Expression of acrA gene in ciprofloxacin and tetracycline resistant Esherichia coli mutants with possible mutation in acrR
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
International Research Journal of Applied and Basic Sciences
© 2013 Available online at www.irjabs.com
ISSN 2251-838X / Vol, 6 (9): 1285-1290
Science Explorer Publications
Expression of acrA gene in ciprofloxacin and
tetracycline resistant Esherichia coli mutants with
possible mutation in acrR
Razieh Pourahmad Jaktaji1 and Nasim Jazayeri2
Corresponding author: Razieh Pourahmad Jaktaji
ABSTRACT: In E. coli the major transporter responsible for the high intrinsic level of antibiotic
resistance is AcrAB-TolC. The ingredients of pump are encoded by acrA, acrB and tolC. The
expression of first two genes is inhibited by a repressor called AcrR. However, MarA activates the
expression of three genes. Occurrence of a mutation in marR and acrR can lead to overexpression
of the pump. The aims of this research were to use ciprofloxacin and tetracycline resistant mutants
having a mutation in marR gene for studying first, the possible presence of mutations in acrR gene
and then the expression of acrA. For these purposes the DNA binding region of acrR gene in these
mutants were amplified and sequenced, and the relative expression of acrA in these mutants was
quantified by real time PCR. Results showed that one of the mutant and its clone had a mutation in
acrR, but none of the mutants overexpresses acrA in comparison with wild type strain. The effect of
marR and acrR mutations on acrAB overexpression is dependent on levels of resistance to
tetracycline and ciprofloxacin.
Key Words: AcrAB-TolC pump; acrA; acrR; antibiotic multiple resistance; marR
INTRODUCTION
Generation of multiple irrelevant drug resistant phenotypes in pathogenic gram negative bacteria, such as E.
coli is a clinical problem. It can be associated with increase in activity of membrane transporters which have a
role in exports of antibiotics (Piddock, 2006). There are five classes of efflux transporters, including the ATP-
binding cassette (ABC) family; the major facilitator superfamily (MFS); the resistance-nodulation-division (RND)
family; the small multidrug resistance (SMR) family and the multidrug and toxic compound extrusion (MATE)
family (Piddock, 2006). Some of these transporters produce the tripartite complexes while others produce two
component complexes in bacterial membrane (Grkovic et al., 2002). One of the important membrane
transporters in E. coli is AcrAB-TolC pump that belongs to RND family (Piddock, 2006). As the name shows it
consists of three ingredients, including AcrA, a periplasmic membrane-fusion protein; AcrB, the inner
membrane protein; and TolC, an outer membrane channel. These are encoded by acrA, acrB and tolC. The
first two genes are located in acrAB operon, while tolC is placed on different site of bacterial chromosome
(Viveiros et al., 2007).
The acrAB operon is negatively regulated by AcrR repressor (Su et al., 2007). The repressor encoding
gene, acrR is positioned upstream of acrAB operon and transcribed divergently from the same promoter. Figure
1 shows the region of genome containing this operon and its regulatory gene.
The N-terminal domain of AcrR contains DNA-binding helix-turn-helix (HTH) motif, while its C-terminal
domain has drug binding site. The attachment of drug to C-terminal ligand domain leads to conformational
change of N-terminal DNA-binding domain and thereby dissociates AcrR from its operator site (Gu et al., 2008)
On the other hand, MarA, a global transcriptional activator, activates acrAB and tolC expressions (Rhee et
al., 1998). Expression of MarA is under the control of MarR repressor (Martin & Rosner, 1995). This repressor,
like AcrR possesses DNA binding and drug binding sites (Perera & Grove, 2010). Occurrence of a mutation in
marR and acrR can overactivate the AcrAB-TolC pump (Grkovic et al., 2002). In the previous work gyrA
mutants, which are resistant to ciprofloxacin and tetracycline and either or not having a mutation in marR were
described (Pourahmad Jaktaji et al., 2012). These mutants and their increased tetracycline resistant clones
could overexpress acrAB, if they lacked AcrR activity. The aims of this research were first, to study the possible
presence of mutations in acrR gene and then to study acrA expression in these mutants.Intl. Res. J. Appl. Basic. Sci. Vol., 6 (9), 1285-1290, 2013
MATERIALS and METHODS
Antimicrobial Agent and Media
Tetracycline hydrochloride (Tc) (Sigma) was used to induce resistance in mutants. Stock solution was 4
mg/ml. LB broth (Merck, Germany) and LBA containing 1.5% agar (Merck, Germany) were used for cultivation
of strain and mutants.
