Dynamics of Myc/Max/Mad Expression during Luteinization of Primate Granulosa Cells in Vitro: Association with Periovulatory Proliferation
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
0013-7227/03/$15.00/0 Endocrinology 144(4):1249 –1256
Printed in U.S.A. Copyright © 2003 by The Endocrine Society
doi: 10.1210/en.2002-220664
Dynamics of Myc/Max/Mad Expression during
Luteinization of Primate Granulosa Cells in Vitro:
Association with Periovulatory Proliferation
CHARLES L. CHAFFIN, REBECCA S. BROGAN, RICHARD L. STOUFFER,
CATHERINE A. VANDEVOORT
Department of Physiology, Medical College of Georgia (C.L.C., R.S.B.), and Veterans Affairs Medical Center (R.S.B.),
Augusta, Georgia 30912; Department of Physiology and Pharmacology, Oregon Regional Primate Research Center (R.L.S.),
Beaverton, Oregon 97006; and California National Primate Research Center, University of California (C.A.V.), Davis,
California 95616
Granulosa cell luteinization involves the attenuation of by hCG, suggesting that changes in the expression of this gene
gonadotropin-induced proliferation. Although recent evi- may further regulate the activity of Myc and Mad. To deter-
dence indicates that primate granulosa cells stop dividing mine whether other cell cycle regulatory families are involved
within 12 h of an ovulatory stimulus, early events in cell cycle in luteinization, the expression of p53 and the wild-type
arrest remain unknown. In the current study an in vitro model p53-inducible phosphatase (wip1) was examined. Similar to
of primate granulosa cell luteinization is established that al- Mad and Max, p53 and wip1 are transiently repressed by hCG,
lows assessment of early events in terminal differentiation. A suggesting that the p53 and Mad pathways have either par-
luteinizing dose of human chorionic gonadotropin (hCG) allel or cooperative roles in luteinization. Thus, luteinization
results in a secondary rise in proliferation before cell cycle of primate granulosa cells is preceded by a burst of prolifer-
arrest that is paralleled by a transient increase in the expres- ation that is regulated by changes in the relative levels of
sion of c-Myc. In contrast, the c-Myc antagonists Mad1, Mad4, c-Myc, Max, and Mad as well as p53. (Endocrinology 144:
and Mxi1 are transiently repressed by hCG. Max, the common 1249 –1256, 2003)
dimerization partner for Myc and Mad, is similarly repressed
L UTEINIZATION of primate granulosa cells is charac-
terized by rapid changes in steroidogenesis, the ex-
pression of proteolytic enzymes, and, importantly, the at-
complexes capable of binding E box promoter elements and
trans-activating target genes (7). The best characterized mem-
ber of this group is the protooncogene c-myc, which typically
tenuation of proliferation (1). The duration of time between facilitates movement of cells into the DNA synthesis (S)
an ovulatory stimulus and follicle rupture (i.e. periovulatory phase of the cell cycle (8). In contrast, the Mad proteins
interval) in primates is 36 – 40 h. Recent evidence indicates (Mad1, Mad3, Mad4, Mxi1, and Mnt) are a group of naturally
that greater than 85% of primate granulosa cells exit the cell occurring c-Myc antagonists that compete with c-Myc for
cycle within 12 h of an ovulatory stimulus (2); thus, regu- access to Max and E box promoter sites and are thus asso-
lation of genes leading to cell cycle exit occurs rapidly in ciated with cell cycle arrest and differentiation (9). In this
response to an ovulatory stimulus. Although an important model, Myc/Max heterodimers act to progress the cell cycle,
early event in cell cycle exit by rat granulosa cells is down- while Mad/Max complexes function as cell cycle repressors.
regulation of the cyclin D2 gene (3), this is not the case in For example, enforced expression of Mad prevents entry into
primates. In rhesus monkeys undergoing controlled ovarian the S phase and can inhibit transformation by overexpressed
stimulation (COS), cyclin D2 mRNA is transiently increased c-Myc (10). Although there is evidence that c-Myc and Mad
12 h after an ovulatory stimulus (2), suggesting that primate gene targets are not entirely overlapping (9), it nevertheless
granulosa cells may undergo an additional round of cell remains possible that the ratio of Myc:Mad dictates whether
division before achieving a final luteal phenotype. The ob- a given cell will proliferate or differentiate (7). Because exit
servation that granulosa cells from rats and macaques ex- from the cell cycle may be an important step in the terminal
press c-Myc after an ovulatory stimulus suggests that this differentiation of many cell types, the interaction between
gene may act as a switch mechanism between proliferating c-Myc and the Mad proteins in the control of the cell cycle
and luteinizing follicles (4 – 6). is a critical issue.
The Myc/Max/Mad family of transcription factors is The transition from a follicle to a corpus luteum in pri-
linked closely to proliferation, differentiation, and apoptosis. mates is not well understood, especially the early events,
Members of this family heterodimerize with Max to form which are exceedingly difficult to study. An in vitro model of
primate granulosa cell luteinization was developed with
Abbreviations: COS, Controlled ovarian stimulation; CNPRC, Cali- which to examine events occurring immediately after the
fornia National Primate Research Center; DNase, deoxyribonuclease;
hCG, human chorionic gonadotropin; PCNA, proliferating cell nuclear
initiation of the periovulatory interval. This model was used
antigen; PR, progesterone receptor; PVA, polyvinylalcohol; r-hFSH, re- to test the hypothesis that a luteinizing dose of gonadotropin
combinant human FSH; tk, thymidine kinase; TL, tyrode lactate. induces rapid changes in the expression of the Myc/Max/
12491250 Endocrinology, April 2003, 144(4):1249 –1256 Chaffin et al. • Luteinization of Macaque Granulosa Cells
Mad family consistent with a role for these genes in the the cell suspension. Cells were placed in a biohazard shipping container
terminal differentiation of primate granulosa cells. and were shipped from the CNPRC to the Medical College of Georgia
by overnight delivery at ambient temperature from September to June.
