Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
LETTERS
Cellular microRNAs contribute to HIV-1 latency
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
in resting primary CD4+ T lymphocytes
Jialing Huang1, Fengxiang Wang1, Elias Argyris1, Keyang Chen1, Zhihui Liang1,2, Heng Tian1, Wenlin Huang2,
Kathleen Squires1, Gwen Verlinghieri1 & Hui Zhang1
The latency of human immunodeficiency virus type 1 (HIV-1) studies have proposed that the mechanisms could include transcrip-
in resting primary CD4+ T cells is the major barrier for the tional inefficiency and post-transcriptional suppression4,15,18–20. As
eradication of the virus in patients on suppressive highly active the major function of cellular miRNA is to inhibit protein translation,
antiretroviral therapy (HAART). Even with optimal HAART we hypothesized that one or more miRNAs could be involved in
treatment, replication-competent HIV-1 still exists in resting HIV-1 latency.
primary CD4+ T cells1–4. Multiple restriction factors that act We wished to determine whether miRNA(s) have a direct role in the
upon various steps of the viral life cycle could contribute to repression of HIV-1 gene expression in resting CD4+ T cells isolated
viral latency. Here we show that cellular microRNAs (miRNAs) from the peripheral blood mononuclear cells (PBMCs) of normal
potently inhibit HIV-1 production in resting primary CD4+ human donors (Supplementary Fig. 1 online). We created constructs
T cells. We have found that the 3¢ ends of HIV-1 messenger for this purpose by inserting a 1.9- or 1.2-kilobase (kb) fragment of
RNAs are targeted by a cluster of cellular miRNAs including the 3¢ end of HIV-1 RNA, which represents the 3¢ untranslated region
miR-28, miR-125b, miR-150, miR-223 and miR-382, which (UTR) common to almost all HIV-1 mRNAs, into the 3¢ UTR of the
are enriched in resting CD4+ T cells as compared to activated enhanced green fluorescent protein (EGFP) gene in the vector pEGFP-
CD4+ T cells. Specific inhibitors of these miRNAs substantially C1 (Fig. 1a and Supplementary Table 1 online). The fragments were
counteracted their effects on the target mRNAs, measured derived from various HIV-1 strains such as NL4-3, 89.6, JR-CSF, LAI.2
either as HIV-1 protein translation in resting CD4+ T cells and YU2. GFP expression from pEGFP-C1 containing these 1.2- and
transfected with HIV-1 infectious clones, or as HIV-1 virus 1.9-kb fragments was lower than expression from the parent vector
production from resting CD4+ T cells isolated from HIV-1– (pEGFP-C1), as measured by median fluorescent intensity (MFI)
infected individuals on suppressive HAART. Our data indicate (Fig. 1b). This indicates that the element(s) responsible for the
that cellular miRNAs are pivotal in HIV-1 latency and suggest possible miRNA-mediated inhibition are mainly positioned in this
that manipulation of cellular miRNAs could be a novel 1.2-kb region and are conserved among the various HIV-1 strains.
approach for purging the HIV-1 reservoir. Further, six smaller fragments (fragments A–F, Fig. 1a) dissected from
the 1.9-kb fragment of the 3¢ end of the HIV-1 NL4-3 genome
The miRNAs are small, noncoding RNAs that control the expression (encoded on a plasmid named pNL4-3) were individually inserted
of various target genes. They can be derived from host or viral RNA. into the 3¢ UTR of the EGFP gene in pEGFP-C1, and the derived
A defensive role for cellular miRNAs against viral infection has been constructs were transfected into resting CD4+ T cells. Among these six
demonstrated in plants, insects, vertebrates and mammals5–7, whereas fragments, the GFP expression from fragments B, D and F was
virus-derived miRNAs can participate in the regulation of host and/or substantially decreased (Fig. 1c). Notably, GFP expression was inhib-
viral gene expression8–10. It has been shown that a cellular miRNA is ited in resting but not in activated CD4+ T cells (Supplementary
able to enhance the replication of hepatitis C virus by an unknown Fig. 2 online). These results suggest that fragments B, D and F could
mechanism11, and a recent report has indicated that cellular miR- harbor potential binding sites for miRNAs that are abundant in resting
17-5p and miR-20a have a role in regulating histone acetyltransferase CD4+ T cells and that could exert an inhibitory effect on the
Tat cofactor expression and HIV-1 replication12. However, their role in expression of viral proteins.
controlling HIV-1 latency has not been well characterized. It is known To further examine the potential for miRNA inhibition of HIV-1
that virus replication does not occur in resting primary CD4+ T cells protein expression, we searched for putative miRNA-binding sites in
of HIV-1–infected individuals receiving suppressive HAART, even the B, D and F fragments using the MicroInspector online program
though proviral DNA and multiply spliced or unspliced viral RNA (Supplementary Table 2 online). On the basis of predictions from this
can easily be found in these cells13–17. The underlying molecular program, we further dissected fragment B into 11 subfragments (B1 to
mechanisms responsible for this latency are still unclear. Previous B11), fragment D into 9 subfragments (D1 to D9) and fragment F into
1Center for Human Virology, Division of Infectious Diseases, Department of Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania 19107, USA.
2Cancer Center, Sun Yatsen University, Guangzhou, Guangdong, 510060, China. Correspondence should be addressed to H.Z. (hui.zhang@jefferson.edu).