Bacterial Strain and Mutants
MG1655 was wild type strain. Ciprofloxacin and tetracycline resistant mutants either or not having mutation in
marR gene isolated from previous work [10] are listed in Table 1. Mutants W25, W26 and W49 were isolated
from cultivation of wild type strain on LBA plus 40 ng/ml ciprofloxacin (Pourahmad Jaktaji & Mohiti, 2010). The
resistance of mutants to Tc was increased up to 45 µg/ml in Clone C6, by cultivation of above mutants on LBA
agar containing up to 20 µg/ml Tc (Pourahmad Jaktaji & Mohiti, 2013). It was described that resistance to
tetracycline can also be divided to three levels, including low levels of resistance (MIC: 1 to 10 µg/ml),
intermediate levels of resistance (MIC: 10 to 50 µg/ml) and high levels of resistance (MIC: >50 µg/ml) (George
& Levy, 1983). It was mentioned that resistance to ciprofloxacin can be divided to three levels, including low
levels of resistance (MIC: 0.063 to 1 µg/ml), intermediate levels of resistance (MIC: 1 to 32 µg/ml) and high
levels of resistance (MIC: >32 µg/ml) (Kishii & Takei, 2009). Based on above definitions mutants have low to
intermediate levels of resistance to ciprofloxacin and tetracycline.
PCR Amplification and DNA Sequencing
As described previously colony PCR was used to amplify the 5′ end of acrR gene in wild type and mutants
(Pourahmad Jaktaji & Mohiti, 2010). A single colony from each mutant and clone on LB agar was suspended in
100 µL of sterile water and heated at 95˚C for 3 min and cooled on ice. It can be used as a PCR template for
acrR amplification. Primers for amplification are listed in Table 2. PCR products (240 bp) were sequenced and
compared with MG1655 acrR sequence obtained from NCBI (NC_000913.2).
acre Expression Analysis By Real Time PCR
After cultivation of bacteria in LB broth plus 3 µg/ml Tc (except for wild type) at 37ºC with shaking at 150 rpm
and grown to mid-logarithmic phase (OD600 of 0.6), each culture was pelleted by centrifugation following
stabilization in RNA protect bacterial reagent (Qiagen. Germany) and RNA was extracted immediately using an
RNeasy Mini Kit (Qiagen, Germany). Contaminating genomic DNA was eliminated by RNase-free DNase I
treatment according to the manufacturer's instruction (Fermentas, Life science research) and its absence was
confirmed by amplification of RNA samples plus a DNA sample as a positive control. Total RNA concentration
was estimated at OD260 using spectrophotometer (Ultrospec 1100, Amersham Pharmacia Biothech). Purified
total RNA (2 µg) was used as a template in RT-PCR using a RevertAid Reverse Transcriptase kit (Fermentas,
Life science research). The cDNAs obtained from reverse transcription were used to quantify the level of acrA
and gapA, as an endogenous reference gene by real time PCR in a Rotor Gene 6000 thermocycler (Corbett
Research, Australia) using a SYBR Green kit (Takara, Japan). Primers used in this experiment are listed in
Table 2. Thermal cycling conditions were described previously (Viveiros et al., 2007). Relative gene expression
was calculated using the efficiency method pfaffl (ratio of acrA expression to gapA expression) (Pfaffl et al.,
2002). All data on acrA expression are the average of triplicate analyses. The data were recorded as
mean±SD. Statistical analysis of relative expression was done by SPSS version 16. T-test was used for
comparison of relative gene expression data.
RESULTS
Presence of mutation in acrR
Mutants listed in Table 1 with different MIC for ciprofloxacin and tetracycline were analyzed for presence of
possible mutation in first region of acrR gene relevant to HTH motif of encoded protein. Figure 2 shows the
result of gel electrophoresis of the acrR PCR product of MG1655 and mutants. The comparison of nucleotide
sequence of PCR products with published sequence of acrR showed that W26 and its derived clone, C14 had
changes in acrR. Figure 3 shows the comparison of nucleotide sequence of C14 PCR product with that of wild
type. The same changes was also seen in W26. However, other mutants and clones were the same as wild
type. Thus, mutants and clones had just single mutation in marR or acrR.
A G/C heterozypote genotype at nucleotide position 131 in coding region of acrR in W26 and C14 could
cause silent mutation at Thr-44 codon and a G/C heterozygote genotype at position 133 could change Arg-45
(CGC) to Pro (CCC). Substitution of Arg-45 with Cys, but not Pro was reported previously (Webber ET AL.,
2005).
