Alternative Splicing Generates Isoforms of the met Receptor Tyrosine Kinase Which Undergo Differential Processing
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, June 1991, p. 2962-2970 Vol. 11, No. 6
0270-7306/91/062962-09$02.00/0
Copyright © 1991, American Society for Microbiology
Alternative Splicing Generates Isoforms of the met Receptor
Tyrosine Kinase Which Undergo Differential Processing
GERARD A. RODRIGUES, MONICA A. NAUJOKAS, AND MORAG PARK*
Ludwig Institute for Cancer Research, Montreal Branch, and Department of Experimental Medicine,
McGill University, Montreal, Quebec, Canada H3A IAJ
Received 1 November 1990/Accepted 28 February 1991
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
The met proto-oncogene is a member of the family of tyrosine kinase growth factor receptors. We describe
the isolation and characterization of a cDNA clone (pOK) for the met receptor from a gastric carcinoma cell
line. This clone differs from the published cDNA clone by the absence of 54 bp predicted to encode 18 amino
acids in the extracellular domain. The pOK cDNA corresponds to the most abundant met RNA species of 8 kb
expressed in human cell lines and tissue, and we show that there are in fact two 8-kb met receptor tyrosine
kinase (RTK) isoforms that are generated by alternative splicing. This newly described met isoform when
transiently expressed in COS cells encodes a protein of 190 kDa which corresponds in size to the p190 met eLp
heterodimer expressed in human cell lines. Furthermore, we show that the 190-kDa product of pOK consists
of the 140-kDa met fi subunit associated with the 50-kDa met a subunit. This finding suggests that both the a
and , met chains are encoded by this construct and confirms the hypothesis that a single chain precursor is
cleaved to produce both subunits of met. In contrast, the previously characterized met isoform corresponds to
a minor met RNA species and encodes a protein of 170 kDa that is not cleaved yet is processed in a manner that
allows cell surface expression. Both met RTK isoforms are autophosphorylated in the in vitro kinase assay.
These results suggest that different isoforms of the met RTK may have distinct biological activities.
The control of cell proliferation and differentiation is in onstrated that the mature protein encoded by the met
part regulated by the interaction of diffusible growth factors proto-oncogene is a heterodimer of 190 kDa consisting of a
and hormones with their receptors. Many growth factor 140-kDa ,B and a 50-kDa ot subunit (11). The ,B subunit spans
receptors belong to a family of evolutionarily conserved the membrane and contains the tyrosine kinase catalytic
transmembrane glycoproteins that possess intrinsic tyrosine domain (12), while the ox subunit remains extracellular (10,
kinase activity. Members of this family include the receptors 11). On the basis of the existence of a consensus signal for
for epidermal growth factor, insulin, insulin growth factor proteolytic cleavage from sequence analysis, it had been
type 1 platelet-derived growth factor, fibroblast growth proposed that the mature met heterodimeric form arises as a
factor, and colony stimulating factor type 1 (reviewed in result of the proteolytic cleavage of a common 170-kDa
references 13, 31, and 33). In addition to receptors for known precursor in a manner similar to the insulin receptor (3, 10).
growth factors, there are a group of proteins, many identified However, because of the presence of multiple met RNAs of
through their involvement in neoplastic transformation, that 8, 7, 5, and 3 kb in these cell lines (11, 23), this issue remains
are structurally similar to receptor tyrosine kinases (RTKs)
and presumably encode receptors for as yet unknown li- unresolved. It is conceivable that the a subunit is encoded
gands (13). One member of this family is the met proto- by another met or unrelated RNA species.
oncogene (23, 30). To distinguish between these possibilities and to facilitate
The met gene was originally identified as an activated a biochemical analysis of the met RTK, we first sought to
oncogene in an N-methyl-N'-nitronitrosoguanidine-treated isolate a cDNA(s) encoding the met p190 heterodimer by
human osteogenic sarcoma cell line (MNNG-HOS) by its using, as a source, RNA prepared from a human gastric
ability to transform NIH 3T3 mouse fibroblasts (5). Activa- carcinoma cell line containing an amplified met locus.
tion of met involved a chromosomal rearrangement that In this report, we describe the isolation and characteriza-
generates a chimeric gene containing sequences derived tion of a cDNA clone, from the gastric carcinoma cell line
from chromosome 1 (designated tpr) fused to sequences Okajima (21), that corresponds to an 8-kb met RNA species.
encoding the kinase domain of the met proto-oncogene on This cDNA differs from the previously published clone
chromosome 7 (8, 22). isolated from HOS cells (23) by the absence of 54 bp
Recently the met gene was shown to be amplified in cell predicted to encode 18 amino acids in the extracellular
lines derived from poorly differentiated human gastric car- domain. We show that this is the predominant met RNA
cinomas (9, 11) and in spontaneous transformants of murine species expressed in human cell lines and tissue and that
NIH 3T3 fibroblasts (6, 14). Amplification of met in these there are in fact two 8-kb met RNA species, arising from
cells does not appear to be accompanied by gene rearrange- alternative splicing, with the potential to encode two met
ment but results in overexpression of met proto-oncogene RTK isoforms. Furthermore, we demonstrate that the
products. Thus, overexpression of met may contribute to shorter met cDNA isolated from Okajima cells encodes the
neoplastic progression of some human gastric carcinomas. mature 190-kDa aot heterodimeric protein when expressed
Previous studies using human tumor cell lines have dem- transiently in COS cells, whereas the other isoform from
HOS cells encodes a 170-kDa protein. This latter protein is
shown to be distinct from the 170-kDa met proreceptor in
*
Corresponding author. biological activity. These results raise the possibility that
2962VOL. 11, 1991 PROTEIN ISOFORMS OF THE met RECEPTOR TYROSINE KINASE 2963
extracellular transmembrane
domain domain
AUG LYS RA LYS LYS ARG kinase UAG
4228
+1l \ / 2265 2319 domain (
pOK A(n)
.,
V
+54
pHOS - U. AAA n
k-HI
1kb
2265 2319
agT ACT TGG TGG AM GAA CCT CTC MC ATT GTC AGT mTT CTA mTT TGC lTT GCC AGt
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
Ser Thr Trp Trp Lys Glu Pro Leu Asn lie Val Ser Phe Leu Phe Cys Phe Ala Ser
FIG. 1. Schematic diagram of the two met receptor cDNA clones. Untranslated regions are represented by a line, and coding sequences
are represented by boxes. The signal sequence and transmembrane domain are identified by solid boxes, while the kinase domain is identified
by the cross-hatched box. A putative cleavage site is indicated at the top. The 54 nucleotides in the extracellular domain that distinguish these
two clones are shown in uppercase letters in the expanded region. The lower case letters represent nucleotides present in both clones. The
amino acids encoded by this sequence are presented below the corresponding codon. The cysteine residue that was mutated to an alanine is
underlined and italicized.
alternative met isoforms may have unique biological proper- of 3' untranslated sequence (Fig. 1). The pOK met cDNA
ties. differs from the published pHOS sequence by a deletion of
54 bp.
