Evaluation of a Single-Tube Multiplex Polymerase Chain Reaction Screen for Detection of Common alpha-Thalassemia Genotypes in a Clinical Laboratory
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Hematopathology / PCR SCREEN FOR ALPHA-THALASSEMIA IN A CLINICAL LABORATORY
Evaluation of a Single-Tube Multiplex Polymerase
Chain Reaction Screen for Detection of Common
alpha-Thalassemia Genotypes in a Clinical Laboratory
Alana K. Bergstrome Jones, MSc, and Annette Poon, MB, BCh, FRCP(C)
Key Words: alpha-Thalassemia; Thalassemia; Polymerase chain reaction; PCR
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
Abstract Thalassemia is a group of genetic disorders characterized
We prospectively compared a single-tube multiplex by quantitative defects in globin chain synthesis. The subse-
polymerase chain reaction (PCR) for detecting alpha- quent absence or decrease of hemoglobin production results
thalassemia with our current approach using 452 blood in microcytosis with varying degrees of anemia. These condi-
samples. Initial evaluation of 89 specimens revealed tions commonly are found in people of Mediterranean,
sensitivity and specificity, respectively, for the African, Middle Eastern, Indian, Chinese, or Southeast Asian
hemoglobin H inclusion body test (HbH prep) vs PCR origin.1 Some evidence suggests that natural selection may
for detecting alpha0-thalassemia carriers of 0.79 and have elevated and maintained the high frequency of globin
0.96 and for a mean corpuscular volume (MCV) of 82 deletions as protection against a severe form of malaria.2
µm3 (82 fL) or less, 1.0 and 0.45. Detection of all While the heterozygous state for thalassemia (thalassemia
alpha-thalassemia genotypes was significantly lower trait) is a benign condition, the homozygous state is associ-
for HbH prep and MCV (sensitivity and specificity, ated with more severe disorders that cause substantial
respectively: HbH prep, 0.48 and 0.96; MCV, 0.87 and morbidity and mortality worldwide.
0.47). In a follow-up evaluation of patients with positive In the healthy adult, hemoglobin A is the most prevalent
HbH prep results or suspected alpha-thalassemia form, composed of 2 alpha-globin and 2 beta-globin chains.
prescreened by low MCV, the sensitivity and specificity, Two minor hemoglobins also are present: hemoglobin A2 (2
respectively, of HbH prep vs PCR increased to 0.97 and alpha- and 2 delta-globin chains) and hemoglobin F (2 alpha-
0.93 for alpha0-thalassemia and 0.83 and 0.92 for any and 2 gamma-globin chains). There are 4 alpha-globin genes, 2
alpha-thalassemia. PCR detected alpha-thalassemia in of which are encoded in tandem (in cis) on each chromosome
37.2% of 298 suspected alpha-thalassemia cases with 16p13.33 (αα/αα), and 2 beta-globin genes, 1 on each chromo-
suggestive indices but negative HbH prep results and no some 11. beta-Thalassemia often is due to a point mutation or a
detectable hemoglobinopathy. This multiplex approach small deletion or insertion mutation in one of the beta-globin
was more sensitive than the HbH prep for detecting all genes, leading to decreased or absent beta-globin chain
alpha-thalassemia genotypes, particularly alpha+- synthesis.4-6 On the other hand, alpha-thalassemia usually is
thalassemia; was particularly valuable for identifying caused by deletion of one or more alpha-globin genes.4 The
carriers of alpha0-thalassemia at risk for offspring with rate of synthesis of alpha-globin chains is related to the
hemoglobin Bart hydrops fetalis, regardless of other number of genes deleted. 7 Loss of 1 alpha-globin gene
diagnosed hemoglobinopathies; and is an ideal adjunct (heterozygous alpha+-thalassemia; –α/αα) results in a silent
to standard clinical screening protocols for detecting carrier, not manifesting abnormalities other than mild micro-
alpha-globin deletions. cytosis. Loss of 2 alpha-globin genes on 1 chromosome
(heterozygous alpha0-thalassemia; – –/αα), or on opposite
chromosomes (homozygous alpha+-thalassemia; –α/–α) may
18 Am J Clin Pathol 2002;118:18-24 © American Society for Clinical PathologyHematopathology / ORIGINAL ARTICLE
result in a mild microcytic hypochromic anemia. Loss of 3 prep). This test is laborious, observer-dependent, and
genes (– –/–α) results in an intermediate thalassemia disease reported to have poor sensitivity.18 Initial screening for other