1286Intl. Res. J. Appl. Basic. Sci. Vol., 6 (9), 1285-1290, 2013
Expression of acrA in mutants
As mutants used in this study harbor either a mutation in marR (W25, W49, C6 and C17) or acrR (W26
and C14), it was possible that they overexpress acrAB. Purified RNAs were used for real time analysis. Results
reveal that the efficiency of acrA and gapA were 1.96 and 2.1, respectively. The melting curve of two genes
showed just one major peak which indicates the purity of samples. The melting point of acrA and gapA were 88
and 86 degree centigrade. Table 3 shows the acrA relative expression in these mutants. The T-test analysis
showed no significant difference between wild type and mutants for expression of acrA (PIntl. Res. J. Appl. Basic. Sci. Vol., 6 (9), 1285-1290, 2013
Furthermore, it is possible that the accumulation of other mutations is also necessary for high levels of
resistance and overactivity of pump (Lindgren et al., 2003).
ACKNOWLEDGEMENT
This work was financially supported by the University of Shahrekord. We thank Prof. R. G. Lloyd for kind gift
of MG1655.
REFERENCES
Aono R, Tsukagoshi N, Yamamoto M. 1998. Involvement of outer membrane protein TolC a possible member of the mar-sox regulon in
maintenance and improvement of organic solvent tolerance of Escherichia coli K-12. J Bacteriol. 180: 938-944.
Cohen SP, Hachler H, Levy SB. 1993. Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli. J
Bacteriol. 175: 1484-1492.
Dzwokai M, Alberti M, Lynch C, Nikaido H, Hearst JE. 1996. The local repressor AcrR plays a modulating role in the regulation of acrAB
genes of Escherichia coli by global stress signals. Mol Microbiol. 19: 101-112.
George AM, Levy SB. 1983. Amplifiable resistance to tetracycline, chloramphenicol and other antibiotics in Escherichia coli: involvement of
a non-plasmid determined efflux of tetracycline. J Bacteriol. 155: 531-540.
Grkovic S, Brown MH, Skurray RA. 2002. Regulation of bacterial drug export systems. Microbiol and Mol Biol Rev. 66: 671-701.
Gu R, Li M, Su CC, Long F, Routh MD, Yang F, McDermott G, Yu EW. 2008. Conformational change of the AcrR regulator reveals a
possible mechanism of induction. Acta Cryst. 64, 584-588.
Kishii R, Takei M. 2009. Relationship between the expression of OmpF and quinolone resitance in Escherichia coli. J Infect Chemother.
15: 361-366.
Lindgren PK, Karlsson A, Hughes D. 2003. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from
patients with urinary tract infections. Antimicrobial Agents Chemother. 47: 3222-3232.
Maneewannakul K, Levy SB. 1996. Identification of mar mutants among quinolone resistant clinical isolates of Escherichia coli.
Antimicrobial Agents Chemother. 40: 1695-1698.
Martin RG, Rosner JL. 1995. Binding of purified multiple antibiotic resistance repressor protein (MarR) to mar operator sequences. Proc
Natl Acad Sci USA. 92: 5456-5460.
Mazzariol A, Tokue Y, Kanegawa TM, Cornaglia G, Nikaido H. 2000. High level fluoroquinolone resistant clinical isolates of Escherichia coli
overproduce multidrug efflux protein AcrA. Antimicrobial Agents Chemother. 44: 3441-3443.
Perera IC, Grove A. 2010. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators.
J Mol Cell Biol. 2: 243-254.
Pfaffl MW, Horgan GW, Dempfle L. 2002. Relative expression software tool (REST ©) for group wise comparison and statistical analysis of
relative expression results in real time PCR. Nuc Acids Res. 30: 1-10.
Piddock LJV, White DG, Gensberg K, Pumbwe L, Griggs DJ. 2000. Evidence for an efflux pump mediating multiple antibiotic resistance in
Salmonella enteric serovar typhimurium. Antimicrobial Agents Chemother. 44: 3118-3121.
Piddock LJV. 2006. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clinic Microbiol Rev . 19:
382-402.
Pourahmad Jaktaji R, Ebadi R, Karimi M. 2012. Study of organic solvent tolerance and increased antibiotic resistance properties in E. coli
gyrA mutants. IJPR. 11:595-600.
Pourahmad Jaktaji R, Ebadi R. 2013. Generation of clones with higher resistance to tetracycline and chloramphenicol from ciprofluoxacin
resistant Escherichia coli mutants. IRJABS. 4: 3063-3067.
Pourahmad Jaktaji R, Mohiti E. 2010. Study of mutations in the DNA gyrase gyrA gene of Escherichia coli. IJPR. 9: 43-45.