MATERIALS AND METHODS pHOSCYS- was created by introducing two point mutations
at nucleotide positions 2341 and 2342 of pHOS, thus con-
Preparation of cDNA library. Total RNA was isolated from verting a cysteine triplet to an alanine triplet. These changes
the Okajima gastric carcinoma cell line (21) by the method of were introduced into the 69-bp primer 5'-TGCAGGAAT
Chomczynski and Sacchi (4). Poly(A)+ RNA was selected TCAGGTTTTTCCCAACACCTGTTATTGTGCTCCCAC
on oligo(dT)-cellulose. Ten micrograms of twice poly(A)+- CACTGGCAAAGGCAAATAGAAAAC-3', corresponding
selected RNA was converted to double-stranded cDNA as to nucleotides 2296 to 2359. This 3' primer was used with the
described previously (23). Blunt-end cDNA was ligated to 5' primer, 5'-AGACACATTTCAATTGGT-3', correspond-
semi-XhoI adapters. Nonligated adapters were removed by ing to nucleotides 2257 to 2274 in pHOS, to amplify, using
chromotography on Bio-Gel A50-m (Bio-Rad). Semi-XhoI- the polymerase chain reaction (PCR), a 305-bp EcoRI re-
adapted cDNA was ligated into the COS-1 cell expression striction fragment containing the additional 54 bp (Fig. 1).
vector pXM (32). The ligation mixture was used to transform This fragment was then substituted for the wild-type EcoRI
Escherichia coli DH5 (Stratagene) to generate a library of 1.2 fragment in pHOS.
x 106 ampicillin-resistant colonies. A total of 106 colonies ptpr-met contains a cDNA for the tpr-met oncogene
were plated at 20,000 colonies per plate on Hybond N filters cloned into the EcoRI site of pXM. A 4.4-kb cDNA, con-
(Amersham). Replica filters of each plate were hybridized taining the complete open reading frame for tpr-met, was
with met-specific probes isotopically labeled with 32P by isolated from a cDNA library prepared from RNA of the
random primer labeling. Approximately 100 positive met tpr-met NIH 3T3 transformed cell line 2212b (data not
cDNA clones were identified, the largest of which, pOK, shown).
was 6.8 kb and was characterized further. DNA sequencing. All DNAs to be sequenced were sub-
Construction of expression plasmids. Two overlapping cloned into pBluescript II KS + and sequenced by the
cDNA clones that correspond to an 8-kb met RNA species dideoxy-chain termination method (26), using the Sequenase
were isolated from a HOS cell cDNA library (23). These system (United States Biochemical Corp.).
clones were used to reconstruct the entire met open reading PCR. A met genomic clone was isolated from a human
frame in the expression vector pXM as follows. XHosll placental genomic library prepared in the cloning vector X
contains a 2.1-kb EcoRI restriction fragment which encodes Dash (Stratagene). Sequences encompassing the region of
the carboxy-terminal portion of the met protein, plus an divergence between the two cDNA clones were amplified by
additional 1.8 kb of 3' untranslated sequence (23). XHos5 using two primers flanking this region. The 5' primer, P1,
was isolated from an oligonucleotide-primed HOS cell described above, was used with a 3' primer, P2 (5'-AATC
cDNA library and contains the amino terminus of the met TCGGGACACTAAC-3'; nucleotides 2557 to 2573) (23).
protein including the ATG (23). The 2.1-kb AHosll fragment Two additional primers within the 54-bp insert, P3 (5'-
was subcloned into pBluescript II KS+. XHos5 was sub- ACTTGGTGGGAAAGAACCTCT-3') and P4 (5'-AACACC
cloned as a partial 4.3-kb EcoRI-digested fragment into TGTTATTGTGCTC-3'), were also used in combination with
pUC9. Using a common SpeI site, XHosll and XHos5 were P1 and P2. Reaction mixtures contained 50 pmol of each
joined to construct the complete met open reading frame, primer, 200 ,uM each of the four deoxynucleoside triphos-
which was subcloned into the XhoI site of the vector pXM to phates, and 5 U of Taq polymerase (Pharmacia) in 100 ,ul of
generate the vector pHOS. 10 mM Tris-HCl (pH 8.3)-S50 mM KCl-0.75 mM MgCl2-
The 6.8-kb cDNA clone pOK isolated from the Okajima 0.01% (wt/vol) gelatin. A single phage plaque was picked and
cell cDNA library corresponds to an 8-kb met RNA species. added to 1 ml of SM buffer (100 mM NaCl, 8 ,IM MgSO4, 50
From sequence analysis, the pOK met cDNA starts at bp mM Tris-HCl, 0.01% [wt/vol] gelatin), and 2 ,u1 of this
-14 of the published met sequence (23) and contains the 2 kb mixture was added to the PCR reaction. Reactions were2964 RODRIGUES ET AL. MOL. CELL. BIOL.
carried out in a Perkin-Elmer Cetus Thermal Cycler as h at 3 W. Proteins were concentrated in a Centricon 3
follows: 25 cycles each consisting of a 1-min denaturation microconcentrator (Amicon), mixed with an equal volume of
step at 94°C, followed by an annealing step of 2 min at 37°C 2 x sample buffer, and analyzed by SDS-PAGE under reduc-
and a final extension step carried out at 72°C for 3 min. ing conditions.