state known as hemoglobin H (HbH) disease, and may be causes of microcytosis, such as iron deficiency, beta-
associated with reduced growth rate, iron overload unrelated to thalassemia trait, or thalassemic hemoglobin variants, can
transfusion history, and other complications.8 Complete dele- improve sensitivity. The HbH prep test is seldom positive in
tion of all 4 alpha-globin genes results in severe hypoxia and alpha+-thalassemia, and laboratory diagnosis in these cases
anemia in utero (hemoglobin Bart hydrops fetalis; – –/– –), relies on a high index of suspicion, based on a decreased
a lethal condition. 9,10 The laboratory identification of mean corpuscular volume (MCV) and the absence of other
people with alpha-thalassemia is important for 2 reasons: causes of microcytosis, followed by DNA studies. Molecular
(1) for the identification of patients of reproductive age methods for detecting and typing the alpha-thalassemia dele-
who are carriers of serious or life-threatening hemoglo- tions typically have required the use of Southern blot
binopathies8,11 and (2) for the investigation of microcytic analysis.10,16 The advent of nonradioactive labeling methods
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
anemia to prevent erroneous and unnecessary medical improved the safety of the procedure; however, it remains a
intervention for iron deficiency. time-consuming, labor-intensive, and expensive technique.
People with heterozygous alpha0-thalassemia and HbH Polymerase chain reaction (PCR) methods developed to
disease are carriers of hemoglobin Bart hydrops fetalis, as specifically amplify individual deletions have required
they both carry the alpha0-thalassemia mutation. Parents who multiple reactions owing to different reagent and cycling
both carry this mutation have a 25% risk of conceiving a conditions appropriate to each deletion.2,10,19-21 Recently, a
fetus with hemoglobin Bart hydrops fetalis. People who are single-tube multiplex PCR screen was developed to identify
heterozygous and homozygous for alpha+ mutations are not the 6 most common deletional mutations (described in the
carriers of hemoglobin Bart hydrops fetalis but are carriers of preceding paragraph).16 The present study examined the
HbH disease. effectiveness of the multiplex PCR for the detection of alpha-
The most common inherited disorder of hemoglobin thalassemia compared with our current screening approach
synthesis is alpha-thalassemia.12 More than 95% of alpha- of low MCV, exclusion of other causes of microcytosis, and
thalassemia cases are deletional. The most common alpha0- HbH prep.
thalassemia deletions are the Southeast Asian (– –SEA),
Mediterranean (– –MED), 20.5 kilobase (kb) (– –20.5), and
Filipino (– –FIL). The most common alpha+-thalassemia dele-
Materials and Methods
tions are the rightward 3.7 kb (–α3.7) and the leftward 4.2 kb
(–α4.2).1,3,13 The – –SEA and – –FIL deletions are found in
Southeast Asian and Chinese populations. A majority of Initial Evaluation
these, more than 90% in most populations, are the – –SEA Blood samples from 154 patients that were submitted to
deletion, which occurs with a frequency of 4.5% to 14%.8 MDS Metro Laboratory Services, Burnaby, British
The – –MED and – –20.5 deletions are found in Mediterranean Columbia, for thalassemia or hemoglobinopathy investiga-
and Arab populations with a frequency ranging from less tion were included in the initial evaluation ❚Table 1❚ .
than 0.1% to 0.7%. A majority of these, more than 70% in Samples from all patients were tested in parallel with
most populations, are the – –MED deletion.1 The –α3.7 and existing methods. Group 1 included samples from all
–α4.2 deletions are found in Mediterranean, Arab, Indian, patients referred for thalassemia or hemoglobinopathy inves-
Southeast Asian, Chinese, and Oceanian populations, with a tigation during a 1-week period. Group 2 included samples
frequency ranging from 2.2% to more than 26% in some selected according to the following criteria: positive HbH
regions. A majority of these, more than 80% in most popula- prep result or an MCV of 82 µm3 (82 fL) or less. Whole
tions, are the –α3.7 deletion.1 The population served by our blood samples were stored at 4°C for up to 1 week before
facility has a large proportion of people of Asian ethnicity. In molecular analysis.