Upon receipt, cells were recovered by centrifugation, and viability, as
Materials and Methods determined by trypan blue exclusion, remained over 85%.
Animals
In vitro luteinization of macaque granulosa cells
Adult female rhesus macaques (Macaca mulatta) were housed at the
California National Primate Research Center (CNPRC) as previously Granulosa cells were plated overnight at 37 C with an initial seeding
described (11). Animal protocols and experiments were approved by the density of 5 ⫻ 105 viable cells/well in 24-well plates precoated with
CNPRC animal care and use committee, and studies were conducted in fibronectin in DMEM/Ham’s F-12 supplemented with 20 mm HEPES,
accordance with the Guide for the Care and Use of Laboratory Animals penicillin/streptomycin (50 U/ml), 1% fetal calf serum, and 50 ng/ml
(12). After the onset of menstruation, adult female rhesus monkeys were hFSH (Sigma-Aldrich, F4021). Preliminary experiments using [3H]thy-
treated with recombinant human FSH (r-hFSH; Ares-Serono, Randolph, midine uptake verified that macaque granulosa cells remain prolifera-
MA; or Organon, West Orange, NJ; 37.5 IU, im, twice daily) for 7 d. tive during this initial plating interval in response to 50 ng/ml hFSH
Antide (Ares-Serono; 5 mg/kg body weight, sc, once daily) was ad- (data not presented). After the initial overnight seeding period, media
ministered daily to prevent endogenous gonadotropin secretion. Folli- were changed to include either 50 ng/ml hFSH to maintain a prolifer-
cles were aspirated the morning after the last dose of r-hFSH by an ative phenotype (controls) or 20 IU/ml human chorionic gonadotropin
ultrasound-guided procedure as previously described (11). Aspirates (hCG; Sigma-Aldrich) to induce luteinization. Cultures were terminated
were maintained at approximately 35 C within a temperature-controlled either before medium change (0 h) or 1, 4, 8, 18, or 48 h after the addition
isolette at all times. Oocytes were removed by transferring the aspirate of hCG or hFSH. Cell extracts were harvested as described below, and
to a 24-mm diameter, 70-m pore size filter (Netwell Inserts 3479, Corn- media were retained for the measurement of steroid concentrations
ing, Inc., Acton, MA), and the tube was rinsed with fresh tyrode lactate using a commercially available RIA kit (Diagnostic Products, Los An-
(TL)-HEPES/polyvinylacohol (PVA) medium (TL-HEPES/0.1 mg/ml geles, CA).
PVA; Ref. 13) that was also poured onto the filter. The filter was rinsed
further with fresh TL-HEPES/PVA medium until blood cells were re- [3H]Thymidine uptake
moved. The rinse from the filter was saved for the recovery of granulosa
cells (see below). Granulosa cells were cultured and hormonally treated as described
above, and [3H]thymidine uptake was determined at 0, 4, 8, 12, 24, and
Preparation of macaque granulosa cells 48 h post-hCG (n ⫽ 3 animals). In brief, [3H]thymidine (2 Ci) was added
to cultures 2 h before termination. Unincorporated [3H]thymidine was
Granulosa cells were recovered from the filter rinse by a modification removed with four rinses of room temperature DMEM/Ham’s F-12,
of the method previously described (14). Briefly, the cell suspension was followed by 6-min incubation with trypsin (0.25%)/EDTA (0.1%) at 37
centrifuged for 5 min at 300 ⫻ g to pellet the red cells; this was then C. The resulting detached cells were pelleted and solubilized in 50 l
increased to 500 ⫻ g for an additional 5 min, resulting in a thin layer of 10% sodium dodecyl sulfate for 10 min at room temperature before
granulosa cells over the red cell pellet. The supernatant was removed, determining the counts per minute.
and the layer of granulosa cells was transferred to a 40% Percoll gradient
in medium 199 (Sigma-Aldrich, St. Louis, MO) and centrifuged for 30 RNA analysis
min at 500 ⫻ g. The supernatant was removed, and the granulosa cells
were recovered from the surface of the Percoll with a Pasteur pipette and To maximize the amount of information obtained from limited num-
washed once with TL-HEPES/PVA. The cell pellet was resuspended in bers of granulosa cells, an RT-PCT assay was employed. Total RNA was
1 ml TL-HEPES/PVA and counted on hemocytometer. An additional 14 extracted from granulosa cells using TRIzol (Life Technologies, Inc.,
ml TL-HEPES/PVA supplemented with 5 g/ml r-hFSH were added to Gaithersburg, MD) according to the manufacturer’s instructions, and
TABLE 1. Primer sequences
Name Sequence (5⬘–3⬘) Primer conc. (pmol) Size (bp) Ref.