RNase protection analysis. Following gentle lysis of the In vitro protein kinase assays. Cells were lysed with Triton
cells with Nonidet P-40, nuclei were pelleted, the superna- lysis buffer (0.1% Triton X-100, 25 mM N-2-hydroxyeth-
tant was removed for isolation of cytoplasmic RNA, and the ylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.4], 10
nuclei were washed with lysis buffer. Total RNA was mM MnCI2). Immunoprecipitations were carried out as
prepared as described by Chomczynski and Sacchi (4). described above. The immunocomplexes were washed twice
The 305-bp EcoRI fragment of pHOS (nucleotides 2055 to with kinase buffer (20 mM HEPES [pH 7.4], 10 mM MnCl2)
2359), which contained the additional 54 bp, was subcloned and resuspended in 50 1.I of kinase buffer. Following the
into pBluescript II KS+. Using the T7 promoter, an an- addition of 10 ,uCi of [,y-32P]ATP, samples were incubated on
tisense probe corresponding to this insert was generated and ice for 10 min. Immunocomplexes were washed alternatively
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
hybridized to 5 ,ug of poly(A)+ RNA or 50 pLg of cytoplasmic with kinase lysis buffer containing 5 mM EDTA and low salt
or nuclear RNA in 50 1LI of hybridization solution [80% (150 mM NaCl) or high salt (500 mM NaCl), resuspended in
formamide, 40 mM piperazine-N,N'-bis(2-ethanesulfonic sample buffer, and analyzed by SDS-PAGE.
acid) (PIPES; pH 6.7)] at 48°C for 12 to 14 h. Then 300 ,u of Cell surface iodinations. Cell surface iodinations were
RNase digestion buffer (10 mM Tris-HCl [pH 7.5], 5 mM carried out by the lactoperoxidase method (17, 19). Subcon-
EDTA, 300 mM NaCl) containing 4 pLg of RNase A (Sigma) fluent cultures of COS cells were scraped into PBS, pelleted
per ml and 0.5 U of RNase T1 (Boehringer Mannheim) was by low-speed centrifugation (2,500 rpm for 2 min), and
added, the mixture was incubated at 22°C for 1 h. Then 10 ,ul resuspended in a labeling mix containing 50 ,ul of Enzymo-
of 20% sodium dodecyl sulfate (SDS) and 50 ,ug of proteinase bead reagent (Bio-Rad), 50 RI of 0.2 M phosphate buffer (pH
K (Boehringer Mannheim) were added, and the samples 7.2), and 25 R1 of 2% glucose. Then 1 mCi of Na1251
were incubated at 37°C for 15 min. After phenol-chloroform (Amersham) was added, and the reaction was allowed to
extraction and ethanol precipitation, samples were resus- proceed for 15 min at room temperature. The reaction was
pended in loading buffer (80% [vol/vol] formamide, 1 mM terminated by washing the pellet three times with PBS. Cell
EDTA [pH 8.0], 0.1% bromophenol blue, 0.1% xylene extracts were prepared by lysing cells with RIPA buffer, and
cyanol), denatured at 85°C for 5 min, and electrophoresed in immunoprecipitations were carried out as described above.
a denaturing 4% acrylamide-8 M urea gel.
Cells and transfections. COS, Okajima, MKN45, and RESULTS
SW620 cells were maintained in Dulbecco's modified Eagle
medium (DMEM) supplemented with 10% fetal bovine se- Identification of two met 8-kb RNAs. The met proto-
rum (Flow Laboratories). NIH 3T3 cells were grown in oncogene expresses a major transcript of 8 kb in addition to
DMEM containing 10% bovine serum (GIBCO). The Oka- smaller RNA species in various human cell lines (11, 22).
jima and MKN45 human cell lines, derived from poorly The isolation and characterization of a 6.9-kb cDNA from
differentiated gastric carcinomas (21), were obtained from HOS cells that corresponds to an 8-kb met RNA species has
George Vande Woude. The SW620 cell line is derived from been previously described (23). Here we report the isolation
a colon carcinoma and was obtained from the American of a 6.8-kb cDNA from a gastric carcinoma cell line (Oka-
Type Culture Collection. Transient transfections were done jima) that from Northern (RNA) analysis (data not shown)
by the DEAE-dextran method (18) with 2 ,ug of DNA per also corresponds to an 8-kb met RNA species. Sequence
60-mm plate. At 12 to 16 h posttransfection, cells were analysis revealed that this clone starts at bp -14 of the
treated with 100 ,M chloroquine for 3 to 4 h (16) and published HOS met sequence (23) and contains 2 kb of 3'
incubated for 48 to 72 h prior to harvesting. untranslated sequence (Fig. 1). However, this cDNA differs
Immunoprecipitation. Cells were metabolically labeled from the published sequence by a deletion of 54 bp (bp 2265
with 100 ,Ci of [35"]-Trans label (ICN Radiochemicals) for 3 to 2319; Fig. 1). This deletion maintains the predicted open
to 4 h in methionine-free DMEM containing 2% dialyzed calf reading frame of the HOS cDNA sequence, and the Okajima
serum. Cells were washed with phosphate-buffered saline cell cDNA would therefore be predicted to encode a trans-
(PBS) and lysed with RIPA buffer (150 mM NaCl, 1.0% membrane protein with a deletion of 18 amino acids in the
Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris- extracellular domain (Fig. 1). The cDNA clones from HOS
HCI [pH 8.0]). Immunoprecipitations were conducted by (6.9 kb) and Okajima (6.8 kb) cells are shorter than the
using a polyclonal antibody, raised in rabbits, against a predicted size of 8 kb for the major met RNA species. Both
C-terminal peptide, NH2-Cys-Val-Asp-Thr-Arg-Pro-Ala- clones contain the complete met open reading frame (Fig. 1).
Ser-Phe-Trp-Glu-Thr-Ser-COOH, in the presence or ab- Although the transcription initiation sites for the 8-kb met
sence of competing peptide (1 RI of a 10-mg/ml stock). The transcripts have not yet been mapped, sequence analysis of
immunocomplexes were collected on protein A-Sepharose partial cDNA clones from the Okajima cell library (data not
(Pharmacia), washed alternatively with RIPA buffer contain- shown) indicates that both cDNA clones lack 5' untranslated
ing low (150 mM NaCl) and high (500 mM NaCl) salt, sequences.
resuspended in SDS sample buffer, boiled for 5 min, and To test whether both cDNAs are authentic copies of met
subjected to 8% SDS-polyacrylamide gel electrophoresis transcripts and to determine the relative abundance of their
(PAGE). corresponding RNAs, an RNase protection assay was con-
Electroelution of proteins from SDS-gels. Immunoprecipi- ducted. A 305-bp EcoRI fragment (Fig. 2D) from the HOS
tates of MKN45 and COS cells metabolically labeled were cell cDNA containing the 54-bp insert was subcloned into
analyzed by SDS-PAGE under nonreducing conditions. The pBluescript II KS+, and the T7 promoter was used to
labeled bands of interest were located by autoradiography, generate an antisense riboprobe. This probe was hybridized
excised from the dried gel, swollen in water, and electro- to poly(A)+ RNA prepared from HOS cells and two human
eluted into 10 mM Tris-acetate (pH 8.6) with 0.1% SDS for 5 tumor cell lines, Okajima and SW620, that express an 8-kbVOL. 11, 1991 PROTEIN ISOFORMS OF THE met RECEPTOR TYROSINE KINASE 2965
A B Okajima MKN45 C
D 0 to
N
0.