Received 9 July; accepted 9 August; published online 30 September 2007; doi:10.1038/nm1639
NATURE MEDICINE VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 1241LETTERS
a vpr vpu RRE nef b
Relative MFI
LTR gag pol vif env LTR
128
tat 65.2%
MFI = 277 M1 1
Ctl
rev
1.9-kb (7261–9172) 0
Relative MFI
100 101 102 103 104
1.2-kb (7961–9172)
128 128 42.1%
23.8%
Total CD4+ T-cell counts
A (7261–7960) MFI = 48 M1 MFI = 165 M1
NL4-3 1.2 kb 0.17 89.6 1.2 kb 0.6
B (7961–8351) 0
0
C (8291–8691)
Total CD4+ T-cell counts
100 101 102 103 104 100 101 102 103 104
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
D (8631–8981)
128 128
18.2% 41%
E (8921–9046) MFI = 172 M1
MFI = 64 M1 NL4-3 1.9 kb 0.23 LAI.2 1.2 kb 0.62
c F (9047–9172)
0 0
1.6 100 101 102 103 104
100 101 102 103 104
128
Relative GFP MFI
128 49.5%
1.2 25.2%
MFI = 102 M1 MFI = 190 M1
JR-CSF 1.2 kb 0.37 YU2 1.2 kb 0.69
0.8 0 0
100 101 102 103 104 100 101 102 103 104
0.4 EGFP intensity EGFP intensity
0
Ctl A B C D E F
Figure 1 MiRNA(s) inhibit HIV-1 expression by acting on the 3¢ end of the HIV-1 genome. (a) Schematic map of the HIV-1 genome. Numbers in parentheses
denote nucleotide positions spanned by fragments of the HIV-1 genome 3¢ end that were inserted into the 3¢ UTR of the EGFP gene in the pEGFP-C1
reporter vector. LTR, long terminal repeat; RRE, Rev response element. Numbers in parentheses denote nucleotide positions that each fragment contains.
(b) Expression of GFP from pEGFP-C1 reporter constructs carrying the 1.9-kb fragment in the 3¢ end of HIV-1 NL4-3 or the 1.2-kb fragment in the 3¢ end of
one of five different HIV-1 strains (NL4-3, 89.6, LAI.2, JR-CSF and YU2). Resting CD4+ T cells from normal human donors were transfected with pEGFP-C1
reporter constructs; GFP expression was analyzed by flow cytometry 48 h later. The MFI of green fluorescing cells was measured. Percentages represent the
rate of GFP-positive cells. (c) Expression of GFP by pEGFP-C1 reporter constructs carrying fragments from the dissection of the 3¢ end of pNL4-3. Fragments
A–F dissected from the 1.9-kb 3¢ end of pNL4-3 were individually inserted into the 3¢ UTR of the EGFP gene in pEGFP-C, which was then transfected into
resting CD4+ T cells. GFP expression was analyzed 48 h after nucleofection. Values represent means ± s.d. Relative GFP MFI is normalized to the MFI from
negative control cells (Ctl) expressing pEGFP-C1 reporter with no insertion. Data in b and c represent at least three independent experiments.
4 subfragments (F1 to F4) (Supplementary Table 1). All of these roles in the suppression of HIV-1 protein expression, we created
subfragments, which consist of 40–76 nucleotides each, were inserted mutant analogs of the binding sequences and inserted each binding
individually into the 3¢ UTR region of the EGFP gene in pEGFP-C1, sequence or its analog into the 3¢ UTR region of the EGFP gene in
and their effects on GFP expression were further examined. Subfrag- pEGFP-C1 (Fig. 2e). All of the binding sites—that is, those for
ments B5, D3, D9 and F3 all harbored potential miRNA target miR-28, miR-125b, miR-150, miR-223 and miR-382—were sufficient
sequences, as GFP expression from these fragments was decreased in to mediate strong inhibition of GFP expression in resting CD4+
resting primary CD4+ T cells (Fig. 2a–c). We again predicted putative T cells. The derivative mutations substantially neutralized this inhibi-
cellular miRNA-binding sites in these four subfragments by employing tion, further supporting our hypothesis (Fig. 2f). Notably, these
the MicroInspector online program (Supplementary Fig. 3a–d binding sites are relatively conserved in the 3¢ ends of various HIV-1
online), and the putative binding sites were further verified by the strains (Supplementary Fig. 4 online).
rna22 and RNAHybrid online programs. Additionally, we compared To further verify the relatively abundant expression of these
miRNA expression in resting CD4+ T cells with that in activated CD4+ miRNAs in resting CD4+ T cells, we measured miRNA abundance
T cells by microarray analysis. Among the miRNAs that are expressed by stem-loop RT-PCR23. The amount of miR-150 and miR-223
in CD4+ T cells, 31 are at least two times more abundant in resting expressed in resting CD4+ T cells was much greater than that in
CD4+ T cells than in activated CD4+ T cells (Supplementary Table 3 activated CD4+ T cells, whereas the amount of miR-28, miR-125b, and
online). We determined that subfragment B5 harbors putative miR-382 was also at least twice as much in resting CD4+ T cells as it
miR-125b– and miR-150–binding sites, subfragments D3 and D9 was in activated CD4+ T cells. As a control, we measured the
harbor putative miR-223– and miR-382–binding sites, respectively, expression of three miRNAs that were not enriched in resting CD4+
and subfragment F3 harbors a putative miR-28–binding site (Fig. 2d T cells in our microarray analysis (miR-124a, miR-146b and miR-155).