Washington State, which has similar demographics to those
of southern British Columbia, anomalies of the alpha-globin Postimplementation Study
gene complex were detected in 66% of Asian American Following the initial evaluation, an algorithm was
patients referred for reproductive reasons.14 The importance established to select patients with a negative HbH prep
of genotyping to family planning is significant, particularly result and an MCV of 82 µm3 (82 fL) or less or diagnosed
in Asian ethnic communities, owing to the high frequency of with other hemoglobinopathies (group 3) for further DNA
alpha0-thalassemia mutations in this population.9,10,14-17 testing. During this period, an additional 298 samples were
In general, laboratory diagnosis of alpha0-thalassemia submitted for PCR analysis. Samples from patients younger
carriers is performed by the HbH inclusion body test (HbH than 4 years were excluded from the study. Whole blood
© American Society for Clinical Pathology Am J Clin Pathol 2002;118:18-24 19Jones and Poon / PCR SCREEN FOR ALPHA-THALASSEMIA IN A CLINICAL LABORATORY
❚Table 1❚
Summary of Groups
Group Sample Numbers Inclusion Criteria
1 1-89 All patients referred for thalassemia or hemoglobinopathy investigation during a 1-week period
2 90-154 Positive results on HbH prep or MCV ≤82 µm3 (≤82 fL)
3 155-452 Negative results on HbH prep and MCV ≤82 µm3 (≤82 fL) or diagnosed with other hemoglobinopathies
HbH prep, hemoglobin H inclusion body test; MCV, mean corpuscular volume.
samples were stored at 4°C for up to 1 week before molec- minutes. Following amplification, 10-µL aliquots were
ular analysis and were analyzed in batches of at least 6 mixed with bromphenol blue–xylene cyanol loading dye
specimens. (Sigma-Aldrich, Oakville, Ontario) and electrophoresed
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
through an 0.8% agarose gel (Bio-Rad, Mississauga) in 1×
Blood Samples Tris-borate-EDTA buffer for 1 hour at 5-6 V/cm. The gel
DNA was extracted from blood samples using the DNA was prepared with ethidium bromide (Sigma-Aldrich), and
MiniKit (Qiagen, Mississauga, Ontario) following the manu- once electrophoresis was complete, the amplified products
facturer’s suggested protocol. Briefly, blood was subjected to were visualized on a UV transilluminator housed in the
Proteinase K digestion in lysis buffer, followed by binding to GelDoc system (Bio-Rad). Images were processed on the
a silicon membrane and a series of washes in the presence of computer and printed on a laser printer for documentation.
chaotropic salts. Pure nucleic acid was eluted from the
membrane in 200 µL of buffer and subsequently stored at
–20°C. This protocol yields between 4 and 12 µg of purified
Results
DNA from 200 µL of whole blood.
The PCR analysis was performed as described on 452
Current Diagnostic Approach peripheral blood samples (154 in the initial evaluation of the
Blood samples included in the study were subjected to method and 298 in subsequent analyses of suggestive but
the standard hematologic analysis performed at MDS Metro unconfirmed cases). All samples were amplified and geno-
Laboratory Services. Initial screening tests for thalassemia typed independently of the hematologic evaluation. In all
and the hemoglobinopathies include a CBC count, blood cases, the internal control was amplified successfully.
film examination, and high-performance liquid chromatog- Appropriate alpha-globin genotypes were assigned as
raphy for the measurement of hemoglobin A2 and hemo- shown in ❚Table 3❚ (initial evaluation) and ❚Table 4❚
globin F levels and the detection of hemoglobin variants. We (postimplementation study).
suspect alpha-thalassemia in patients with a decreased MCV
if no thalassemic hemoglobinopathy is detected by initial ❚Table 2❚
screening. In these cases, an HbH prep is performed by Primers Used in the Single-Tube Multiplex Polymerase Chain
staining RBCs with brilliant cresyl blue and looking for the Reaction for Detection of Common Deletional Determinants
of alpha-Thalassemia
presence of HbH inclusion bodies (positive HbH prep).