E c
D
0
*
°0
a
Z
_i
-
o
w3
Q
O
x
o
Z _
0 n
C_
C>. a
0
0
Z
_
0
49
y
o
0
X
X
-c
o x
9
I -3 0 5 b p
w
34-30o5b p
+4-305bp 31Obp
281bp
271 bp
.I.
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
234bp -2 1 4 b p
F..& eSa t
1 94bp _
|9,* -2i 4bp
D
EooR Eo UAG
4228
AAA1n
370 gon
W-%r
probe F-r--m- .' .1--l..'.; .'. ;- I."o, ."o,-I
54
protected 1 21 4bP 17i
3 pOK
fragments :i pHOS
FIG. 2. RNase protection studies of met transcripts. A 32P-labeled antisense probe was hybridized to 5 ,ug of poly(A)3 RNA from SW620,
Okajima, and HOS cells (A), 50 ,ug of total cytoplasmic (cytopl.) or nuclear RNA from Okajima and MKN45 cells (B), and 5 p.g of poly(A)+
RNA from Okajima cells, 100 ,ug of total RNA from human placenta, and 100 ,ug of total RNA from 17-week-old fetal kidney (C). Following
hybridization in formamide-PIPES hybridization solution, samples were treated with RNases A and T1 and then analyzed on a 4% denaturing
gel. X~X DNA digested with HaeIII serves as the molecular weight markers. Protected fragments of 305 and 214 bp corresponding to the two
alternatively spliced transcripts are indicated. (D) Schematic of the location of the probe in the cDNA and the expected RNase-protected
fragments.
met RNA species (Fig. 2A). A schematic of the predicted -54-bp form (data not shown). It would therefore appear
fragments that would be protected by the two RNA species that the -54-bp form is the most abundant species in HOS
is shown in Fig. 2D. Protected fragments corresponding to cells and that the XHOS5 cDNA (23) corresponds to a minor
both RNAs are detected in all cell lines including HOS, species and was previously characterized because it repre-
confirming that these cDNAs are authentic copies of met sented the largest cDNA clone.
transcripts. To determine whether both RNA species were Exon-intron analysis. These data suggest that these two
efficiently transported into the cytoplasm, we hybridized met transcripts arise through alternative splicing. To confirm
total nuclear and cytoplasmic RNA with the probe described this hypothesis, we examined the exon-intron structure of a
above (Fig. 2B). The ratios of met RNA species (+54 and genomic clone isolated from a human placental DNA library
-54) were similar in both nuclear and cytoplasmic RNA by using the 305-kb fragment as a probe. Using oligonucle-
preparations. An examination of human tissue samples otide primers that flank the 54-bp segment in the cDNA
showed that both transcripts are also present in human (designated P1 and P2 in Fig. 3), the genomic clone was
placenta and fetal kidney. The relative amounts of the two subjected to PCR analysis. A 1.8-kb product was amplified
transcripts are consistent with those observed in cell lines. from the genomic DNA, whereas a 305-bp fragment was
The additional protected fragments result from incomplete amplified from the HOS cell cDNA and a 251-bp fragment
digestion of probe in the presence of higher concentrations was amplified from pOK (Fig. 3). The 1.8-kb genomic
of RNA used in these samples. In these cell lines and normal fragment amplified by using primers P1 and P2 corresponds
human tissue as well as a variety of other tumor cell lines to a 1.8-kb EcoRI fragment. If the 54-bp insert was an
(data not shown), the pOK RNA species is found to be the unprocessed intron, the amplified product from the genomic
most abundant species and is present at levels approximately fragment would correspond directly to the 305-bp product
50-fold higher than the level of the larger HOS cell species, amplified from the HOS cDNA. This result demonstrates the
as determined by densitometric scans of the autoradio- presence of an intron(s) between primers P1 and P2, suggest-
graphs. Reanalysis of cDNA clones from the HOS cell ing that the additional 54 bp represents an alternatively
cDNA library indicated that 18 of 20 clones were of the spliced miniexon. To confirm this hypothesis, the 1.8-kb2966 RODRIGUES ET AL. MOL. CELL. BIOL.
A cDNA
0D
I.~
.6% \
B O4
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
4-1 .Bkb
I:v 305bp
251 bp
C
22 65 231 9 EcoRI
..acceptor .p0.
intron pHOSc4bppexontorpHOS+pOKaxon
LHPCTTGGTGGAAAGNACCTCTAACATrTGTAGTTCTAi rGCTTGCCAG[TGGTGGGAGCACAATAACAGGTGTTGGGAAAACCTS
tCCCtCtCtta9
pHOS acceptor pOK acceptor
FIG. 3. Exon-intron analysis. (A) Schematic of the partial exon-intron structure surrounding the region of divergence between the two
cDNA clones with the 54-bp insert framed between two EcoRI sites. (B) Corresponding 1.8-kb EcoRI fragment of a genomic clone. The
alternative splicing event that would generate the two cDNA clones is indicated by the dashed lines. The 54-bp exon is highlighted by the
hatched box. The primers used to sequence or carry out PCR analysis are labeled P1 through P4. (C) The 54-bp exon and 3' region expanded
to illustrate the positions of the alternative acceptor sites. Uppercase letters are used to designate coding sequences; nucleotides in the intron
are marked in lowercase letters. The alternative acceptor sites are underlined. The HOS cell clone acceptor site is located within the 5' intron,
while use of an internal acceptor site preceding position 2319 generates the transcript corresponding to the cDNA clone isolated from Okajima
cells. (D) PCR amplification of genomic DNA and pHOS and pOK cDNAs, using primers P1 and P2. The 1.8-kb amplified product from
genomic DNA and the 305- and 251-bp fragments from the cDNA clones are indicated. The amplified products were resolved by
electrophoresis in a 1% agarose gel. M.Wt., molecular weight.