and Supplementary Fig. 3a–d). All five of these miRNAs were As expected, miR-124a could not be detected in the CD4+ T cells,
enriched in resting CD4+ T cells, as determined by microarray analysis expression of miR-146b was almost equal in both activated and resting
(Supplementary Table 3). It is notable that the ‘seed’ regions of two CD4+ T cells, and the expression of miR-155 in activated cells was
miRNAs (miR-28 and miR-150) do not perfectly match their target higher than it was in the resting cells (Fig. 2g).
sequences (Fig. 2d). Although perfect pairing at the seed region is To further assess the inhibitory effects of miR-28, miR-125b,
important for identifying miRNA-binding sites21, it has also been miR-150, miR-223 and miR-382 on gene expression, we conducted
demonstrated that perfect seed pairing is not essential for effective experiments with specific, chemically synthesized antisense inhibitors
translational inhibition22. of these miRNAs. Transfection of resting primary CD4+ T cells with
To verify that the identified putative miRNA-binding sequences the combination of all five inhibitors substantially counteracted the
(those of miR-28, miR-125b, miR-150, miR-223 and miR-382) have inhibitory effects of the cellular miRNAs on the GFP expression of
1242 VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 NATURE MEDICINELETTERS
a d e
Relative GFP MFI
1.6
1.2 NL4–3 (9097) 5′ 3′ GFP (+) F5
miR-28
0.8 miR–28 3′ 5′ GFP (–) mF5
0.4 NL4–3 (8096) 5′ 3′ GFP (+) B13
miR-125b
0 GFP (–) mB13
Ctl B B1 B2 B3 B4 B5 B6 B7 B8 B9 B10 B11 miR–125b 3′ 5′
GFP (+) B12
b 1.6
NL4–3 (8957) 5′ 3′ miR-150
GFP (–) mB12
Relative GFP MFI
miR–382 3′ 5′
1.2 GFP (+) D10
NL4–3 (8113) 5′ 3′ miR-223
GFP (–) mD10
0.8
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
miR–150 3′ 5′
GFP (+) D11
0.4 miR-382
NL4–3 (8720) 5′ 3′ GFP (–) mD11
0 miR–223 3′ 5′
Ctl D D1 D3 D2 D4 D5 D6 D7 D8 D9
No RT, resting CD4+ T cells
c f g No RT, activated CD4+ T cells
Resting CD4+ T cells
1.6
Relative GFP MFI
Actived CD4+ T cells
Relative GFP MFI
1.6 18
1.2 16
1.2
Relative expression
0.8 14
0.8 12
0.4 0.4 10
0 0 8
Ctl F F1 F2 F3 F4
)
8)
b)
)
)
10
12
tl
2
3
F5
23
6
82
50
C
B1
B1
-2
25
D
D
m
-2
-3
-1
iR
m
m
m
m
-1
iR
iR
iR
4
(m
iR
(m
(m
(m
(m
F5
2
10
12
2
3
B1
D
B1
D
0
4a
6b
5
0
3
28
2
5b
15
15
22
38
12
14
ir-
12
ir-
ir-
ir-
ir-
m
ir-
ir-
ir-
m
m
m
m
m
m
m
Figure 2 Identification of the binding sites of cellular miRNAs at the 3¢ end of HIV-1 genomic RNA. (a–c) Expression of GFP by pEGFP-C1 reporter
constructs carrying subfragments from the dissection of fragments B (a), D (b) and F (c). Fragments B, D and F were further dissected into 11, 9 or 4
subfragments, respectively, and cloned into pEGFP-C1. The generated constructs were transfected into resting CD4+ T cells and GFP expression was
analyzed 48 h after nucleofection. Relative GFP MFI is normalized to the MFI from negative control cells (Ctl) expressing pEGFP-C1 reporter with no
insertion. Values represent means ± s.d. (d) Secondary structure of microRNAs binding to the 3¢ end fragments of HIV-1NL4-3 RNA. Nucleotide position
numbers are shown in parentheses. (e) Various microRNA target sequences (+) and the corresponding mutated sequences (–), which were created in the
miRNA-binding sequences (underlined) corresponding to the 5¢ portion of the miRNA known as the seed. (f) Expression of GFP from pEGFP-C1 carrying
the original or mutated miRNA target sequences. The predicted miRNA target sequences and their mutants were inserted into the 3¢ UTR of the EGFP
gene in pEGFP-C1. The resulting constructs were transfected into resting CD4+ T cells and GFP expression levels were measured 48 h after transfection.
(g) Differential expression of miR-28, miR-125b, miR-150, miR-223 and miR-382, in primary resting and activated CD4+ T cells, as detected by stem-loop
RT-PCR. The miRNAs were isolated from resting and activated CD4+ T cells separately and miRNA expression was measured by stem-loop RT-PCR. As
controls, miR-124a, miR-146b and miR-155 were also detected. U6 RNA was used as an endogenous control. No RT, no reverse transcription. Data
represent at least three independent experiments. Values are means ± s.d.