Fragment Size
Multiplex PCR Analysis Primer Name 5'-3' Sequence (Base Pairs)
PCR conditions were as described previously,16 with LIS1-F GTCGTCACTGGCAGCGTAGATC 2,503
minor changes. In brief, PCR was performed using approxi- LIS1-R GATTCCAGGTTGTAGACGGACTG
alpha2/3.7-F CCCCTCGCCAAGTCCACCC 2,022/2,029
mately 75 ng of genomic DNA in 25-µL reaction volumes 3.7/20.5-R AAAGCACTCTAGGGTCCAGCG
containing 1.5-mmol/L magnesium chloride; 0.2-µmol/L alpha2/3.7-F Refer to primer of same name shown above 1,800
alpha2-R AGACCAGGAAGGGCCGGTG
each primer ❚Table 2❚, including 2 primers that target the 4.2-F GGTTTACCCATGTGGTGCCTC 1,628
LIS1 gene and that act as internal controls; 200-µmol/L 4.2-R CCCGTTGGATCTTCTCATTTCCC
deoxynucleoside triphosphates; 2.5 U of Taq polymerase SEA-F CGATCTGGGCTCTGTGTTCTC 1,349
SEA-R AGCCCACGTTGTGTTCATGGC
(Qiagen); and a proprietary additive provided with the FIL-F TGCAAATATGTTTCTCTCATTCTGTG 1,166
Qiagen Taq polymerase (Q Solution). Cycling was carried FIL-R ATAACCTTTATCTGCCACATGTAGC
20.5-F GCCCAACATCCGGAGTACATG 1,007
out on a 9600 thermal cycler (Perkin-Elmer, Foster City, CA) 3.7/20.5-R Refer to primer of same name shown above
with an initial 5-minute denaturation at 95°C, followed by 30 MED-F TACCCTTTGCAAGGACACGTAC 807
MED-R TCAATCTCCGACAGCTCCGAG
cycles at 97°C for 45 seconds, 60°C for 75 seconds, and
72°C for 150 seconds and a final extension at 72°C for 5 F, forward; R, reverse.
20 Am J Clin Pathol 2002;118:18-24 © American Society for Clinical PathologyHematopathology / ORIGINAL ARTICLE
❚Table 3❚
Correlation of Hematology Results With alpha-Globin Genotypes in the Initial Evaluation
Hematologic Diagnosis MCV, µm3 (fL)
alpha- Hemoglobin beta-
Thalassemia Trait H Disease Thalassemia Trait ≤82 (≤
≤82) >82 (>82) Total
Group 1
HbH prep positive 13 1 0 0 0 14
Genotype (PCR)
αα/αα 3 0 14 18 31 66
– –SEA/αα 10 0 1 2 0 13
– –SEA/–α3.7 0 1 0 0 0 1
–α3.7/αα 0 0 0 2 3 5
–α3.7/–α3.7 0 0 0 3 0 3
–α3.7/–α4.2 0 0 0 1 0 1
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
Total 13 1 15 26 34 89
Group 2
HbH prep positive 36 0 0 0 0 36
Genotype (PCR)
αα/αα 2 0 9 13 0 24
– –SEA/αα 33 0 0 1 0 34
– –SEA/–α3.7 0 0 0 0 0 0
–α3.7/αα 0 0 0 5 0 5
–α3.7/–α3.7 0 0 0 1 0 1
–α3.7/–α4.2 0 0 0 0 0 0
– –MED/αα 1 0 0 0 0 1
Total 36 0 9 20 0 65
HbH prep, hemoglobin H inclusion body test; MCV, mean corpuscular volume; PCR, polymerase chain reaction.
❚Table 4❚
Correlation of Hematology Results With alpha-Globin Genotypes in the Postimplementation Evaluation (Group 3)*
Hematologic Diagnosis
None beta-
Genotype (PCR) Detected† Thalassemia HbE Trait HbE Disease HbS Trait HbC Trait HbD Trait Total
αα/αα 99 85 3 0 0 0 0 187
– –SEA/αα 26 4 2 1 0 0 1 34
–α3.7/αα 45 7 1 0 1 1 0 55
–α3.7/–α3.7 13 0 0 0 2 0 0 15
–α3.7/–α4.2 5 0 0 0 0 0 0 5
–α4.2/αα 2 0 0 0 0 0 0 2
Total 190 96 6 1 3 1 1 298
Hb, hemoglobin; PCR, polymerase chain reaction.
* See the text for a description of the groups.
† No hemoglobinopathy detected.