EcoRI genomic restriction fragment was subcloned into reconstructed in pXM to generate plasmid pHOS. The
pBluescript II KS+ and subjected to sequence analysis. cDNA to the RNA lacking the 54 bp (pOK) was isolated as
These analyses showed that alternative splicing of the extra a single clone in the pXM vector. These two plasmids were
54 bp occurs through use of an alternative acceptor site used to transiently transfect COS cells. Proteins metaboli-
within a single exon, such that one donor site in HOS can be cally labeled with [35S]methionine were immunoprecipitated
spliced to two acceptor sites at bp 2265 for HOS and bp 2319 by using an anti-met peptide antibody raised against the
for pOK. Use of the second acceptor site would generate an carboxy terminus of the predicted met protein (amino acid
mRNA without the 54 bp and would be equivalent to pOK positions 1396 to 1408) (23). As shown in Fig. 4, pOK
(Fig. 3). A comparison of both acceptor sites with the encodes a protein of 190 kDa that under nonreducing condi-
consensus acceptor site sequence predicted that both accep- tions comigrates with the mature met product expressed in a
tor sites would be used (29). To verify the sequence data, human gastric carcinoma cell line, MKN45. In both cases,
PCR analysis was conducted by using primers within the immunoprecipitation of the 190-kDa proteins was efficiently
54-bp insert, designated P3 and P4 in Fig. 3, in combination competed for with the antigenic peptide. Under reducing
with P1 and P2. As would be predicted, P1 and P4 amplified conditions, products of 140 and 170 kDa were detected,
a 1.6-kb fragment, whereas P2 and P3 amplified a 180-bp corresponding to the met 140-kDa chain and the met 170-kDa
fragment (data not shown). proreceptor, respectively (10, 12). The 170-kDa proreceptor
The two met 8-kb mRNAs encode distinct proteins. To represents a precursor that undergoes proteolytic cleavage
determine whether the two 8-kb met RNAs encode similar to yield the mature met 140-kDa chain, which is then
proteins and whether these proteins correspond to the p190 associated with a 50-kDa ,3 chain to generate the 190-kDa
met oa heterodimer, expression plasmids containing the two met heterodimer (10). We do not observe the 50-kDa a
cDNAs were constructed in the vector pXM (see Materials subunit when immunoprecipitates of p190 metabolically la-
and Methods). This vector contains the adenovirus major beled with [35S]methionine are reduced. This is due to the
late promoter as well as a simian virus 40 origin of replication presence of additional proteins in this size range that are
to facilitate transient expression assays in COS cells (32). nonspecifically immunoprecipitated with the anti-met antise-
Using overlapping cDNA clones corresponding to the 8-kb rum (10).
met RNA (containing the 54 bp) isolated from a HOS cell The product of pHOS, which includes the additional 54
cDNA library (23), the entire met open reading frame was bp, appears to be processed differently from pOK. UnderVOL. 11, 1991 PROTEIN ISOFORMS OF THE met RECEPTOR TYROSINE KINASE 2967
non-reducing reducing MKN45 pOK pHOS
- E E
peptide -+
Zl-
+ +
el~ If'
+ - -
/ 0-'cI
+ + - + -
l
+
+
+
p1i9 0--~*
p170-_ -p
I40 4- 70
205kd
D-b-
| X
p 1 4 0-0
.4-- L 4
1 70
p1 9_
It
an
__ .2
e
w W
.4-p
1 40
i
a 4-p
77kd pt40_
--al - 4-p50
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
46kd
FIG. 5. Elution and reduction of unreduced met proteins.
MKN45 and COS cells transfected with pOK or pHOS and meta-
bolically labeled were immunoprecipitated in the absence (-) or
FIG. 4. Expression of met in MKN45 and COS cells. [35S]me- presence (+) of competing peptide and resolved by SDS-PAGE (8%
thionine-labeled cell extracts from MKN45 cells or COS cells acrylamide) under nonreducing conditions. [35S]methionine-labeled
transfected with pXM, pOK, pHOS, or pHOSCYS- were incubated bands indicated by the asterisks were excised from the dried gel,
with anti-met antiserum in the presence (+) or absence (-) of extracted, and reanalyzed by SDS-PAGE under reducing conditions
antigenic peptide. The resulting immunoprecipitates were either first (E). The additional lane of eluted proteins (E*) with the pOK clone
reduced or loaded directly onto an 8% gel as described in Materials represents a long exposure of the adjacent lane.
and Methods. Positions of migration of the p190, p170, and p140 met
products are indicated by arrows. Molecular weight markers include
myosin (205,000), P-galactosidase (116,500), bovine serum albumin molecular-weight species observed under nonreducing con-
(80,000), and ovalbumin (49,500). ditions are excised and reduced, the only product detected is
a p170. Together, these results strongly suggest that the pOK
cDNA encodes a p170 precursor that is cleaved to yield the
nonreducing conditions, a protein of 170 kDa and a smear of p140 ,B chain and p50 a chain, whereas the pHOS cDNA
larger-molecular-weight species and a large distinct (>200- encodes a distinct p170 met product that is not cleaved.