pEGFP-C1-NL43-1.2 (Fig. 3a). Flow cytometric analysis confirmed inhibitors were infectious (Fig. 3c). FACS data indicate that these
that these miRNA inhibitors did not affect the resting status of CD4 miRNA inhibitors do not affect cellular proliferation status (Supple-
T cells (data not shown). To examine the effects of these specific mentary Fig. 5). Moreover, transfection with the combined five
miRNA inhibitors upon HIV-1 latency in resting CD4 T cells, we miRNA inhibitors could rescue the viral production of several
mimicked in vivo HIV-1 latency by transfecting pNL4-3, an HIV-1 different HIV-1 strains (Fig. 3d). Notably, transfection of these five
infectious clone, into the resting CD4+ T cells. FACS analysis indicated miRNA inhibitors into resting CD4+ T cells did not substantially alter
that these transfected cells remain in a resting state (Supplementary the amounts of spliced and unspliced HIV-1 mRNA (Fig. 3e), but it
Fig. 5 online). Although a small number of viral particles could be did increase the expression of various HIV-1 proteins (Fig. 3f),
produced from these cells (Supplementary Fig. 6 online), and small suggesting a translational regulatory pattern for these miRNAs.
amounts of viral RNA and protein could also be detected in the cells Furthermore, we analyzed the possible synergistic effect of Rev on
(Supplementary Figs. 7 and 8 online), the amounts of cell-associated HIV-1 expression in primary resting CD4+ T cells treated with the
viral RNA and protein, as well as of viral particles, were substantially miRNA inhibitors by transfecting the cells with a Rev-expressing
increased when the cells were activated with phytohemagglutinin vector (pcRev). Rev expression not only increased HIV-1 protein
(PHA) (Supplementary Figs. 6–8). These data indicate that this expression by itself, a result compatible with previous reports24, but
relatively simple method can effectively mimic HIV-1 latency. also synergized with the miRNA inhibitors to promote HIV-1 pro-
Our data further indicate that neutralization of the inhibitory duction in resting CD4+ T cells (Fig. 3b,f). Our results also imply that
effects of these five miRNAs by their corresponding 2¢-O-methyl- Rev itself is regulated by miRNA (Fig. 3f).
oligoribonucleotide antisense inhibitors results in increased HIV-1 Finally, we examined the effect of these combined miRNA inhibi-
production from pNL4-3–transfected cells. Although individual inhi- tors upon HIV-1 latency in resting CD4+ T cells directly isolated
bitors only modestly affected viral production (Supplementary Fig. 9 from HIV-1–infected individuals receiving suppressive HAART.
online), the combination of the five inhibitors resulted in a substantial Post-integration HIV-1 latency in these cells was confirmed by
increase in HIV-1 production (11.3 times higher than the control) in detection of integrated HIV-1 provirus in the chromosomal
resting CD4+ T cells, but not in activated CD4+ T cells (Fig. 3b and DNA via Alu-PCR (see Methods; Fig. 4a, top). Stimulation of
Supplementary Fig. 10 online). Additionally, the viral particles in the the cells with PHA induced the production of a large number
supernatants of resting CD4+ T cells treated with the five miRNA of viral particles (Fig. 4a, bottom), and serial passaging experiments
NATURE MEDICINE VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 1243LETTERS
a b * c 35,000 Anti-miRs + AZT
Anti-miRs
30,000
* PHA
HIV-1 p24 antigen (pg /ml)
20,000,000 25,000
Virion-associated RNA
4
Relative GFP MFI
16,000,000 20,000
(copies/ml)
3
12,000,000 15,000
2
8,000,000 10,000
1
4,000,000
5,000
0
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
0
m 5b
m -28
An i–m nt
0
an om 82
3
tre ctl
iR d
0
ti– -15
ti– -22
m e
e
ti– 12
C -3
A
ev
d
ti- bin
l
l
d
g
ti– iR
An tm
s
ct
ct
0 5 9 14 18
m e
PH
s e
ne
An iR
iR
An iR
An iR-
R
ti- bin
iR in
a
e
s
g
m
pc
m
iR
iv
ne
b
iR
Time (d) after infection
an om
m m
at
t
m
iR
o
ti- o
N
C
N
c
ti -
m
+
An
ti-
ev
An
an
R
pc
d No treatment e No treatment
f
Anti-miR neg ctl
Combined anti-miRs Anti-miR neg ctl Anti-miR neg ctl – + – – –
16,000,000 Combined anti-miRs Combined anti-miRs – – + – +
8
pcRev – – – + +
Virion-associated RNA
7
Relative expression
12,000,000 Rev
6
(copies/ml)
5
8,000,000 Gag-p55
4
3 Gp160
4,000,000 2
Vif
1
0 0 GAPDH
pNL4-3 89.6 JR-CSF LAI.2 YU2 tat and rev gag
Figure 3 Combined miRNA inhibitors can facilitate HIV-1 protein expression and viral production in resting primary CD4+ T cells. (a) Effects of various
miRNA inhibitors on GFP expression from pEGFP-C1-NL4-3-1.2 in resting CD4+ T cells. Resting CD4+ T cells were transfected with pEGFP-C1 carrying
the 1.2-kb fragment of the 3¢ end of pNL4-3 and various miRNA inhibitors. GFP expression was analyzed by FACS 48 h later. The difference between the
treatments with anti-miR negative control and combined anti-miRs is statistically significant (P o 0.001, ANOVA). (b) Effects of miRNA inhibitors on
HIV-1NL4-3 production in resting CD4+ T cells. Resting CD4+ T cells were transfected with pNL4-3 plasmid, combined miRNA inhibitors or pcRev, or
stimulated with PHA, as indicated. After 48 h, HIV-1 virions in the supernatants were collected by ultracentrifugation and viral RNAs were isolated and
amplified by real-time RT-PCR. The cutoff for virion-associated RNA is 100 copies per ml. The difference in viral production between the treatments with
anti-miR negative control (5.9 ± 0.6 105, mean ± s.d.) and the combined anti-miRs (66.4 ± 11.1 105, mean + s.d.) is statistically significant