Initial Evaluation result consistent with heterozygous alpha0-thalassemia. All
The initial evaluation analyzed 154 specimens, specimens carried the – –SEA deletion; the remaining 3 cases
divided into 2 groups. In group 1, which consisted of 89 were negative by PCR. One patient with beta-thalassemia-
samples, standard hematologic methods diagnosed 13 trait also was found to be a carrier of the – –SEA deletion. The
alpha-thalassemia cases, 15 beta-thalassemia cases, and 1 1 patient diagnosed by HbH prep with hemoglobin H disease
case of hemoglobin H disease. Of the remaining 60 speci- had the common genotype (– –SEA/–α3.7). Various deletions
mens, 34 were hematologically normal, while 26 had of the alpha-globin genes were identified in 8 of 26 cases
microcytosis (MCV, 82 µm3 [82 fL] or less) but could not with no detectable hemoglobinopathy and an MCV of 82
be confirmed as either alpha- or beta-thalassemia cases by µm3 (82 fL) or less. Genotypes detected were as follows:
HbH prep or by high-performance liquid chromatography. – –SEA/αα, 2; –α3.7/αα, 2; –α3.7/–α3.7, 3; and –α3.7/–α4.2, 1.
In this cohort of patients, the carrier rate for alpha- Of 34 patients with an MCV of more than 82 µm3 (>82 fL),
thalassemia was 16% (14/89). 3 were heterozygous carriers for the 3.7-kb single gene dele-
PCR analysis of group 1 confirmed the diagnosis of tion (–α3.7/αα). HbH prep and PCR results for group 1 are
alpha0-thalassemia in 10 of 13 cases that had an HbH prep shown in Table 3.
© American Society for Clinical Pathology Am J Clin Pathol 2002;118:18-24 21Jones and Poon / PCR SCREEN FOR ALPHA-THALASSEMIA IN A CLINICAL LABORATORY
The sensitivity and specificity of the HbH prep Discussion
compared with the multiplex PCR for the detection of
alpha0-thalassemia carriers were 0.79 and 0.96, respectively. We evaluated the effectiveness of a multiplex PCR
The sensitivity and specificity of the HbH prep compared targeting 6 common alpha-globin deletions compared with a
with the multiplex PCR for detection of all alpha- low MCV and a positive HbH prep result in the diagnosis of
thalassemia genotypes were 0.48 and 0.96, respectively. The alpha-thalassemia when other causes of microcytosis had
sensitivity and specificity of an MCV of 82 µm3 (82 fL) or been excluded. In an analysis of unselected specimens
less for alpha 0 -thalassemia carriers were 1.0 and 0.45, referred for thalassemia or hemoglobinopathy investigation
respectively. The sensitivity and specificity of an MCV of (group 1), the sensitivity and specificity of the HbH prep
82 µm3 (82 fL) or less compared with the multiplex PCR for compared with the multiplex PCR for detection of alpha0-
all alpha-thalassemia genotypes detected were 0.87 and thalassemia were 0.79 and 0.96, respectively. The sensitivity
0.47, respectively. of the HbH prep was significantly lower for detection of all
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
In group 2, 65 samples were selected for PCR analysis alpha-thalassemia genotypes (0.48), although the specificity
based on positive HbH prep results or an MCV of 82 µm3 remained high. It is well recognized that the HbH prep result
(82 fL) or less. Standard hematologic methods diagnosed 36 is seldom positive in alpha+-thalassemia cases18; thus, the
cases of alpha-thalassemia and 9 cases of beta-thalassemia low sensitivity for detection of all alpha-globin deletions was
trait. In 20 specimens, indices were suggestive of not unexpected. In the follow-up evaluation of 298 additional
thalassemia, ie, no detectable hemoglobinopathy and an cases (group 3) with suggestive alpha-thalassemia indices
MCV of 82 µm3 (82 fL) or less. and a negative HbH prep result or diagnosed with another
PCR analysis of group 2 samples confirmed the diag- hemoglobinopathy, 111 cases of alpha-globin gene deletions
nosis of alpha0-thalassemia in 34 of 36 cases with an HbH (37.2%) were observed. Of these, 34 patients (30.6%) were
prep result consistent with heterozygous alpha0-thalassemia. found to have alpha0-thalassemia. These data clearly demon-
All but 1 patient carried the – –SEA deletion, and that patient strate the superior effectiveness of the multiplex PCR over
carried the – –MED deletion. None of the beta-thalassemia the HbH prep in the diagnosis of alpha0-thalassemia and
cases exhibited deletions in the alpha-globin gene complex. other alpha-thalassemia genotypes.