PR up GTGGTCTAAATCATTGCCAGGTTTTCG PR, 20 410 18
dn ACGATGTGAGCTCGACACAAGTC GAPDH, 4
c-myc up CCAGCAGCGACTCTGAGG c-myc, 20 344 NA
dn CCAAGACGTTGTGTGTTC MG, 6
max up ACGATGACATCGAGGTGGAGAG max, 20 51 NA
dn GCATTATGATGAGCCCGTTT GAPDH, 2
mad1 up CCAGGTGGAGCGGGAGAAAATGC mad1, 20 318 NA
dn CCACTGCAGTTCCGAGATCCTCC GAPDH, 2
mad4 up CGACTTCGCCAGGGAGAAAAC mad4, 20 250 NA
dn GCTGCTCCTTGATGCTCAGTG GAPDH, 8
mxi1 up GCCAGCACCAGCTCGAGAATTTGG mxi1, 20 252 NA
dn CTCGGCAGGCTGCTGTGG MG, 3
cyclin D2 up TCATGACTTCATTGAGCA cyclin D2, 20 192 2
dn CACTTCCTCATCCTGCTG GAPDH, 6
p53 up AGCAGTCACAGCACATGACG p53, 20 200 NA
dn TGGTACAGTCAGAGCCAACC MG, 4
wip1 up GGGGTGAATCGTGTAGTTTGGAAACG wip1, 50 194 NA
dn CTGAGGGTCAAGAGTGTGGACAC MG, 8
tk1 up GAGTTCTGCGAGGCCATG tk-1, 20 317 NA
dn GGCTTTCCTGGCACTGGG MG, 5
wip1, Wild-type p53-inducible phosphatase; NA, not applicable.Chaffin et al. • Luteinization of Macaque Granulosa Cells Endocrinology, April 2003, 144(4):1249 –1256 1251
contaminating genomic DNA was removed by treating the extract with pending cells in 100 l F-buffer (16): 10 mm Tris (pH 7.05), 50 mm NaCl,
ribonuclease-free deoxyribonuclease I (DNase I; Life Technologies, Inc.) 30 mm sodium pyrophosphate, 50 mm sodium fluoride, 5 mm zinc chloride,
for 15 min at room temperature. DNase I was subsequently inactivated 100 mm sodium orthovanadate (Na3VO4), Triton X-100, and mixed protease
by the addition of 1 l 25 mm EDTA for 15 min at 65 C. RT was carried inhibitors (one tablet/25 ml; Complete Protease Inhibitors, Roche Molec-
out for 2 h at 37 C in a 20-l reaction volume using 10-l DNase I ular Biochemicals) for 10 min on ice, followed by vortexing for 45 sec.
reaction, single strength RT buffer [50 mm Tris-Cl (pH 8.3), 40 mm KCl, Lysates were cleared by centrifugation at 15,000 rpm and 4 C for 15 min,
and 6 mm MgCl2], 1 mm dithiothreitol, 25 pmol oligo(deoxythymidine) and supernatant protein concentrations were determined with a commer-
primer (Promega Corp., Madison, WI), and 200 U of Moloney murine cially available kit (bicinchoninic acid kit, Pierce Chemical Co., Rockford,
leukemia virus reverse transcriptase (Life Technologies, Inc.); then the IL). Five micrograms of protein were analyzed by SDS-PAGE. After sep-
reverse transcriptase was heat-inactivated at 94 C for 5 min. aration, proteins were transferred to a polyvinylidene difluoride mem-
PCR was carried out in a 20-l volume that included an empirically brane, rinsed with PBS, and blocked for 1 h with 5% dry milk at room
determined amount of the RT reaction dictated by the specific primer set, temperature. The antiproliferating cell nuclear antigen (anti-PCNA) mono-
2 l 10⫻ strength Taq buffer (Roche Molecular Biochemicals, Indianap- clonal (clone PC10, LabVision, Fremont, CA) was added in a 1:200 dilution
olis, IN), 1– 4 mm MgCl2, 0.8 l 10 mm deoxy-NTPs, 3 U FastStart Taq in the same blocking solution. The secondary antibody was used at a
(Roche), and the experimental and internal standard primers sets (Table concentration of 1:5000 for 1 h at room temperature. Antibody complexes
1). The reaction was carried out 95 C for 4 min, followed by 94 C for 30 were visualized using the ECL-Plus kit (Pierce Chemical Co., Rockford, IL)
sec, 60 C for 1 min, and 72 C for 1 min for an empirically determined and were densitometrically quantified.
number of cycles. The entire PCR was electrophoresed through a 2%
agarose gel stained with 0.1 g/ml ethidium bromide. Gels were visu-
alized on a UV transilluminator and were photographed using 667 Statistical analysis
Polaroid film (Fisher Scientific, Fairlawn, NJ), and photographs were Data were tested for heterogeneity of variance with Bartlett’s 2 test and
analyzed by densitometry (Un-Scan-It, Silk Scientific, Orem, UT). All were subsequently logarithm transformed (log ⫹ 2) before analysis by one-
values were normalized to the internal standard; no apparent changes way (PCNA) or two-way ANOVA with one repeated measure. Individual
were observed for either standard after hCG treatment. means were compared using a Newman-Keuls test. Data are expressed as
Validation of the PCR assay was performed using RNA from gran- a percentage of the 0 h (pre-hCG) value. Differences were considered
ulosa cells aspirated 27 h after hCG treatment during routine in vitro significant when P ⬍ 0.05, and all values are presented as the mean ⫾ sem.
fertilization protocols. In brief, the amount of coamplified product was
linear and parallel with increasing amounts of cDNA, and both sets of
primers were in the exponentially increasing phase relative to the num- Results
ber of cycles. To eliminate between-assay variance, all samples were run Validation of the macaque in vitro luteinization model
in a single PCR assay (15).
