Response element sequence modulates estrogen receptor and affinity and activity
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
137
Response element sequence modulates estrogen
receptor and affinity and activity
P C Kulakosky, M A McCarty, S C Jernigan, K E Risinger and C M Klinge
Department of Biochemistry and Molecular Biology, University of Louisville School of Medicine, Louisville, Kentucky 40292, USA
(Requests for offprints should be addressed to C M Klinge; Email: carolyn.klinge@louisville.edu)
Abstract
The relationship between estrogen receptor (ER)–estrogen response element (ERE) binding affinity and
estradiol (E2)-induced transcription has not been systematically or quantitatively tested. We examined the
influence of ERE palindrome length and the 3′ ERE flanking sequence on ERα and ERβ affinity binding
in vitro and on the induction of reporter gene activity in transfected cells. The addition of one nucleotide
in each arm of the 13 bp ERE palindrome, forming a 15 bp ERE palindrome, increased ERα and ERβ
affinity and transcription. In contrast, the addition of an AT-rich flanking sequence from genes highly
stimulated by E2 had little effect on affinity or reporter gene activity. Notable differences between ERα and
ERβ include: both Kd and transcriptional induction were generally higher for ERα than ERβ, better
correlation between ERE palindrome length and transcriptional induction for ERα than ERβ, and a better
correlation between (ER–ERE) Kd and transcriptional induction for ERα than for ERβ.
Journal of Molecular Endocrinology (2002) 29, 137–152
Introduction affect the efficiency of transcriptional activation of
estrogen-regulated genes, it is important to
Nuclear receptor binding to their response determine the quantitative relationship between
elements obviously impacts their function as ER–ERE affinity and transcriptional response.
transcriptional activators for genes containing these There are several conspicuous gaps in the literature
response elements. Despite the fact that this has surrounding the affinity of ER–ERE interactions
been known for some time (Klein-Hitpass et al. (Klinge 2001). First, there are no studies that
1986), it is still not clear if or how the affinity of directly compare ER–ERE binding affinity and
either estrogen receptor (ER) or estrogen transcriptional activation. Second, since the
receptor (ER) binding to estrogen response discovery of a second ER, ER (Kuiper et al. 1996),
element (ERE) affects the magnitude of transcrip- there have been neither published studies com-
tional activation. Without this information, it will paring the affinity of ER and ER to the same
be difficult to determine if ER binding affinity is the EREs, nor studies directly comparing transcrip-
major factor that controls induction of target gene tional activation by ER and ER from the same
transcription by allowing higher stability of ER ERE-containing promoter. Because tissue-specific
interaction in the promoter region or whether some and developmental regulation of ER and ER
other parameter is more important in activating gene expression could control response to estrogens
transcription. Additional proposed effects of the it is important to compare both affinity and
ERE sequence on transcription include ER- transcriptional activation of both of these receptor
induced DNA bending (Nardulli et al. 1993, 1995) forms.
and alteration of ER conformation (Wood et al. In this study, we used quantitative electro-
1998, 2001, Klinge et al. 2001) which could, in phoretic mobility shift assays (EMSA) to compare
turn, alter the ability of the ER to recruit the affinities of ER and ER binding to a
co-activators (Klinge 2000). Since ER–ERE bind- consensus ERE derived from the Xenopus vitello-
ing affinity is one of several interactions that might genin A1 and A2 and the chicken apo-VLDLII
Journal of Molecular Endocrinology (2002) 29, 137–152 Online version via http://www.endocrinology.org
0952–5041/02/029–137 © 2002 Society for Endocrinology Printed in Great Britain
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free access138 P C KULAKOSKY and others · ERE length impacts ER function
genes (Peale et al. 1988) and several variants of this plasmids were isolated using Qiagen mega preps
ERE designed to examine how individual nucleo- (Chatsworth, CA, USA) and digested with HinfI
tides within and adjacent to the ERE impact ER and XhoI. The pGL3-pro plasmid sequence
binding affinity. We used the same EREs to measure surrounding the EREs is as follows: HinfI-ATCGA
estradiol (E2)-induced transcription in reporter TAGTACTAACATACGCTCTCCATCAAAAC
gene-transfected Chinese hamster ovary (CHO-K1) AAAACGAAACAAAACAAACTAGCAAAATA
cells. We found that the 13 bp ERE palindrome, GGCTGTCCCCAGTGCAAGTGCAGGTGCC
considered to be the minimal ERE (Klein-Hitpass AGAACATTTCTCTATCGATAGGTAC-(ERE
et al. 1988, 1989) had a markedly lower affinity for from Table 1)-CTTACGCGTGCTAGCCCGG