Various alpha-globin gene deletions were detected in 7 of Use of MCV cutoff levels is an established method for
the 20 cases that were suggestive of thalassemia. Geno- selecting presumptive alpha-thalassemia cases. In the initial
types detected were as follows: – –SEA/αα, 1; –α3.7/αα, 5; evaluation of 89 specimens submitted for thalassemia or
and –α3.7/–α3.7, 1. HbH prep and PCR results are shown in hemoglobinopathy investigation (group 1), the sensitivity
Table 3. and specificity of an MCV of 82 µm 3 (82 fL) or less
The sensitivity and specificity of the HbH prep compared with the multiplex PCR for detection of alpha0-
compared with the multiplex PCR for the detection of thalassemia carriers were 1.0 and 0.45, respectively. The
alpha0-thalassemia carriers were 0.97 and 0.93, respectively. sensitivity for detection of all alpha-thalassemia genotypes
The sensitivity and specificity of the HbH prep compared was 0.87, while specificity remained low (0.47). Three
with the multiplex PCR for all alpha-thalassemia genotypes patients in this group, with an MCV of more than 82 µm3
detected were 0.83 and 0.92, respectively. (>82 fL), had the –α3.7/αα genotype. Use of the MCV cutoff
of 82 µm3 (82 fL) would preclude diagnosis of these cases as
Postimplementation Study alpha-thalassemia trait. We found that the majority of
The postimplementation study analyzed 298 specimens patients with a single gene deletion genotype also had a low
(group 3). Of these, standard hematologic methods revealed MCV, and only 3 patients in this group were hematologically
96 cases of beta-thalassemia trait (Table 4), 12 other hemo- normal. However, since these patients are not carriers for
globinopathies, and 190 specimens with an MCV of 82 µm3 hemoglobin Bart hydrops fetalis and would not be misdiag-
(82 fL) or less in which no hemoglobinopathy was detected. nosed with iron deficiency anemia, the clinical significance
PCR analysis identified alpha-globin deletions in 11 of not diagnosing them is low. Use of an MCV of 82 µm3 (82
(11%) of 96 beta-thalassemia cases (– –SEA/αα, 4 cases; fL) or less is a safe and effective means of selecting patients
–α3.7/αα, 7 cases). Among the 12 cases with other diagnosed for further investigation for alpha-thalassemia.
hemoglobinopathies, 9 (75%) also carried alpha-globin gene Selection of specimens by an MCV of 82 µm3 (82 fL) or
deletions: – –SEA/αα, 4; –α3.7/αα, 3; and –α3.7/–α3.7, 2. PCR less improved the sensitivity of the HbH prep compared with
analysis of the 190 cases without a detectable hemoglo- the multiplex PCR. In an analysis of 65 samples with an
binopathy showed that 91 (47.9%) were carriers of alpha- MCV of 82 µm3 (82 fL) or less (group 1), the sensitivity of
globin deletion mutations: – –SEA/αα, 26; –α3.7/αα, 45; the HbH prep for detection of alpha0-thalassemia was 0.97,
–α3.7/–α3.7, 13; –α3.7/–α4.2, 5; and –α4.2/αα, 2. and the specificity also was high (0.93). Detection of all
22 Am J Clin Pathol 2002;118:18-24 © American Society for Clinical PathologyHematopathology / ORIGINAL ARTICLE
alpha-thalassemia genotypes also was improved, with a alpha-thalassemia. Initial screening by a low MCV, an HbH
sensitivity of 0.83 and a specificity that remained relatively prep, and the absence of other hemoglobinopathies can be
unchanged (0.92). Application of this strategy produced a followed by DNA studies for known common alpha-globin
significant improvement in the sensitivity of the HbH prep genotypes. The use of a low MCV plus the HbH prep is
for the diagnosis of alpha0-thalassemia, while maintaining sufficiently sensitive for the diagnosis of alpha0-thalassemia
high specificity. This suggests that the HbH prep is useful in cases in laboratories without molecular capabilities.
laboratories where PCR is not available. It also suggests that However, this multiplex PCR is an efficient addition to the
the HbH prep is valuable in laboratories that have PCR capa- testing algorithm in a clinical laboratory for the investigation
bilities, as it can assist in diagnosing alpha0-thalassemia of thalassemia or hemoglobinopathy cases. In addition, the
cases without the need for subjecting all specimens with an multiplex PCR is a valuable tool for screening all patients
MCV of 82 µm3 (82 fL) or less to PCR analysis. with microcytosis undergoing prenatal evaluation, regardless
In the initial evaluation (groups 1 and 2), 5 cases with of other diagnosed hemoglobinopathies.