(P o 0.0001, ANOVA). (c) Viral infectivity of HIV-1 generated by CD4+ resting T cells. The viral particles (0.2 ng HIV-1 p24 antigen equivalent) in the
supernatants of resting CD4+ T cells treated with combined miRNA inhibitors or PHA were collected 48 h after transfection and used to infect activated
PBMCs. Subsequent virus production was measured by HIV-1 p24 ELISA at various time points. As a control for viral infectivity, zidovudine (AZT, 10 mM)
was added into the culture. (d) The effects of miRNA inhibitors on virus production of various HIV-1 strains. Resting CD4+ T cells were transfected with
various HIV-1 infectious clones and combined miRNA inhibitors, as indicated. Forty-eight hours after transfection, HIV-1 virions in the supernatants were
collected by ultracentrifugation and viral RNAs were isolated and amplified by real-time RT-PCR. (e) Real-time RT-PCR detection of HIV-1 mRNA in resting
CD4+ T cells. Resting CD4+ T cells were transfected with combined miRNA inhibitors and pNL4-3. Forty-eight hours after transfection, total RNA was
isolated and tat/rev and gag mRNAs were detected by real-time RT-PCR. b-actin mRNA was also measured as an internal reference. (f) Effects of miRNA
inhibitors on the expression of Rev, Gag-p55, Vif and Gp160 proteins in resting CD4+ T cells. Resting CD4+ T cells were transfected with pNL4-3, combined
miRNA inhibitors, or pcRev, as indicated. After 48 h, cell lysates were collected and subjected to western blotting with antibodies to gp160, p24, Vif or Rev.
Anti-miR neg ctl represents negative control 2 for miRIDIAN microRNA inhibitor. Values represent means ± s.d. Data represent the average of four to six
independent experiments.
further indicated that these viruses were replication competent (data demonstrate that cellular miRNAs contribute to post-integration
not shown). These data suggest that the cells harboring proviral HIV-1 latency in HIV-1–infected individuals receiving suppressive HAART.
DNA are indeed latently infected. After transfection with the com- Our results show that differentially expressed cellular miRNAs
bined miRNA inhibitors, these resting CD4+ T cells generated at least inhibit HIV-1 expression in primary resting CD4+ T cells through
ten times more HIV-1 particles than did the cells treated with a their interactions with the 3¢ end of HIV-1 RNA, thereby contributing
negative control inhibitor (Fig. 4b). Next, we used a coculture assay to to viral latency. It is known that every spliced or unspliced HIV-1
determine whether the viruses produced after treatment with com- mRNA, with the exception of Nef-encoding mRNA, contains the
bined miRNA inhibitors were replication competent. Resting CD4+ T 1.2-kb fragment we used (or a portion of it) in its 3¢ UTR25.
cells that were transfected with combined miRNA inhibitors and Thus, these cellular miRNAs, which bind the 1.2-kb fragment of
g-irradiated to avoid activation of the cells by alloantigens or cytokines the HIV-1 RNA 3¢ end, can inhibit the translation of almost all
during the coculture. The cells were then cocultured with PHA- HIV-1–encoded proteins—including Tat and Rev, which are key in
stimulated uninfected CD4+ T cells, which were able to capture the the transcription and translocation of viral RNA. The resultant
viruses budding from the resting CD4+ T cells during the first hours inefficient synthesis of Tat and Rev proteins could further enforce
after coculture. These replication-competent viruses, which were the viral latency. We have identified the specific binding sites of
captured by activated cells, were able to spread the infection, and cellular miRNAs in HIV-1 RNA, and their corresponding inhibitors
virus production reached very high levels (Fig. 4c–e). All of these data can effectively counteract the miRNAs’ inhibitory effects on HIV-1
1244 VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 NATURE MEDICINELETTERS
a HIV-1 copy numbers b 100,000
1
2
3
EG
o.
o.
o.
SP
N
N
N
N
5,000 500 50 5 0
Virion-associated RNA
Alu
10,000
(copies/ml)
Actin-b
Subject 1
40,000 Subject 2
Subject 3
HIV-1 p24 antigen (pg/ml)
35,000 1,000
30,000 Subject 1, no stimulation
Subject 1, with stimulation
25,000
Subject 2, with stimulation
20,000 Subject 2, no stimulation
0
s
s
ev
A
t
l
iR
ct
iR
en
Subject 3, no stimulation
PH
15,000
R
m
m
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
g
m
pc
ne
ti-
ti-
Subject 3, with stimulation
at
an
an
10,000
tre
iR
m
d
d
o
ne
ne
ti-
N
5,000
An
bi
bi
m
om
co
0
C
+
0 3 7 10 14 17
ev
R
Time (d) after stimulation
pc
c 50,000 d 105,000 e 140,000
HIV-1 p24 antigen (pg/ml)
HIV-1 p24 antigen (pg/ml)
HIV-1 p24 antigen (pg/ml)
90,000 120,000 No transfection +
40,000 irradiation
75,000 100,000 Anti-miR neg ctl +
irradiation
30,000 60,000 80,000 Combined anti-miRs +
irradiation
20,000 45,000 60,000 PHA stimulation +
irradiation
30,000 40,000
10,000 PHA stimulation only
15,000 20,000
0 0 0
0 4 9 13 18 23 28 0 4 9 13 18 23 28 0 4 9 13 18 23 28
Time (d) in coculture Time (d) in coculture Time (d) in coculture
No transfection + No transfection +
irradiation PHA stimulation + irradiation PHA stimulation +
Anti-miR neg ctl + irradiation Anti-miR neg ctl + irradiation
irradiation irradiation PHA stimulation only
PHA stimulation only
Combined anti-miRs + Combined anti-miRs +
irradiation irradiation
Figure 4 Effect of miRNA inhibitors upon HIV-1 production from resting CD4+ T cells isolated from HIV-1–infected patients on suppressive HAART.