kDa) species are detected (Fig. 4). If proteins are first Both met protein isoforms have in vitro kinase activity and
reduced, the product of pHOS migrates as a distinct 170-kDa are localized on the cell surface. To study the possible
protein (Fig. 4). We interpret these results to mean that the function of the p170 pHOS isoform and to confirm that p190
170-kDa protein does not undergo cleavage to yield the encoded by pOK has the same properties as p190 met, we
heterodimeric form. An analysis of the sequence of the extra examined the activity of these proteins expressed in COS
54 bp revealed the presence of an additional cysteine residue cells in the in vitro immune complex kinase assay. The
not present in the smaller pOK form (Fig. 1). This form may results indicate that the p170 pHOS isoform when overex-
not be cleaved because it adopts a conformation, generated pressed became phosphorylated to a level comparable with
through additional disulfide linkages, that masks the proc- that of the p140 ,B subunit, expressed from the pOK clone in
essing site from cleavage by the protease. To formally test COS cells (Fig. 6). When lysates of cells metabolically
this hypothesis, we mutated the additional cysteine residue labeled with [35S]methionine were divided in half and either
in pHOS to an alanine. The TGC codon was changed to GCC immunoprecipitated or used in the in vitro kinase assay, the
within the context of a PCR primer used to amplify a level of phosphorylation of these two proteins was found to
fragment containing the 54-bp insert (see Materials and reflect their relative abundance (data not shown). The level
Methods). The amplified product was substituted into the of phosphorylation of both isoforms in COS cells was less
wild-type sequence of pHOS to yield plasmid pHOSCYS-. than that observed for the P subunit in MKN45 cells, in
This plasmid was transiently transfected into COS cells, and which met appears to be constitutively activated (data not
the protein products were analyzed by immunoprecipitation. shown). In contrast, the met p170 proreceptor was phos-
Substitution of the cysteine residue for an alanine residue in phorylated to levels that were less than stoichiometric (com-
pHOS did not allow cleavage of this alternative met product pare Fig. 4 and 6) and could be detected only following long
(Fig. 4). exposure of the autoradiograph in Fig. 6. Interestingly, a
To determine whether the pOK p190 consists of a het- protein of 46 kDa which was phosphorylated in the immune
erodimer of the p140 chain associated with the p50 a chain complex kinase assay in the presence of p140 from pOK or
and whether the p170 pHOS product is associated with MKN45 cells was not phosphorylated in the presence of
additional proteins or the p50 a chain, we excised these p170 pHOS.
proteins from nonreducing polyacrylamide gels and sub- To determine whether the pHOS and pOK isoforms are
jected the eluted products to SDS-PAGE under reducing transmembrane proteins as suggested from the sequence, we
conditions. The results in Fig. 5 demonstrate that the p190 examined their subcellular localization. The 125I-surface-
met product expressed in MKN45 cells and from pOK in labeled proteins from COS cells transfected with either pOK
COS cells consists of p140 and p50. Although the p50 or pHOS were immunoprecipitated with the anti-met anti-
product from pOK-transfected COS cells is weakly labeled, body. In addition, COS cells transfected with ptpr-met
this result is consistent and reflects the lower amounts of cDNA were analyzed to control for any background labeling
pOK p190 expressed in the COS cell population than in of cytoplasmic proteins due to cell lysis. The p65 tpr-met
MKN45 cells. When the pHOS p170 product and the larger- protein product has been shown to be localized to the2968 RODRIGUES ET AL. MOL. CELL. BIOL.
MKN45 pHOS pOK pXM may therefore reflect some improper compartmentalization
p eptide + - + - +- + -
in COS cells due to overexpression of the transfected
constructs. The p65 tpr-met product, on the other hand, is
not detected on the surface, although large amounts are
205kd immunoprecipitated from total cell lysates of COS cells
4-p170
0 - p140
metabolically labeled with [35S]methionine (Fig. 7).
11 6 kd
DISCUSSION
77kd
The data presented here demonstrate the existence of two
met isoforms possessing characteristics of RTKs. Our pub-
lished sequence of the HOS cDNA for the met receptor
predicted a protein of 1,408 amino acids (23). In this study,
a second cDNA (pOK), predicted to encode a similar protein
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
46kd with a deletion of 18 amino acids in the extracellular domain,
is described and is shown to correspond to the major form of
the 8-kb met RNA species.
This newly described met isoform encodes a protein of 190
FIG. 6. Immune complex protein kinase activity of met prod- kDa which comigrates with the p190 met ao heterodimer
ucts. Extracts from MKN45 or COS cells transfected with pXM,
expressed in human cell lines (Fig. 4 and 5). Under reducing
pOK, or pHOS were incubated with anti-met antiserum in the conditions, the p190 pOK product consists of the 140-kDa P
presence (+) or absence (-) of competing peptide. The resulting subunit which is associated with the 50-kDa a subunit (Fig.
immunoprecipitates were incubated with [-y-32P]ATP, washed, and 5). Expression of the p190 met protein species from pOK
analyzed by SDS-PAGE as described in Materials and Methods. provides strong evidence that both the a and P met chains
The phosphorylated p140 and p170 met products are indicated by are encoded by a single RNA and supports the hypothesis
arrows. Molecular weight markers are those described in the legend that the met 170-kDa single-chain precursor is cleaved to
to Fig. 4.
produce both subunits in a fashion analogous to the insulin
receptor (3, 10). We have shown from RNase protection
(Fig. 2) and Northern hybridization (data not shown) analy-
cytoplasm (12). We show that the unprocessed p170 pHOS ses that this pOK cDNA without the extra 54 bp corresponds
isoform is a transmembrane protein and, as anticipated, the to the major 8-kb met RNA expressed in all human cell lines
p140 p subunit expressed from pOK is also localized on the tested (Okajima and HOS inclusive; Fig. 2). Moreover, the
cell surface (Fig. 7). It has been suggested that the precursor pOK cDNA is colinear with the mouse met cDNA sequence,
is not usually present on the cell surface (10). In this which differed from pHOS by the absence of these 54 bp (3,
experiment (Fig. 7), the proreceptor expressed from pOK is 14, 23).
detected on the cell surface. However, unlike with the p170 Although the -54 pOK form is the major RNA expressed,
pHOS isoform, the precursor is not consistently detected on the + 54 form is also observed in RNA prepared from human
the cell surface. This varies with transfection efficiency and placenta and kidney tissue (Fig. 2). The product of the pHOS
cDNA is a protein of 170 kDa under reducing conditions
(Fig. 4 and 5) that is not cleaved yet is processed in a manner
that allows cell surface expression (Fig. 7). Under nonreduc-
c e e ing conditions, in addition to a 170-kDa protein, a smear of
a
peptide
4011- 'eb larger-molecular-weight species and a distinct larger form is
detected. Although the presence of an additional cysteine
residue may expand the number of different combinations of
205kd intrachain disulfide linkages, mutation of this cysteine resi-
p 1 7 O-R
p 1 4 0-_- due did not significantly affect protein mobility in nonreduc-
1 1 6kd ing conditions. One possible explanation is that p170 pHOS
may form homotypic protein complexes stabilized through
77kd disulfide linkages (Fig. 5).
IFt Proteolytic cleavage of the p170 HOS isoform is not
required for in vitro kinase activity (Fig. 6). Since only p170
46kd
pHOS is expressed in the COS cells, phosphorylation of
p170 pHOS is not due to transphosphorylation by p190 met
in the immune complex as was proposed to explain the low
level of phosphorylation of the p170 met proreceptor (10).