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
positive HbH prep results failed to demonstrate any of the
common deletional mutations included in the multiplex
PCR. These patients likely have a nondeletional form of
Conclusions
alpha-thalassemia, a deletional form not included in the
PCR, or an acquired form of alpha-thalassemia. Detection of The multiplex PCR used in the present study was more
these cases by the HbH prep supports the value of HbH effective for the diagnosis of alpha-thalassemia than the
inclusion body screening, even in laboratories with DNA HbH prep. The data shown here demonstrate that using an
diagnostic capabilities. MCV threshold of 82 µm3 (82 fL) or less is an effective
Analysis of 298 specimens (group 3) with suggestive means of selecting patients for alpha-thalassemia investiga-
alpha-thalassemia indices or another diagnosed hemoglo- tion. Furthermore, it substantially increases the sensitivity of
binopathy identified 111 patients (37.2%) with alpha-globin the HbH prep for the detection of alpha0-thalassemia. The
gene deletions that were undetected by the HbH prep. Of HbH prep, when used in conjunction with a low MCV,
these, 34 (30.6%) had the – –SEA/αα genotype, 7 of which continues to have value for the diagnosis of alpha 0 -
occurred in patients with other hemoglobinopathies that thalassemia in laboratories where PCR methods are not
cause microcytosis. These data demonstrate the requirement available. In addition, the HbH prep continues to be useful
for DNA testing for alpha-thalassemia in all patients with for the detection of nondeletional, rare deletional, and
microcytosis who undergo prenatal screening regardless of acquired forms of alpha-thalassemia in laboratories that
other hemoglobinopathies detected. perform PCR testing. Given the cost-efficiency of targeting
Only 1 – –MED deletion was detected during the present multiple deletions, the ethnic variability of the population
study, and neither the – –FIL nor the – –20.5 deletion was served by this laboratory, and the good sensitivity of the
observed. Although the published prevalence of these dele- HbH prep when used in conjunction with a low MCV, a
tions is low,1 the population served by this laboratory is multitiered strategy that involves conventional testing
diverse and includes ethnic groups in which these deletions including the HbH prep, followed by DNA studies using the
may occur. Targeted DNA investigation is a potential option multiplex described herein can provide an efficient method
if the ethnicity of the patient is known; however, this infor- for the diagnosis of alpha-thalassemia. Our data demonstrate
mation is not readily available to us and cannot be presumed. that no single method is capable of identifying all carriers of
In addition, multiracial births may present mutations not alpha-thalassemia, and the diagnostic approach must include
expected in a given ethnic group.8 Use of additional primers a combination of techniques. Our results also underscore the
in a single multiplex reaction has little effect on the cost of importance of DNA studies in all patients with microcytosis
providing the service. The largest component of any DNA- undergoing a prenatal workup for thalassemia, regardless of
based method is labor. Thus, providing a single, inclusive other hemoglobinopathies detected.
PCR approach is substantially more cost-effective than
offering a limited, more targeted approach, with additional From MDS Metro Laboratory Services, Burnaby, British
follow-up in cases with negative results. The inclusion of the Columbia.
primers targeting the 6 common deletions in a single multi- Address reprint requests to Dr Poon: MDS Metro Laboratory
plex PCR is a cost-effective and efficient means for Services, 3680 Gilmore Way, Burnaby, British Columbia, Canada
providing the best possible adjunct method to our diagnostic V5G 4V8.
capabilities. Acknowledgment: We gratefully acknowledge Debbie
Our results demonstrate that the multiplex PCR is a Griswold, MD, FRCP(C), for review and comments during
useful addition to the diagnostic strategy for detection of manuscript preparation.
© American Society for Clinical Pathology Am J Clin Pathol 2002;118:18-24 23Jones and Poon / PCR SCREEN FOR ALPHA-THALASSEMIA IN A CLINICAL LABORATORY
References 11. Chan LC, Ma SK, Chan AYY, et al. Should we screen for
globin gene mutations in blood samples with mean
1. Bernini LF. Geographic distribution of alpha-thalassemia. In:
corpuscular volume (MCV) greater than 80 fL in areas with
Steinberg MH, Forget BG, Higgs DR, et al, eds. Disorders of
high prevalence of thalassemia? J Clin Pathol. 2001;54:317-
Hemoglobin: Genetics, Pathophysiology, and Clinical
320.