The capacity to synthesize progesterone by primate gran-
Protein analysis ulosa cells is induced within 30 min of hCG in vivo (17) and
Granulosa cells were detached from plates with 0.25% trypsin/0.1% thus is a reliable early marker of luteinization. Medium levels
EDTA for 6 min at 37 C, pelleted, and snap-frozen. Cell pellets were stored of progesterone increased significantly (P ⬍ 0.05) 4 h after the
at – 80 C until protein isolation. Whole cell protein was isolated by resus- addition of hCG and continued to increase throughout the
FIG. 1. Luteinization of primate granulosa cells in vitro. Cells were cultured in the presence of 20 IU/ml hCG (F) or 50 ng/ml hFSH (E). Media
and cells were harvested before (0 h) and 1, 4, 8, 18, or 48 h after the addition of hCG. A, Levels of progesterone were determined by RIA at
the indicated time points; B, induction of PR mRNA during luteinization of primate granulosa cells. GAPDH was used as an internal control.
Data are the mean ⫾ SEM (n ⫽ 3/time point). CTRL, Control (FSH only). *, Significantly different (P ⬍ 0.05) from 0 h; #, significantly different
from time-matched FSH controls.1252 Endocrinology, April 2003, 144(4):1249 –1256 Chaffin et al. • Luteinization of Macaque Granulosa Cells
treatment interval (Fig. 1A). In control (FSH only) cultures, of tk mRNA were highest and declined between 1– 4 h post-
progesterone was not markedly induced even after 48 h. hCG (Fig. 2). Importantly, a transient increase in tk mRNA
Similarly, increased expression of the progesterone receptor occurred 8 h post-hCG, after which mRNA levels declined
(PR) gene is related to luteinization of primate granulosa cells between 18 – 48 h. In control cultures, levels of tk mRNA did
(18). The addition of hCG to culture medium resulted in the not appreciably change over time.
increased expression of PR mRNA within 4 – 8 h, whereas The uptake of [3H]thymidine was 125% and 108% of 0 h
increased expression of PR mRNA was not evident in control control values by 4 h after hCG or FSH treatment, respec-
cultures (Fig. 1B). tively. By 12 h after hCG, [3H]thymidine uptake was 407% of
0 h values vs. 220% for time-matched FSH controls (P ⬍ 0.05).
Expression of PCNA and thymidine kinase (tk) Thereafter, levels of [3H]thymidine uptake dropped to 172%
PCNA is a nonhistone component of the late G1 nucleus and 10% of 0 h values (P ⬍ 0.05) by 24 and 48 h post hCG
(19), increasing immediately before the onset of DNA rep- (Fig. 3).
lication, and is therefore a useful marker for S phase entry.
Expression of c-Myc, Max, Mad1, Mad4, and Mxi1 mRNA
In primate granulosa cells, PCNA was detectable by Western
blot in all samples, although expression was maximum be- All samples expressed c-Myc, Max, Mad1, Mad4, and Mxi1
fore (0 h) the addition of hCG (Fig. 2). Within 4 h of hCG mRNA, but varying levels of mRNA were observed. Levels
treatment, PCNA was reduced to 50% of that in 0 h samples of mRNA for c-Myc, Max, Mad1, and Mxi1 did not change
(P ⬍ 0.05). Interestingly, PCNA was transiently increased during control (FSH) cultures; Mad4 mRNA tended to in-
(P ⬍ 0.05) 8 h post hCG before declining (P ⬍ 0.05) to 30% crease during the control culture.
of 0 h values by the culmination of the culture interval (48 h). The expression of c-Myc mRNA was lowest before (0 h)
The tk-1 gene is induced by active transcription factor E2F and 1 h after hCG administration and tended to increase 4 h
before S phase entry (20), and thus serves as an excellent gene (P ⫽ 0.10) and 8 h (P ⫽ 0.06) later. Levels of c-Myc returned
marker of G1 to S phase transition. Before hCG (0 h), levels to 0 h values by 18 and 48 h after hCG (Fig. 4A). In contrast,
the expression of Max mRNA was highest before hCG treat-
ment and declined by 5-fold (P ⬍ 0.05) within 1 h (Fig. 4B).
Max mRNA remained suppressed at 4 h post hCG but re-
turned to values equivalent to 0 h between 8 and 48 h.
Similarly, Mad1 mRNA was highest before hCG treatment
and declined significantly (5-fold; P ⬍ 0.05) within 1 h of hCG
treatment (Fig. 4C) before returning to 0 h levels at 8 h. The
expression pattern for Mad4 mRNA was similar to that for
Mad1, except that the levels of Mad4 did not recover until
18 h post hCG (Fig. 4D). Levels of mRNA were highest before
hCG treatment before declining significantly (P ⬍ 0.05) at 4 h
FIG. 2. Expression of PCNA and tk-1 mRNA in macaque granulosa
cells during luteinization. PCNA protein and tk-1 mRNA levels were
determined by Western blot and RT-PCR, respectively, before (0 h) FIG. 3. Proliferation of granulosa cells during luteinization in vitro.
and 1, 4, 8, 18, or 48 h after the addition of hCG. Note that treatment Cells were treated as described in Fig. 1, except that the 1-h point was
of cells with FSH for 48 h did not change either PCNA or tk-1 mRNA omitted, [3H]thymidine was added 2 h before the indicated time
levels. The lower panel is a graphic representation of PNCA expres- points, and incorporation was measured (n ⫽ 3). *, Significantly
sion (n ⫽ 3). Different superscript letters reflect significant differences different from 0 h; #, significantly different from time-matched con-
(P ⬍ 0.05) across time after hCG treatment. trols (FSH only).Chaffin et al. • Luteinization of Macaque Granulosa Cells Endocrinology, April 2003, 144(4):1249 –1256 1253 FIG. 4. Expression of c-Myc, Max, Mad1, Mad4, and Mxi1 by primate granulosa cells before (0 h) and 1, 4, 8, 18, and 48 h after the addition of hCG. Macaque granulosa cells were cultured as described in Fig. 1, and mRNA levels were measured by RT-PCR. Panels are mRNA levels relative to internal standard for c-Myc (A), Max (B), Mad1 (C), Mad4 (D), and Mxi1 (E). F, Representative PCRs. *, Significantly different from 0 h; #, significantly different from time-matched controls (FSH only). Data are the mean ⫾ SEM (n ⫽ 3 animals).