Rand JD, Danby SG, Greenway DL, England RR. 2002. Increased expression of the multidrug efflux genes acrAB occurs during slow
growth of Escherichia coli. FEMS Microbiol Lett. 207: 91–95.
Rhee S, Martin RG, Rosner JL, Davies DR. 1998. A novel DNA-binding motif in MarA: the first structure for an AraC family transcriptional
activator. Proc Natl Acad Sci USA. 95:10413–10418.
Ruiz J. 2003. Mechanisms of resistance to quinolones: target alteration, decreased accumulation and DNA gyrase protection. J.
Antimicrobial Chemother. 51: 1109-1117.
Su CC, Rutherford DJ, Yu EW. 2007. Characterization of the multidrug efflux regulator AcrR from Escherichia coli. Biochem Biophys Res
Commun . 361: 85-90.
Swick MC, Morgan-Linnell SK, Carlson KM, Zechiedrich L. 2011. Expression of multidrug efflux pump genes acrAB-tolC, mdfA and norE in
Escherichia coli clinical isolates as a function of fluoroquinolone and multidrug resistance. Antimicrobial Agents Chemother. 55:
921-924.
Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pages JM, Amaral L. 2007. Antibiotic stress, genetic response and
altered permeability of E. coli. PLoS. 4: e365
Webber MA, Talukder A, Piddock LJV. 2005. Contribution of mutation at amino acid 45 of AcrR to acrB expression and ciprofloxacin
resistance in clinical and veterinary Escherichia coli isolates. Antimicrobial Agents Chemother. 49: 4390-4392.
Yasufuku T, Shigemura K, Shirakawa T, Matsumoto M, Nakano Y, Tanaka K, Arakawa S, Kinoshita S, Kawabata M, Fujisawa M. 2011.
Correlation of overexpression of efflux pump genes with antibiotic resistance in Escherichia coli strains clinically isolated from
urinary tract infection patients. J Clinic Microbiol. 49: 189-194.
1288Intl. Res. J. Appl. Basic. Sci. Vol., 6 (9), 1285-1290, 2013
acrR AcrR site acrB
acrA
Figure 1. acrAB operon and its upstream neighboring gene and regulatory region. Modified and adapted
from Dzwokai et al 1996.
Table 1. Bacterial strain and mutants
Strain/Mutant/Clone Relevant MIC Source/Reference
properties Ciprofloxacin Tetracycline
(ng/ml) (µg/ml)
MG1655 Wild type 35 3 A gift from Prof. R. G.
Lloyd
W25 Wild type; gyrA 75 4 Pourahmad & Mohiti,
(Ser83→Leu) and 2010
marR
(Met74→Thr)
W26 Wild type; gyrA 75 4 Pourahmad & Mohiti,
(Ser83→Leu) 2010
W49 Wild type; gyrA 625 4 Pourahmad & Mohiti,
and marOR (20 2010
bp duplication in
operator)
C6 W25; gyrA 1000 45 Pourahmad & Ebadi,
(Ser83→Leu) and 2013
marR
(Met74→Thr)
C12 W26; gyrA 1000 30 Pourahmad & Ebadi,
(Ser83→Leu) 2013
C16 W49; gyrA and 1000 30 Pourahmad & Ebadi,
marOR (20 bp 2013
duplication in
operator)
Table 2. List of primers used in this study
Gene Primer sequence (5′-3′) Length of amplicon (bp) Reference
acrR F: CACGAACATATGGCACG 240 This work
R: GCCTGATACTCAAGCTC
acrA F: TTGAAATTACGCTTCAGGAT 189 Viveiros et al., 2007
R: ACTTACGAGCAGATCAAAGC
gapA F: ACTTACGAGCAGATCAAAGC 170 Viveiros et al., 2007
R: AGTTTCACGAAGTTGTCGTT
1289Intl. Res. J. Appl. Basic. Sci. Vol., 6 (9), 1285-1290, 2013
wt W26 C6 C14 C17
Figure 2. PCR products of acrR gene in wild type (wt) and mutants. First lane
shows the 1 Kb ladder and other lanes show PCR products.
TT ACC/GCG/CCGG
TT AC G C G CGG
Figure 3. Sequence output from acrR PCR product of C14 mutant (first part)
and wild type (second part) using forward and reverse primers. Underlined
nucleotides show the differences between nucleotide sequences of two parts.
Table 2. Relative expression of acrA in wild type (MG1655) and mutants as determined by real time PCR
Strain/mutant Relative expression of acrA
Wild type (MG1655) 1±0
EM3 1.25±0.017
EM4 1.16±0.021
EM9 1.62±0.01
C6 1.2±0.015
C14 1.28±0.013
C17 1.4±0.013
1290You can also read