(a) Post-integration latency evaluated in three HIV-1–infected individuals receiving repressive HAART. The post-integration HIV-1 latency in these cells
(2 106) was confirmed by detection of integrated of HIV-1 proviruses in the chromosomal DNA using Alu-PCR (top). Virus production was induced by
PHA treatment (bottom). The viral production in the supernatant was measured by HIV-1 p24 ELISA. (b) Resting CD4+ T cells isolated from HIV-1–infected
patients on suppressive HAART were transfected with combined miRNA inhibitors, control miRNA inhibitor or pcRev, or treated with PHA. After 72 h ,
HIV-1 virions in the supernatants were collected by ultracentrifugation and viral RNAs were isolated and amplified by real-time RT-PCR. The cutoff for
virion-associated RNA is 100 copies per ml. Anti-miR neg ctl represents negative control 2 for miRIDIAN microRNA inhibitor. (c–e) Resting CD4+ T cells
isolated from three HIV-1–infected patients (c, patient 1; d, patient 2; e, patient 3) were transfected with combined miRNA inhibitors or control miRNA
inhibitors, or treated with PHA. Seventy-two hours later, the cells were first exposed to 20 Gy X-ray irradiation for 5 min and then cocultured with
PHA-stimulated uninfected CD4+ T cells. As visualized with Trypan blue, the irradiated cells gradually died within 24 h. At several time points during the
coculture, viral titers in the supernatant were measured by HIV-1 p24 ELISA. Values are means ± s.d. Data represent four to six independent experiments.
production. Therefore, it is likely that these cellular miRNAs, rather and fragments A–F, Fig. 1a) were amplified by PCR and directionally
than virus-derived ones, play a major role in the inhibition of HIV-1 cloned into the 3¢ UTR region of the EGFP gene in the pEGFP-C1 vector
production in resting primary CD4+ T cells. However, as cellular (BD Biosciences). Other subfragments, predicted miRNA-targeting sites,
activation was always better than combined miRNA inhibitors at and their mutated analogs were directly synthesized as sense and antisense
oligonucleotides. These sense and antisense oligonucleotides were annealed
stimulating virus production (Fig. 3b and Fig. 4b), other mechanisms,
with each other and directly inserted into the 3¢ UTR of the EGFP gene in
such as transcriptional inefficiency, could also be important in main-
pEGFP-C1. Detailed information about the oligonucleotides is provided in
taining HIV-1 latency15,18–20. Supplementary Table 1.
Latent infection is one of the most important characteristics
required for all strains of HIV-1 to survive in vivo. Our work Isolation and culture of primary CD4+ T cells. The blood bank of Thomas
demonstrates that HIV-1 can recruit resting-cell–enriched cellular Jefferson University Hospital recruited HIV-1–seronegative blood donors,
miRNAs to control the translation of viral RNA into protein, the whereas the clinical section of the Division of Infectious Diseases of Thomas
last step in the generation of various viral antigens. Thus, a combined Jefferson University Hospital recruited HIV-1–infected individuals who had
miRNA inhibitor panel could be used to activate latent HIV-1 for received HAART for at least 3 months, had a CD4 count Z400 cells/mm3 and
therapeutic purposes. had blood plasma HIV-1 RNA levels lower than 50 copies/ml. All of the
recruited HIV-1–infected individuals gave their informed consent, and the
study was approved by the Institutional Review Board of Thomas Jefferson
METHODS University. The PBMCs were isolated from the whole blood by Histopaque
Plasmid construction. We obtained the various infectious HIV-1 clones (Sigma) sedimentation. Resting primary CD4+ T lymphocytes were then
(pNL4-3, pYK-JRCSF, pYU2, p89.6, pLAI.2) through the AIDS Research isolated from PBMCs with CD4+ T Cell Isolation Kit II (Miltenyi), and
and Reference Reagent Program, Division of AIDS, National Institute of CD25+ and HLA-DR+ cells were depleted by direct immunomagnetic conjuga-
Allergy and Infectious Diseases, US National Institutes of Health. The tion. The negative fraction consisted of CD4+, HLA-DR– and CD25– resting
sequences in the 3¢ end of pNL4-3 (1.9-kb fragment, 1.2-kb fragment, CD4+ T cells, as described previously26,27. The primary CD4+ T cells were
NATURE MEDICINE VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 1245LETTERS
activated by stimulation with PHA (5 mg/ml) for 48 h, then maintained with of AIDS, National Institute of Allergy and Infectious Diseases, US National
interleukin-2 (25 U/ml; Sigma). Institutes of Health.
