 years.
90:2810– 2815. Hum Reprod 1998;13:1442 – 1448.
Dalkin AC, Haisenleder DJ, Ortolano GA, Ellis TR, Marshall JC. The Sedlmeyer IL, Pearce CL, Trueman JA, Butler JL, Bersaglieri T, Read AP,
frequency of gonadotropin-releasing-hormone stimulation differentially Clayton PE, Kolonel LN, Henderson BE, Hirschhorn JN et al.
regulates gonadotropin subunit messenger ribonucleic acid expression. Determination of sequence variation and haplotype structure for the
Endocrinology 1989;125:917 – 924. gonadotropin-releasing hormone (GnRH) and GnRH receptor genes:
Hofman A, Grobbee DE, de Jong PT, van den Ouweland FA. investigation of role in pubertal timing. J Clin Endocrinol Metab 2005;
Determinants of disease and disability in the elderly: the Rotterdam 90:1091– 1099.
Elderly Study. Eur J Epidemiol 1991;7:403 – 422. Simoni M, Gromoll J, Hoppner W, Kamischke A, Krafft T, Stahle D,
Hofman A, Breteler MM, van Duijn CM, Krestin GP, Pols HA, Stricker BH, Nieschlag E. Mutational analysis of the follicle-stimulating hormone
Tiemeier H, Uitterlinden AG, Vingerling JR, Witteman JC. The (FSH) receptor in normal and infertile men: identification and
Rotterdam Study: objectives and design update. Eur J Epidemiol 2007; characterization of two discrete FSH receptor isoforms. J Clin
22:819– 829. Endocrinol Metab 1999;84:751 – 755.
Imani B, Eijkemans MJ, te Velde ER, Habbema JD, Fauser BC. Predictors of Simoni M, Nieschlag E, Gromoll J. Isoforms and single nucleotide
patients remaining anovulatory during clomiphene citrate induction of polymorphisms of the FSH receptor gene: implications for human
ovulation in normogonadotropic oligoamenorrheic infertility. J Clin reproduction. Hum Reprod Update 2002;8:413 – 421.
Endocrinol Metab 1998;83:2361 – 2365. Simoni M, Tempfer CB, Destenaves B, Fauser BC. Functional genetic
Iwasaki H, Emi M, Ezura Y, Ishida R, Kajita M, Kodaira M, Yoshida H, polymorphisms and female reproductive disorders: Part I: polycystic
Suzuki T, Hosoi T, Inoue S et al. Association of a Trp16Ser variation ovary syndrome and ovarian response. Hum Reprod Update 2008a;
in the gonadotropin releasing hormone signal peptide with bone 14:459– 484.
mineral density, revealed by SNP-dependent PCR typing. Bone 2003; Simoni M, Tuttelmann F, Michel C, Bockenfeld Y, Nieschlag E, Gromoll J.
32:185– 190. Polymorphisms of the luteinizing hormone/chorionic gonadotropin
Jakimiuk AJ, Weitsman SR, Navab A, Magoffin DA. Luteinizing hormone receptor gene: association with maldescended testes and male
receptor, steroidogenesis acute regulatory protein, and steroidogenic infertility. Pharmacogenet Genomics 2008b;18:193 – 200.
enzyme messenger ribonucleic acids are overexpressed in thecal and Steinkampf MP, Mendelson CR, Simpson ER. Regulation by
granulosa cells from polycystic ovaries. J Clin Endocrinol Metab 2001; follicle-stimulating hormone of the synthesis of aromatase cytochrome
86:1318– 1323. P-450 in human granulosa cells. Mol Endocrinol 1987;1:465– 471.
Laven JS, Imani B, Eijkemans MJ, Fauser BC. New approach to polycystic Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype
ovary syndrome and other forms of anovulatory infertility. Obstet reconstruction from population data. Am J Hum Genet 2001;
Gynecol Surv 2002;57:755 – 767. 68:978– 989.
Laven JS, Mulders AG, Suryandari DA, Gromoll J, Nieschlag E, Fauser BC, Vagenakis GA, Sgourou A, Papachatzopoulou A, Kourounis G,
Simoni M. Follicle-stimulating hormone receptor polymorphisms in Papavassiliou AG, Georgopoulos NA. The gonadotropin-releasing
women with normogonadotropic anovulatory infertility. Fertil Steril hormone (GnRH)-1 gene, the GnRH receptor gene, and their
2003;80:986 – 992. promoters in patients with idiopathic hypogonadotropic
Perez Mayorga M, Gromoll J, Behre HM, Gassner C, Nieschlag E, hypogonadism with or without resistance to GnRH action. Fertil Steril
Simoni M. Ovarian response to follicle-stimulating hormone (FSH) 2005;84:1762 – 1765.
stimulation depends on the FSH receptor genotype. J Clin Endocrinol van Santbrink EJ, Hop WC, Fauser BC. Classification of
Metab 2000;85:3365 – 3369. normogonadotropic infertility: polycystic ovaries diagnosed by
Piersma D, Berns EM, Verhoef-Post M, Uitterlinden AG, Braakman I, ultrasound versus endocrine characteristics of polycystic ovary
Pols HA, Themmen AP. A common polymorphism renders the syndrome. Fertil Steril 1997;67:452 – 458.2022 Valkenburg et al.
Venturoli S, Porcu E, Fabbri R, Magrini O, Gammi L, Paradisi R, Flamigni C. Yen SS, Vela P, Rankin J. Inappropriate secretion of follicle-stimulating
Longitudinal evaluation of the different gonadotropin pulsatile patterns hormone and luteinizing hormone in polycystic ovarian disease. J Clin
in anovulatory cycles of young girls. J Clin Endocrinol Metab 1992; Endocrinol Metab 1970;30:435 – 442.
74:836 – 841. Zumoff B, Freeman R, Coupey S, Saenger P, Markowitz M, Kream J. A
Wigginton JE, Abecasis GR. PEDSTATS: descriptive statistics, graphics chronobiologic abnormality in luteinizing hormone secretion in
and quality assessment for gene mapping data. Bioinformatics 2005; teenage girls with the polycystic-ovary syndrome. N Engl J Med 1983;
21:3445 – 3447. 309:1206– 1209.
Wigginton JE, Cutler DJ, Abecasis GR. A note on exact tests
of Hardy – Weinberg equilibrium. Am J Hum Genet 2005;76: Submitted on November 1, 2008; resubmitted on March 25, 2009; accepted on
887 – 893. March 30, 2009
Downloaded from https://academic.oup.com/humrep/article/24/8/2014/650239 by guest on 08 February 2021You can also read