1254 Endocrinology, April 2003, 144(4):1249 –1256 Chaffin et al. • Luteinization of Macaque Granulosa Cells
FIG. 5. Changes in mRNA expression of p53 and wild-type p53-inducible phosphatase (wip1) before (0 h) and 1, 4, 8, 18, and 48 h after hCG
administration. 2-Microglobulin (2MG) was used as an internal standard. See Fig. 1 for details.
and increasing again at 8 – 48 h. Mxi1 mRNA tended to be cell luteinization is developed that closely reflects the in vivo
reduced (P ⫽ 0.08; 2.5-fold) 8 h after hCG treatment (Fig. 4E). setting. This model was used to evaluate the early dynamics
of proliferation after a luteinizing dose of gonadotropin.
Expression of cyclin D2, p53, and wip1 mRNA Surprisingly, levels of PCNA did not decline in a time-
In a variety of cell types, cyclin D2 expression is regulated dependent manner after hCG treatment. Rather, a small in-
by c-Myc (21). To provide a possible mechanistic link be- crease in PCNA expression was observed 8 h after the onset
tween c-Myc/Mad and changes in PCNA and tk, cyclin D2 of luteinization, and [3H]thymidine uptake was increased
mRNA was measured before (0 h) and 8 or 48 h after hCG, 12 h post hCG. Characterization of the Myc/Max/Mad fam-
corresponding to granulosa cell proliferation, the secondary ily as well as p53 indicates that changes in the ratios of these
rise in proliferation during luteinization, and cell cycle arrest, gene products may be responsible for control of the cell cycle
respectively. Cyclin D2 mRNA was not significantly reduced during terminal differentiation of primate granulosa cells.
until 48 h after hCG treatment (P ⬍ 0.05), at which time cyclin Hormonal control of rhesus monkeys, i.e. COS, has proven
D2 mRNA from hCG-treated cultures was significantly (P ⬍ to be an enormously useful tool with which to examine the
0.05) lower than that in control counterparts treated with FSH proliferation and luteinization of granulosa cells. In monkeys
alone (data not presented). undergoing COS, more than 50% of granulosa cells obtained
In contrast to Myc-regulated pathways, p53 mediates cell before an in vivo ovulatory stimulus are proliferative,
cycle arrest by enhancing a large number of target genes (22). whereas less than 15% remain so at 12 and 36 h post hCG (2).
To determine whether control of macaque granulosa cell However, in primates [but not rats (25)], cyclin D2 mRNA
proliferation during luteinization is due principally to the increases 12 h post hCG, suggesting that early periovulatory
Myc/Mad family or if other relevant pathways are involved, events (i.e. ⬍12 h) may not be aimed entirely at suppressing
p53 mRNA was measured. Addition of hCG to culture me- the cell cycle. Although these data clearly indicate that a
dium caused a marked, but transient, decline in p53 mRNA rapid reorganization of cell cycle machinery occurs within
levels by 4 h (Fig. 5). Control cultures did not have appre- the first 12 h after an ovulatory stimulus, this time interval
ciable changes in p53 mRNA. To determine whether p53 remains completely unexplored. The in vitro model of ma-
mRNA correlates with function, a p53-dependent target caque granulosa cell luteinization that was established in the
gene, the wild-type p53-inducible phosphatase (wip1), was current study displays several features in common with the
used (23). The expression of wip1 was regulated in a manner in vivo setting: 1) these cells are proliferative and synthesize
identical to p53 (Fig. 5). estrogen in response to treatment with FSH in vitro (current
study and Chaffin, C. L., unpublished observations); 2) treat-
Discussion ment of proliferating granulosa cells with hCG in vitro causes
The process of luteinization is linked intrinsically to the a rapid accumulation of progesterone in the culture-medium,
terminal differentiation of granulosa into luteal cells, an es- indicative of luteinization; and 3) the expression of PR
sential component of which is the growth arrest of prolifer- mRNA increases after hCG treatment in vitro, a critical aspect
ating cells. This paradigm appears to be the case in the of luteinization. Thus, events and temporal relationships be-
ovarian follicle as well, where granulosa cells exit the cell tween key markers of luteinization appear to be intact and
cycle soon after an in vivo ovulatory stimulus (2, 24 –26). reflective of the in vivo situation.