Management. New York, NY: Cambridge University Press;
2001:878-894. 12. Higgs DR, Vickers MA, Wilkie AO, et al. A review of the
molecular genetics of the human alpha-globin gene cluster.
2. Shaji RV, Srivastava A, Chandy M, et al. A single tube
Blood. 1989;73:1081-1104.
multiplex PCR method to detect the common alpha+
thalassemia alleles [letter]. Blood. 2000;95:1879-1880. 13. Goldbloom RB. Screening for hemoglobinopathies in
Canada. In: Canadian Task Force on the Periodic Health
3. Forget BG. Molecular genetics of the human globin genes. In:
Examination, ed. Canadian Guide to Clinical Preventive Health
Steinberg MH, Forget BG, Higgs DR, et al, eds. Disorders of
Care. Ottawa, Ontario: Health Canada; 1994:206-218.
Hemoglobin: Genetics, Pathophysiology, and Clinical
Management. New York, NY: Cambridge University Press; 14. Hofgartner WT, West Keefe SF, Tait JF. Frequency of deletional
2001:117-130. alpha-thalassemia genotypes in a predominantly Asian-
American population. Am J Clin Pathol. 1997;107:576-581.
4. Clarke GM, Higgins TN. Laboratory investigation of hemo-
Downloaded from https://academic.oup.com/ajcp/article/118/1/18/1758259 by guest on 25 January 2022
globinopathies and thalassemias: review and update. Clin 15. Working party of the General Haematology Task Force
Chem. 2000;46:1284-1290. (BCSH). Guideline: the laboratory diagnosis of
haemoglobinopathies. Br J Haematol. 1998;101:783-792.
5. Maragoudaki E, Kanavakis E, Traeger-Synodinos J, et al.
Molecular, haematological and clinical studies of the –101 16. Chong SS, Boehm CD, Higgs DR, et al. Single-tube
C → T substitution of the beta-globin gene promoter in 25 multiplex-PCR screen for common deletional determinants of
beta-thalassemia intermedia patients and 45 heterozygotes. alpha-thalassemia. Blood. 2000;95:360-362.
Br J Haematol. 1999;107:699-706. 17. Chan V, Yam I, Chen FE, et al. A reverse dot-blot method for
6. Cabeda JM, Correia C, Estevinho A, et al. Unexpected rapid detection of non-deletion alpha thalassemia. Br J
pattern of beta-globin mutations in beta-thalassemia patients Haematol. 1999;104:513-515.
from northern Portugal. Br J Haematol. 1999;105:68-74. 18. Higgs DR, Bowden DK. Clinical and laboratory features of
7. Miale JB. The hemoglobinopathies. In: Laboratory Medicine in the alpha-thalassemia syndromes. In: Steinberg MH, Forget
Hematology. 5th ed. St Louis, MO: Mosby; 1977:750-757. BG, Higgs DR, et al, eds. Disorders of Hemoglobin: Genetics,
8. Lorey F, Cunningham G, Vichinsky EP, et al. Universal Pathophysiology, and Clinical Management. New York, NY:
newborn screening for Hb H disease in California. Genet Test. Cambridge University Press; 2001:431-469.
2001;5:93-100. 19. Chang JG, Liu TC, Chiou SS, et al. Rapid detection of
9. Harteveld CL, Beijer C, van Delft P, et al. alpha-Thalassemia –alpha4.2 deletion of alpha-thalassemia-2 by polymerase chain
as a result of a novel splice donor site mutation of the alpha reaction. Ann Hematol. 1994;69:205-209.
1-globin gene. Br J Haematol. 2000;110:694-698. 20. Dode C, Labie D, Rochette J. Types of alpha+ thalassemia in
10. Liu YT, Old JM, Miles K, et al. Rapid detection of alpha- Southeast Asian refugees. Ann Genet. 1988;31:201-204.
thalassemia deletions and alpha-globin gene triplication by 21. Baysal E, Huisman TH. Detection of common deletional
multiplex polymerase chain reactions. Br J Haematol. alpha-thalassemia-2 determinants by PCR. Am J Hematol.
2000;108:295-299. 1994;46:208-213.
24 Am J Clin Pathol 2002;118:18-24 © American Society for Clinical PathologyYou can also read