Synthesis of short interfering RNAs and microRNA inhibitors. We selected Note: Supplementary information is available on the Nature Medicine website.
the miRNA gene sequences from the Sanger Center miRNA Registry at
http://microrna.sanger.ac.uk/sequences/. The short interfering RNAs (siRNAs) ACKNOWLEDGMENTS
We thank K. Zhang for his technical help, J. DeSimone and D. Horn for their
and miRNA inhibitors were chemically synthesized by Dharmacon. Synthetic
assistance in enrolling patients and Y. Wang for conducting X-ray irradiation.
miRNA miRIDIAN antisense inhibitors (2¢-O-methyl-oligoribonucleotides)
This work was supported by grants from the US National Institutes of Health
for human miR-28, miR-125b, miR-150, miR-223 or miR-382 were used (AI058798 and AI052732) to H.Z. and the National Basic Research Program of
in our experiments individually or in combination. The miRIDIAN China (grant 2004CB518801) to W.H.
microRNA inhibitor negative control 2 (anti-miR neg ctl) is based on
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
C. elegans miR-239b (mature sequence: UGUACUACACAAAAGUACUG) AUTHOR CONTRUBUTIONS
and has been confirmed to have minimal sequence identity with miRNAs J.H. carried out most experiments. F.W., E.A., H.T., Z.L. and W.H. participated in
in humans, mice and rats. some of the experiments such as purification of the cells, generation of some
plasmid constructs, and DNA or RNA sequencing. K.C. performed some
Prediction of microRNA-binding sites. We predicted miRNA targets using immunoblotting. K.S. and G.V. placed HIV-1–infected individuals on HAART and
the MicroInspector algorithm at http://mirna.imbb.forth.gr/microinspector/. H.Z. directed and supervised the experiments and interpretation of data. The
manuscript was prepared by J.H. and H.Z.
The cutoff values for hybridization temperature and free energy were set to
37 1C and –20 kcal/mol, respectively. Identified miRNA–target gene pairs COMPETING INTERESTS STATEMENT
were confirmed by RNAHybrid at http://bibiserv.techfak.uni-bielefeld.de/ The authors declare competing financial interests: details accompany the full-text
rnahybrid/submission.html and the rna22 miRNA target predictor at http:// HTML version of the paper at www.nature.com/naturemedicine/.
cbcsrv.watson.ibm.com/rna22.html.
Published online at http://www.nature.com/naturemedicine
MicroRNA array analysis. A total of 20 mg RNA from resting CD4+ T cells or Reprints and permissions information is available online at http://npg.nature.com/
activated CD4+ T cells was isolated with TRIzol reagent (Invitrogen). RNA reprintsandpermissions
processing, microarray fabrication, array hybridization and data acquisition
were performed at LC Sciences.
1. Finzi, D. et al. Identification of a reservoir for HIV-1 in patients on highly active
Transfection. We transfected 5 mg HIV-1 plasmids, pEGFP-C1 plasmid or antiretroviral therapy. Science 278, 1295–1300 (1997).
pEGFP-C1–derived plasmids with or without 100 pmol siRNAs or 100 pmol 2. Wong, J.K. et al. Recovery of replication-competent HIV despite prolonged suppression
miRNA inhibitors into resting or activated primary CD4+ T cells using an of plasma viremia. Science 278, 1291–1295 (1997).
3. Siliciano, J.D. et al. Long-term follow-up studies confirm the stability of
Amaxa nucleofector apparatus (Amaxa Biosystems), as described previously26. the latent reservoir for HIV-1 in resting CD4+ T cells. Nat. Med. 9, 727–728
(2003).
Real-time reverse transcription PCR detection. We designed the primers 4. Persaud, D., Zhou, Y., Siliciano, J.M. & Siliciano, R.F. Latency in human
for real-time RT-PCR to detect miRNA on the basis of the miRNA sequences immunodeficiency virus type 1 infection: no easy answers. J. Virol. 77, 1659–1665
(2003).
provided by the Sanger Center miRNA Registry (http://www.sanger. 5. Kasschau, K.D. et al. P1/HC-Pro, a viral suppressor of RNA silencing, interferes
ac.uk/Software/Rfam/mirna/index.shtml) (Supplementary Table 4 online). with Arabidopsis development and miRNA function. Dev. Cell 4, 205–217
Procedures described previously were followed, with minor modifications23. (2003).
The miRNAs were isolated from resting or activated CD4+ T cells with the 6. Dunoyer, P., Lecellier, C.H., Parizotto, E.A., Himber, C. & Voinnet, O. Probing the
microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA
mirVana miRNA Isolation Kit (Ambion). For detection of HIV-1 gene silencing. Plant Cell 16, 1235–1250 (2004).
expression or virion-associated RNA, the total cellular RNA or virion- 7. Lecellier, C.H. et al. A cellular microRNA mediates antiviral defense in human cells.
associated RNA was isolated with TRIzol (Invitrogen). Supplementary Science 308, 557–560 (2005).
Table 4c lists all primers for HIV-1 gene detection. Reverse transcription 8. Pfeffer, S. et al. Identification of virus-encoded microRNAs. Science 304, 734–736
(2004).
reactions were performed with the iScript complementary DNA synthesis 9. Gupta, A., Gartner, J.J., Sethupathy, P., Hatzigeorgiou, A.G. & Fraser, N.W. Anti-
kit (Bio-Rad). Real-time RT-PCR was performed on an Applied Biosystems apoptotic function of a microRNA encoded by the HSV-1 latency-associated transcript.