However, the early events leading to cell cycle arrest and Treatment of proliferative (i.e. nonluteinized) granulosa
terminal differentiation in vivo are difficult to determine in cells results in a marked reduction in PCNA expression
species with a long periovulatory interval such as primates. within 4 h of hCG, whereas an unexpected increase in PCNA
In the present study an in vitro model of primate granulosa is observed 8 h post hCG. Importantly, PCNA expression isChaffin et al. • Luteinization of Macaque Granulosa Cells Endocrinology, April 2003, 144(4):1249 –1256 1255 very low 18 and 48 h after hCG treatment, supporting the and tk expression as well as [3H]thymidine uptake, whereas hypothesis that these cells are terminally differentiated by Mad1 and Mad4 are more abundant during cell cycle arrest 18 –24 h after an ovulatory stimulus (27). Although rat gran- (18 – 48 h after hCG). It is noteworthy that, in contrast to other ulosa cells increase bromodeoxyuridine uptake and PCNA cell systems (32), significant overlap exists in the expression expression within the first 4 h after an ovulatory stimulus (4, and regulation of Mad1 and Mad1 in primate granulosa cells. 5, 28), Robker and Richards (25) suggested that proliferation It is possible that this reflects the brief interval between the of rat granulosa cells is arrested within 4 h of hCG admin- luteinizing hCG stimulus and terminal differentiation [⬃24 istration in vivo. Thus, issues relating to cell cycle arrest of h in primates (27)]. Nevertheless, it is not currently known luteinizing rat granulosa cells have not yet been clearly elu- whether the different Mad proteins have redundant or cidated. Other models show a similar burst of proliferation unique functions that temporally overlap in the ovarian fol- during terminal differentiation; for example, NIH-3T3 L1 licle. It is interesting to note that a marked increase in cells display a transient increase in [3H]thymidine uptake [3H]thymidine uptake also occurs 12 h after replenishment of before achieving a final adipocyte phenotype (29), suggest- FSH; this may be caused by the sudden pulse of mitogenic ing that this may a generalized feature of differentiating cells. stimulus (FSH) to the cells. However, this increase in FSH- Unlike transformed cell models (e.g. 3T3 L1 cells) in which mediated proliferation is not accompanied by changes in the the cell cycle can be synchronized, granulosa cells (in vivo and ratio of Myc to Mad, suggesting that in primate granulosa in vitro) are spread throughout the cell cycle, making it dif- cells, this family of transcription factors may function spe- ficult to determine whether post-hCG proliferation repre- cifically during luteinization. Future studies will be aimed at sents cells entering into a new round of cell division or those understanding the individual or collective actions of Mad in late G1 already destined to divide. The parallel expression family members on primate granulosa cell proliferation and of tk and PCNA along with increased [3H]thymidine uptake differentiation. suggest not only that E2F transcription factor is active 8 –12 One of the surprising findings from the current study is h post hCG, but also that a fraction of cells traverse the S the dramatic regulation of max gene expression during phase in response to hCG. Further, preliminary evidence terminal differentiation. Max has typically been reported suggests that a nearly 30% increase in the number of gran- to be constitutive (7), although there is some evidence that ulosa cells occurs by 24 h after treatment with hCG in vitro Max mRNA levels are under hormonal control in endocrine- compared with that in control cultures (Chaffin, C. L., and sensitive organs such as rat endothelial cells (33). The R. L. Stouffer, unpublished observations). It is intriguing to transient suppression of Max mRNA observed in primate hypothesize about the nature of the granulosa cells that un- granulosa cells after hCG suggests that control of this gene dergo hCG-induced proliferation. These could be less mature is a facet of granulosa cell differentiation. Importantly, the granulosa cells that undergo a phase of catch-up growth, or nadir of Max expression occurs in close temporal associ- perhaps this period of proliferation is indicative of a heter- ation with the increase in the relative ratio of Myc/Mad. ogeneous population of granulosa cells, and by extension, The reduction of Max 1– 4 h post hCG may be a mechanism cell cycle arrest during luteinization could consist of a two- by which differentiating granulosa cells partially blunt the po- stage decline. Although the consequences of this prolifera- tentially apoptotic actions of high levels of Myc unopposed by tive burst on subsequent luteal formation and function are Mad (34). Alternatively, the suppression of Max may actually not currently understood, overexpression of Mad1 blocks sensitize differentiating granulosa cells to Myc by creating com- differentiation of 3T3 cells into mature adipocytes (30). It is petition between Myc and Mad for access to limiting levels of possible that the proliferative burst during luteinization of Max. Further studies will be aimed at determining the func- primate granulosa cells has a similar function in the com- tional consequences of Max regulation. pletion of terminal differentiation and the formation of a Although the proliferative burst of granulosa cells appears corpus luteum. driven in part by reduced levels of Mad mRNAs, the obser- The mechanisms responsible for the proliferative burst in vation that treatment of macaque granulosa cells with hCG granulosa cells before terminal differentiation appear to be results in a transient down-regulation of p53 mRNA indi- linked to changes in the expression of immediate early genes cates that other cell cycle control pathways are involved. such as c-Myc. The central status of c-Myc in the cell cycle is Although the limited samples available for the current study well established, and it has been hypothesized that the ratio preclude analysis of p53 protein function, the parallel ex- of Myc to Mad is a key determinant in the decision of a given pression of a p53-dependent target gene (wip1) strongly cell to proliferate or differentiate (31). Ayer et al. (31) reported suggests that p53 mRNA correlates with function in macaque that Mad/Max complexes are present as early as 2 h after the granulosa cells. Further, preliminary evidence indicates that initiation of differentiation of monocytes and completely re- p53 protein is localized to nuclei of macaque granulosa cell place Myc/Max complexes by 24 – 48 h. Similarly, mRNA (Chaffin, C. L., and R. L. Stouffer, unpublished observations), levels of c-Myc, Mad1, and Mad4 are out of phase in differ- supporting the presence of active p53. Although the function entiating 3T3 cells (32). Further, levels of c-Myc and PCNA of p53 in the process of luteinization is not yet clear, it may are increased transiently after an ovulatory stimulus to rats contribute to cell cycle arrest after the proliferative burst. undergoing superovulation, suggesting that c-Myc regulates Interestingly, p53-regulated Wip1 is involved in cell cycle granulosa cell progression into the S phase during the peri- suppression (23) and may be an important mediator of p53 ovulatory interval (4, 5). In primate granulosa cells after a actions in the ovary. Whether the transient repression of p53 luteinizing dose of gonadotropin, the relative ratio of c-Myc is a cause or a consequence of post-hCG cell cycle charac- to Mad is increased before (and during) the increase in PCNA teristics is not known.