Thus, when overexpressed in COS cells, p170 pHOS has
autophosphorylation activity in the immune complex kinase
assay at a level that is indistinguishable from that of the pOK
FIG. 7. Cell surface iodination of met proteins. Intact MKN45 or p140 I8 chain. However, these two met proteins differ in their
COS cells transfected with pXM, pOK, or pHOS ptpr-met were capacity to phosphorylate a protein of 46 kDa (Fig. 5). A
surface labeled with Na'25l as described in Materials and Methods.
Cells were then lysed, immunoprecipitated, and analyzed as de- protein of 170 kDa can occasionally be detected in metabol-
scribed in the legend to Fig. 4. The last two lanes are immunopre- ically labeled cells (10; Fig. 4); this may correspond to the
cipitates of [35S]methionine-labeled cell extracts from COS cells p170 HOS product and represent the phosphorylated p170
transfected with ptpr-met. The positions of the p170 and p140 met met previously described (10). Without specific antibodies,
and p65 tpr-met products are indicated. we cannot distinguish the p170 pHOS form from the p170VOL . 1 l, 1991 PROTEIN ISOFORMS OF THE met RECEPTOR TYROSINE KINASE 2969
met proreceptor product in cell lines. This finding, plus the chemistry of the met RTK isoforms, their interaction, and
fact that the pHOS mRNA species is expressed in all human their biological functions.
cell lines tested and in RNA prepared from human placenta
and kidney tissue, albeit at a low level, suggests that this met ADDENDUM
isoform may have a biological activity distinct from that of
the met p190 RTK. Without the ligand for met, however, we Sequence analysis of partial met cDNA clones isolated
cannot directly compare the biological activities of these two from another human cell line (GTL16) have also identified
isoforms. the -54-bp met RNA form as the most abundant species
Recently an activated form of the trk oncogene which has (25).
sustained a 51-amino-acid deletion in the extracellular do-
main has been described. This deletion removes a cysteine ACKNOWLEDGMENTS
residue that, when mutated in the normal proto-oncogene We thank Aida Kalbakji for excellent technical assistance, Kath-
product, is sufficient to confer the ability to transform cells leen Italiano and Lois Mulligan for human tissue RNA, Alain
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
(7). Therefore, a change in the number of cysteine residues Nepveu and Yann Echelard for critical reading of the text, and Terri
capable of disulfide bond formation may mimic a conforma- Genio for help in preparing the manuscript.
tional change usually achieved only by ligand binding, This research was supported by the Ludwig Foundation and a
generating a constitutively active form of the trk receptor- FCAR (Province of Quebec) studentship to G.A.R.
like tyrosine kinase. We examined whether overexpression
of pHOS would contribute to morphological transformation REFERENCES
of murine NIH 3T3 or Fisher rat 3T3 cell fibroblasts. In our 1. Andreadis, A., M. E. Gallego, and B. Nadal-Ginard. 1987.
experiments, this met isoform failed to induce foci in either Generation of protein isoform diversity by alternative splicing.
Annu. Rev. Cell Biol. 3:207-242.
cell line, whereas transfection of ptpr-met transformed both 2. Breitbart, R. E., A. Andreadis, and B. Nadal-Ginard. 1987.
cell lines at high efficiency (data not shown). Alternative splicing: a ubiquitous mechanism for the generation
The two met receptor isoforms described in this report are of multiple protein isoforms from single genes. Annu. Rev.
generated by alternative splicing through the use of an Biochem. 56:467-495.
internal acceptor site (Fig. 3). Alternative splicing is now 3. Chan, A. M.-L., H. W. S. King, E. A. Deakin, P. R. Tempest, J.
recognized as an important mechanism for the generation of Hilkens, V. Kroezen, D. R. Edwards, A. J. Wills, C. S. Cooper,
protein diversity (1, 2). Our results are reminiscent of that and P. Brookes. 1988. Characterization of the mouse met
proto-oncogene. Oncogene 2:593-599.
observed for the insulin receptor, for which two alternatively 4. Chomczynski, P., and N. Sacchi. 1987. Single-step method of
spliced isoforms, differing by a 36-bp exon, have been RNA isolation by acid guanidium thiocyanate-phenol-chloro-
described (28). The expression of these forms was shown to form extraction. Anal. Biochem. 162:156-159.
be tissue specific and perhaps developmentally regulated 5. Cooper, C. S., M. Park, D. G. Blair, M. A. Tainsky, K. Huebner,
(20, 27). Interestingly, a difference in binding affinities for C. M. Croce, and G. F. Vande Woude. 1984. Molecular cloning
insulin between these two forms was detected (20), which of a new transforming gene from a chemically transformed
may reflect an underlying difference in biological function human cell line. Nature (London) 311:29-33.
6. Cooper, C. S., P. R. Tempest, M. P. Beckman, C.-H. Heldim,
between these two proteins (20). and P. Brookes. 1986. Amplification and overexpression of the
In addition to the 36-bp exon in the extracellular domain of met gene in spontaneous transformed NIH 3T3 mouse fibro-
the insulin receptor, a 41-bp miniexon that encodes 14 amino blasts. EMBO J. 5:2623-2628.
acids in the extracellular domain of the epidermal growth 7. Coulier, F., R. Kumar, M. Ernst, R. Klein, D. Martin-Zanca,
factor receptor has been described (24). Although alternative and M. Barbacid. 1990. Human trk oncogenes activated by point
splicing of this exon has yet to be demonstrated, differences mutation, in-frame deletion, and duplication of the tyrosine
between the sequences for rat and human receptors fall kinase domain. Mol. Cell. Biol. 10:4202-4210.
entirely within this region, suggesting that these different 8. Dean, M., M. Park, M. M. Lebeau, T. S. Robins, M. 0. Diaz,
J. D. Rowley, D. G. Blair, and G. F. Vande Woude. 1985. The
epidermal growth factor receptor isoforms exist. Moreover, human met oncogene is related to the tyrosine kinase onco-
at least three alternatively spliced variants of the receptor for genes. Nature (London) 318:385-388.
fibroblast growth factor have been reported that are highly 9. Giordano, S., M. F. Di Renzo, R. Ferracini, L. Chiado-Plat, and
divergent in the extracellular domain but have similar bind- P. M. Comoglio. 1988. p145, a protein with associated tyrosine
ing affinities for basic and acidic fibroblast growth factors kinase activity in a human gastric carcinoma cell line. Mol. Cell.