7000 Sequence Detection System (Applied Biosystems). U6 RNA was used as an Nature 442, 82–85 (2006).
endogenous control for miRNA detection, and b-actin mRNA was measured as 10. Bennasser, Y., Le, S.Y., Benkirane, M. & Jeang, K.T. Evidence that HIV-1 encodes
an siRNA and a suppressor of RNA silencing. Immunity 22, 607–619
an endogenous control for HIV-1 gene expression. An in vitro–synthesized (2005).
HIV-1 RNA, after quantification28, was used as the external control for 11. Jopling, C.L., Yi, M., Lancaster, A.M., Lemon, S.M. & Sarnow, P. Modulation
measuring virion-associated viral RNA. The cycle number at which the reaction of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 309,
crossed an arbitrarily placed threshold (CT) was determined for each target 1577–1581 (2005).
12. Triboulet, R. et al. Suppression of microRNA-silencing pathway by HIV-1 during virus
sequence, and the amount of each miRNA relative to U6 RNA (or b-actin) was replication. Science 315, 1579–1582 (2007).
described using the equation 2 DCT where DCT is equal to CT for miRNA minus 13. Furtado, M.R. et al. Persistence of HIV-1 transcription in peripheral-blood mono-
CT for U6 RNA (or b-actin). nuclear cells in patients receiving potent antiretroviral therapy. N. Engl. J. Med. 340,
1614–1622 (1999).
Alu-PCR. Genomic DNA was extracted from the resting CD4+ T cells isolated 14. Chun, T.W. et al. Gene expression and viral prodution in latently infected, resting CD4+
T cells in viremic versus aviremic HIV-infected individuals. Proc. Natl. Acad. Sci. USA
from HIV-1–infected individuals. The integrated HIV-1 was detected using 100, 1908–1913 (2003).
primer pairs specific to Alu fragments, described previously29. 15. Lassen, K.G., Ramyar, K.X., Bailey, J.R., Zhou, Y. & Siliciano, R.F. Nuclear retention
of multiply spliced HIV-1 RNA in resting CD4+ T cells. PLoS Pathog. 2, e68
Flow cytometric analysis. Primary CD4+ T cells transfected with EGFP- (2006).
16. Zhang, L. et al. Quantifying residual HIV-1 replication in patients receiving combina-
encoding plasmids were subjected to flow cytometric analysis on a Beckman
tion antiretroviral therapy. N. Engl. J. Med. 340, 1605–1613 (1999).
Coulter cytometer (BD Biosciences) 48 h after nucleofection. The cell 17. Patterson, B.K. et al. Persistence of intracellular HIV-1 mRNA correlates with
activation status was determined by FACS analysis of CD25+ CD69+ cells as HIV-1–specific immune responses in infected subjects on stable HAART. AIDS 15,
described previously26,27. 1635–1641 (2001).
18. Kim, Y.K. et al. Recruitment of TFIIH to the HIV LTR is a rate-limiting step in the
emergence of HIV from latency. EMBO J. 25, 3596–3604 (2006).
Antibodies. Monoclonal antibody to Rev (1G7), rabbit antiserum to Vif, 19. Williams, S.A. et al. NF-kB p50 promotes HIV latency through HDAC
goat antiserum to gp160, and monoclonal antibody to HIV-1 p24 were recruitment and repression of transcriptional initiation. EMBO J. 25, 139–149
obtained from the AIDS Research and Reference Reagent Program, Division (2006).
1246 VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 NATURE MEDICINELETTERS
20. Lassen, K.G., Bailey, J.R. & Siliciano, R.F. Analysis of human immunodeficiency 25. Schwartz, S., Felber, B.K., Benko, D.M., Fenyo, E.M. & Pavlakis, G.N. Cloning and
virus type 1 transcriptional elongation in resting CD4+ T cells in vivo. J. Virol. 78, functional analysis of multiply spliced mRNA species of human immunodeficiency
9105–9114 (2004). virus type 1. J. Virol. 64, 2519–2529 (1990).
21. Lewis, B.P., Burge, C.B. & Bartel, D.P. Conserved seed pairing, often flanked by 26. Chen, K. et al. a-interferon potently enhances the anti-human immunodeficiency virus
adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, type 1 activity of APOBEC3G in resting primary CD4 T cells. J. Virol. 80, 7645–7657
15–20 (2005). (2006).
22. Didiano, D. & Hobert, O. Perfect seed pairing is not a generally reliable predictor for 27. Wang, F.X. et al. IL-7 is a potent and proviral strain-specific inducer of latent HIV-1
miRNA-target interactions. Nat. Struct. Mol. Biol. 13, 849–851 (2006). cellular reservoirs of infected individuals on virally suppressive HAART. J. Clin. Invest.
23. Chen, C. et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic 115, 128–137 (2005).
Acids Res. 33, e179 (2005). 28. Dornadula, G. et al. Residual HIV-1 RNA in blood plasma of patients taking suppres-
24. Pomerantz, R.J., Seshamma, T. & Trono, D. Efficient replication of human immuno- sive highly active antiretroviral therapy. J. Am. Med. Assoc. 282, 1627–1632 (1999).
deficiency virus type 1 requires a threshold level of Rev: potential implications for 29. Butler, S.L., Hansen, M.S. & Bushman, F.D. A quantitative assay for HIV DNA
latency. J. Virol. 66, 1809–1813 (1992). integration in vivo. Nat. Med. 7, 631–634 (2001).
© 2007 Nature Publishing Group http://www.nature.com/naturemedicine
NATURE MEDICINE VOLUME 13 [ NUMBER 10 [ OCTOBER 2007 1247You can also read