1256 Endocrinology, April 2003, 144(4):1249 –1256 Chaffin et al. • Luteinization of Macaque Granulosa Cells
One of the notable findings from the current study is the Pulverer B, Koskinen PJ, Foley KP, Ayer DE, Eisenman RN 1998 The Mad
protein family links transcriptional repression to cell differentiation. Cold
expression of multiple cell cycle suppressors in granulosa Spring Harb Symp Quant Biol 63:423– 433
cells before hCG. In growing macaque follicles, only a frac- 10. Roussel MF, Ashmun RA, Sherr CJ, Eisenman RN, Ayer DE 1996 Inhibition
tion of cells are proliferative at any one time; thus, it is not of cell proliferation by the Mad1 transcriptional repressor. Mol Cell Biol 16:
2796 –2801
yet known whether the mRNAs for Mad1, Mad4, Mxi1, p53, 11. VandeVoort CA, Tarantal AF 1991 The macaque model for in vitro fertiliza-
and wip1 are 1) translated into functional proteins, 2) ex- tion: superovulation techniques and ultrasound-guided follicular aspiration.
pressed in the actively proliferating fraction of nonluteinized J Med Primatol 20:110 –116
12. National Academy of Sciences 1996 Guide for the care and use of laboratory
granulosa cells, or 3) contribute to cell cycle arrest of that animals. Washington DC: National Academy Press
percentage of granulosa cells present in the growing follicle 13. Boatman DE 1987 In vitro growth or non-human primate pre- and peri-
implantation embryos. In: Bavister BD, ed. Regulation of growth and differ-
that are not actively dividing (⬃50%; Ref. 2). However, some entiation. New York: Plenum Press; 273–308
of these gene products are coexpressed with c-Myc in other 14. Stewart DR, VandeVoort CA 1997 Simulation of human luteal endocrine function
cell types, notably Mxi1 and Mad3 (30, 32, 35–37). These with granulosa lutein cell culture. J Clin Endocrinol Metab 82:3078 –3083
15. Chaffin CL, Stouffer RL 1999 Expression of matrix metalloproteinases and
proteins could possibly fulfill roles other than cell cycle con- their tissue inhibitor messenger ribonucleic acids in macaque periovulatory
trol, for example, as (anti-)apoptotic factors. Therefore, the granulosa cells: time course and steroid regulation. Biol Reprod 61:14 –21
role of Myc/Max/Mad in cell cycle control is far more com- 16. Sommer A, Bousset K, Kremmer E, Austen M, Luscher B 1998 Identification
and characterization of specific DNA-binding complexes containing members
plex than currently realized. Further studies are clearly of the Myc/Max/Mad network of transcriptional regulators. J Biol Chem
needed to establish the cellular colocalization of markers of 273:6632– 6642
cell cycle progression, luteinization, and apoptosis during 17. Chaffin CL, Hess DL, Stouffer RL 1999 Dynamics of periovulatory steroi-
dogenesis in the rhesus monkey follicle after ovarian stimulation. Hum Reprod
follicular maturation. 14:642– 649
In summary, the acquisition of a luteal phenotype by primate 18. Chaffin CL, Stouffer RL, Duffy DM 1999 Gonadotropin and steroid regulation
of steroid receptor and aryl hydrocarbon receptor messenger ribonucleic acid in
granulosa cells in vitro is preceded by a proliferative burst macaque granulosa cells during the periovulatory interval. Endocrinology 140:
driven in part by a transient increase in the ratio of c-Myc to 4753– 4760
Mad1, Mad4, and Mxi1 as well as p53 and the p53-dependent 19. Bravo R, Frank R, Blundell PA, Macdonald-Bravo H 1987 Cyclin/PCNA is
the auxiliary protein of DNA polymerase-␦. Nature 326:515–517
wip1, indicating that multiple pathways are involved in cell 20. Muller R 1995 Transcriptional regulation during the mammalian cell cycle.
cycle control during terminal differentiation. It is hypothesized Trends Genet 11:173–178
that this proliferative burst is a necessary component of termi- 21. Bouchard C, Thieke K, Maier A, Saffrich R, Hanley-Hyde J, Ansorge W, Reed
S, Sicinski P, Bartek J, Eilers M 1999 Direct induction of cyclin D2 by Myc
nal differentiation of primate granulosa cells. contributes to cell cycle progression and sequestration of p27. EMBO J 18:
5321–5333
Acknowledgments 22. el Deiry WS 1998 Regulation of p53 downstream genes. Semin Cancer Biol
8:345–357
The authors are grateful to Dr. Mary Shaw, Dr. Ted Molskenss, and 23. Fiscella M, Zhang H, Fan S, Sakaguchi K, Shen S, Mercer WE, Vande Woude
Dana Hill for technical assistance, and to Marlene Wade for valuable GF, O’Connor PM, Appella E 1997 Wip1, a novel human protein phosphatase
that is induced in response to ionizing radiation in a p53-dependent manner.