(15). Biol. 8:3510-3517.
Therefore, alternative splicing of exons in the extracellular 10. Giordano, S., M. F. Di Renzo, R. P. Narsimhan, C. S. Cooper, C.
domain of RTKs appears to be a mechanism used to create Rosa, and P. M. Comoglio. 1989. Biosynthesis of the protein
novel receptor forms which may or may not differ in their encoded by the c-met proto-oncogene. Oncogene 4:1383-1388.
11. Giordano, S., C. Ponzetto, M. F. Di Renzo, C. S. Cooper, and
binding affinities for their cognate ligands. The fact that the P. M. Comoglio. 1989. Tyrosine kinase receptor indistinguish-
additional 18 amino acids encoded by the alternatively able from the met protein. Nature (London) 339:155-156.
spliced met exon prevents cleavage of the receptor may have 12. Gonzatti-Haces, M., A. Seth, M. Park, T. Copeland, S. Oroszlan,
functional implications for the different met isoforms. Our and G. F. Vande Woude. 1988. Characterization of the TPR-
results clearly demonstrate that p170 pHOS has biological MET oncogene p65 and the MET protooncogene p140 protein-
activity. Given the heterodimeric nature of p190 met, we tyrosine kinases. Proc. Natl. Acad. Sci. USA 85:21-25.
speculate that the p170 pHOS product has an altered affinity 13. Hunter, T., and J. A. Cooper. 1985. Protein-tyrosine kinases.
for the p190 met ligand. Moreover, the alternative isoforms Annu. Rev. Biochem. 54:897-930.
of the met receptor may have distinct functions; for exam- 14. Iyer, A., T. E. Kmiecik, M. Park, I. Daar, D. Blair, K. J. Dunn,
P. Sutrave, J. N. Ihle, M. Bodescot, and G. F. Vande Woude.
ple, it is possible that the p170 pHOS product may not bind 1990. Structure, tissue-specific expression, and transforming
a soluble ligand but instead play some role in cell-cell activity of the mouse met protooncogene. Cell Growth Differ.
interactions. The cDNA constructs expressing the two met 1:87-95.
isoforms described here will be useful in studying the bio- 15. Johnson, D. E., P. L. Lee, J. Lu, and L. T. Williams. 1990.2970 RODRIGUES ET AL. MOL. CELL. BIOL.
Diverse forms of a receptor for acidic and basic fibroblast epidermal growth factor receptor is encoded by an alternatively
growth factors. Mol. Cell. Biol. 10:4728-4736. spliced transcript in normal rat tissue. Mol. Cell. Biol. 10:2973-
16. Luthman, H., and G. Magnusson. 1983. High efficiency polyoma 2982.
DNA transfection of chloroquine treated cells. Nucleic Acids 25. Ponzetto, C., S. Giordano, F. Peverali, G. Della Valle, M. L.
Res. 11:1295-1308. Abate, G. Vaula, and P. M. Comoglio. Oncogene, in press.
17. Marchalonis, J. J. 1969. An enzymatic method for the trace 26. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-
iodination of immunoglobulins and other proteins. Biochem. J. ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.
113:299-305. USA 74:5463-5467.
18. McCutchan, J. H., and J. S. Pagano. 1968. Enhancement of the 27. Seino, S., and G. I. Bell. 1989. Alternative splicing of human
infectivity of simian virus 40 deoxyribonucleic acid with diethyl insulin receptor messenger RNA. Biochem. Biophys. Res.
aminoethyl-dextran. J. Natl. Cancer Inst. 41:351-354. Commun. 159:312-316.
19. Morrison, M., and G. S. Bayse. 1970. Catalysis of iodination by 28. Seino, S., M. Seino, S. Nishi, and G. I. Bell. 1989. Structure of
lactoperoxidase. Biochemistry 9:2995-3000. the human insulin receptor gene and characterization of its
20. Mosthaf, L., K. Grako, T. J. Dull, L. Coussens, A. Ulirich, and promoter. Proc. Natl. Acad. Sci. USA 86:114-118.
D. A. McClain. 1990. Functionally distinct insulin receptors 29. Shapiro, M. B., and P. Senapathy. 1987. RNA splice junctions of
Downloaded from http://mcb.asm.org/ on December 25, 2020 by guest
generated by tissue-specific alternative splicing. EMBO J. different classes of eukaryotes: sequence statistics and func-
9:2409-2413. tional implications in gene expression. Nucleic Acids Res.
21. Motoyama, T., T. Hojo, T. Suzuk, and S. Oboshi. 1979. Evalu- 15:7155-7174.
ation of the regrowth assay method as an in vitro drug sensitiv- 30. Tempest, P. R., C. S. Cooper, and G. N. Major. 1986. The
ity test and its application to cultured human gastric cancer cell activated human met gene encodes a protein tyrosine kinase.
lines. Acta Med. Biol. 27:49-52. FEBS Lett. 209:357-361.
22. Park, M., M. Dean, C. S. Cooper, M. Schmidt, S. J. O'Brien, 31. Ullrich, A., and J. Schlessinger. 1990. Signal transduction by
D. G. Blair, and G. F. Vande Woude. 1986. Mechanism of met receptors with tyrosine kinase activity. Cell 61:203-212.
oncogene activation. Cell 45:895-904. 32. Yang, Y.-C., A. B. Ciarletta, P. A. Temple, M. P. Chung, S.
23. Park, M., M. Dean, K. Kaul, M. J. Braun, M. A. Gonda, and G. Kovacic, J. S. Witek-Giannotti, A. C. Leary, R. Kriz, R. E.
Vande Woude. 1987. Sequence of C-MET protooncogene cDNA Donahue, G. G. Wong, and S. C. Clark. 1986. Human IL-3
has features characteristic of the tyrosine kinase family of (multi-CSF): identification by expression cloning of a novel
growth-factor receptors. Proc. Natl. Acad. Sci. USA 84:6379- hematopoietic growth factor related to murine IL-3. Cell 47:3-
6383. 10.
24. Petch, L. A., J. Harris, V. W. Raymond, A. Blasband, D. C. Lee, 33. Yarden, Y., and A. Ullrich. 1988. Growth factor receptor
and H. S. Earp. 1990. A truncated, secreted form of the tyrosine kinases. Annu. Rev. Biochem. 57:443-478.You can also read