discussion of these data. Proc Natl Acad Sci USA 94:6048 – 6053
24. Christenson LK, Stouffer RL 1996 Proliferation of microvascular endothelial
Received July 1, 2002. Accepted December 17, 2002. cells in the primate corpus luteum during the menstrual cycle and simulated
Address all correspondence and requests for reprints to: Dr. Charles early pregnancy. Endocrinology 137:367–374
L. Chaffin, Department of Physiology, Medical College of Georgia, 1120 25. Robker RL, Richards JS 1998 Hormonal control of the cell cycle in ovarian
15th Street, Augusta, Georgia 30912. E-mail: cchaffin@mail.mcg.edu. cells: proliferation versus differentiation. Biol Reprod 59:476 – 482
26. Young FM, Rodger FE, Illingworth PJ, Fraser HM 2000 Cell proliferation and
This work was supported in part by NIH Grants HD-38724 (to C.L.C.), vascular morphology in the marmoset corpus luteum. Hum Reprod 15:557–566
HD-20869 (to R.L.S.), RR-13439 (to C.A.V.), RR-00163 (to the Oregon 27. Chaffin CL, Stouffer RL 2000 Role of gonadotrophins and progesterone in the
National Primate Research Center), and RR-00169 (to the California regulation of morphological remodelling and atresia in the monkey peri-
National Primate Research Center). ovulatory follicle. Hum Reprod 15:2489 –2495
28. Hirshfield AN, Flickinger GL, Ben Rafael Z 1988 Flow cytofluorometric
References analysis of granulosa cell proliferation in rats. J Reprod Fertil 84:231–238
29. Reichert M, Eick D 1999 Analysis of cell cycle arrest in adipocyte differenti-
1. Chaffin CL, Stouffer RL 2001 Local role of progesterone in the ovary during ation. Oncogene 18:459 – 466
the periovulatory interval. Rev Endocr Metab Disord 3:65–72 30. Pulverer B, Sommer A, McArthur GA, Eisenman RN, Luscher B 2000 Anal-
2. Chaffin CL, Schwinof KM, Stouffer RL 2001 Gonadotropin and steroid con- ysis of Myc/Max/Mad network members in adipogenesis: inhibition of the
trol of granulosa cell proliferation during the periovulatory interval in rhesus proliferative burst and differentiation by ectopically expressed Mad1. J Cell
monkeys. Biol Reprod 65:755–762 Physiol 183:399 – 410
3. Robker RL, Richards JS 1998 Hormone-induced proliferation and differen- 31. Ayer DE, Eisenman RN 1993 A switch from Myc:Max to Mad:Max hetero-
tiation of granulosa cells: a coordinated balance of the cell cycle regulators complexes accompanies monocyte/macrophage differentiation. Genes Dev
cyclin D2 and p27Kip1. Mol Endocrinol 12:924 –940 7:2110 –2119
4. Agarwal P, Peluso JJ, White BA 1996 Steroidogenic factor-1 expression is 32. Queva C, Hurlin PJ, Foley KP, Eisenman RN 1998 Sequential expression of
transiently repressed and c-myc expression and deoxyribonucleic acid syn- the MAD family of transcriptional repressors during differentiation and de-
thesis are induced in rat granulosa cells during the periovulatory period. Biol velopment. Oncogene 16:967–977
Reprod 55:1271–1275 33. Shichiri M, Kato H, Doi M, Marumo F, Hirata Y 1999 Induction of max by
5. Piontkewitz Y, Sundfeldt K, Hedin L 1997 The expression of c-myc during adrenomedullin and calcitonin gene-related peptide antagonizes endothelial
follicular growth and luteal formation in the rat ovary in vivo. J Endocrinol apoptosis. Mol Endocrinol 13:1353–1363
152:395– 406 34. Dang CV 1999 c-Myc target genes involved in cell growth, apoptosis, and
6. Fraser HM, Lunn SF, Cowen GM, Illingworth PJ 1995 Induced luteal re- metabolism. Mol Cell Biol 19:1–11
gression in the primate: evidence for apoptosis and changes in c-myc protein. 35. Hurlin PJ, Foley KP, Ayer DE, Eisenman RN, Hanahan D, Arbeit JM 1995
J Endocrinol 147:131–137 Regulation of Myc and Mad during epidermal differentiation and HPV-
7. Grandori C, Cowley SM, James LP, Eisenman RN 2000 The Myc/Max/Mad associated tumorigenesis. Oncogene 11:2487–2501
network and the transcriptional control of cell behavior. Annu Rev Cell Dev 36. Hurlin PJ, Queva C, Koskinen PJ, Steingrimsson E, Ayer DE, Copeland NG,
Biol 16:653– 699 Jenkins NA, Eisenman RN 1995 Mad3 and Mad4: novel Max-interacting tran-
8. Nasi S, Ciarapica R, Jucker R, Rosati J, Soucek L 2001 Making decisions scriptional repressors that suppress c-myc dependent transformation and are
through Myc. FEBS Lett 490:153–162 expressed during neural and epidermal differentiation. EMBO J 14:5646 –5659
9. McArthur GA, Laherty CD, Queva C, Hurlin PJ, Loo L, James L, Grandori 37. Baudino TA, Cleveland JL 2001 The Max network gone mad. Mol Cell Biol
C, Gallant P, Shiio Y, Hokanson WC, Bush AC, Cheng PF, Lawrence QA, 21:691–702You can also read