both ER and ER than the 15 bp ERE palin- GC-XhoI. The target ERE-containing oligomers
drome. Furthermore, E2 stimulated greater tran- were separated on polyacrylamide gels, electro-
scriptional activity from longer palindromes and was eluted from gel slices and ethanol precipitated
paralleled by a lower EC50 for both ER and ER (Klinge et al. 1997b). The sizes of the oligomers used
expression plasmid DNA. Both binding to and were 202 bp for EREc13, 166 bp for EREc15,
transcription from all EREs tested were roughly 168 bp for EREc17, 169 bp for EREc19, 170 bp
parallel for ER and ER and generally lower for for EREc19,3, 172 bp for EREc19,5, 177 bp for
ER. We found that addition of an A-T rich EREc19,10, and 186 bp for EREc19,19. The
sequence 3 to the 15 bp consensus ERE palindrome resulting DNAs were fill-in labeled with [32P]-
had no significant effect on ER-ERE binding affinity dTTP (3000 Ci/mmol from NEN, Boston, MA,
or on E2-induced reporter gene transcription in USA) using the DNA polymerase I Klenow
transiently transfected CHO-K1 cells. fragment (exo-) from New England Biolabs. The
labeled ERE restriction fragments were separated
from unincorporated nucleotides using spin col-
Materials and methods umns (Centri-Spin-20; Princeton Separations,
Adelphia, NJ, USA). Radiolabel incorporation
Preparation of reporter plasmids
efficiency and purification were monitored with
The sequences of select synthetic single-stranded either paper or cellulose thin-layer chromatography
oligonucleotides are given in Table 1. Annealed, developed with 50% ethanol in water. The
double-stranded ERE-containing oligomers were concentration of the resulting labeled DNAs was
ligated into the SacI, KpnI sites of the pGL3- determined with Picogreen reagent using the
Promoter (pGL3-pro; Promega, Madison, WI, DNA standard included in the Molecular Probes
USA) vector. EREc13 and EREc19,19 were kit (Eugene, OR, USA). The specific activity was
excised from pGEM-7Zf(+) with SacI and KpnI and calculated after liquid scintillation counting in
ligated into the same sites in pGL3-pro as reported EcoScint A (National Diagnostics, Atlanta, GA,
earlier (Klinge et al. 1997b, Klinge 1999). Thus, USA) or Cerenkov counting with a Wallac 1409
EREc13 and EREc19,19 have an additional scintillation counter.
plasmid flanking sequence: 5 -CCC-EREc13-or-
EREc19,19 (sequences in Table 1) -GGGTTCGA
AATCGATAAGCTTGGATCCGGAGAGCT-3 . Preparation of ER and ER
ER does not bind to an oligomer restricted from The cDNA for rat ER in pCMV5, generously
pGEM-7Zf(+) containing this sequence (Anolik provided by Dr J-A Gustaffson (Kuiper et al. 1996),
et al. 1996) nor to the pGL3-pro region surrounding was modified by PCR to better conform to base
the EREs (not shown). All ERE-containing biases near the translation starts in the Autographa
pGL3-pro plasmids were sequenced to ensure the californica multicapsid nuclear polyhedrosis virus
identity of the cloned ERE sequences. (AcMNPV) genome open reading frames (Ayres
et al. 1994) and to remove upstream non-coding
regions. The upstream region and first part of the
Preparation of radiolabeled restriction
open reading frame were sequenced and then
fragment EREs
subcloned from the PCR 2·1 plasmid (Invitrogen,
For EMSA, the EREs were restricted from the San Diego, CA, USA), from the plasmid EcoRI site
pGL3-pro plasmid. The amplified pGL3-pro to the first HindIII site in the open reading frame,
Journal of Molecular Endocrinology (2002) 29, 137–152 www.endocrinology.org
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free accesswww.endocrinology.org
Table 1 Name, DNA sequence, affinity of ER–ERE binding, and fold-induction of reporter gene activity from synthetic sequence-variant EREs. The
underlined nucleotides constitute the palindromic ERE half-site. The affinity of ER–ERE binding was measured directly in EMSA as described in
Materials and methods. The Kd values are the mean± S.E.M. of the number of separate experiments indicated in parentheses. Within each EMSA, each
reaction was performed in quadruplicate as described in Materials and methods. The fold-induction of luciferase/-gal activity was determined in
transiently transfected CHO-K1 cells expressing either ER or ER as described in Materials and methods. The values are the mean± S.E.M. of the
number of separate experiments indicated in parentheses. Within each experiment, each treatment was performed in triplicate
ER ER Fold induct Fold induct
Sequence: (Kd in nM) (Kd in nM) E2ER E2ER
Name
EREc13 5′-CTGGTCACTCTGACCGG-3′ 1·08±0·04 (3) 1·72±0·19 (3) 2·01±0·2 (18) 1·57±0·14 (16)
EREc15 5′-TAGGTCAGAGTGACCTAG-3′ 0·11±0·02 (3) 0·13±0·04 (4) 3·18±0·5 (7) 2·04±0·29 (6)
EREc17 5′-CCAGGTCAGAGTGACCTGAG-3′ 0·18±0·01 (3) 0·25±0·01 (3) 3·51±0·23 (4) 2·30±0·44 (6)
EREc19 5′-TCAGGTCAGAGTGACCTGAAG-3′ 0·25±0·05 (4) 0·41±0·05 (4) 3·37±0·53 (6) 2·83±0·29 (7)
EREc19,3 5′-TCAGGTCAGAGTGACCTGAGCT-3′ 0·11±0·01 (3) 0·45±0·01 (3) 3·17±0·25 (8) 2·38±0·39 (6)
EREc19,5 5′-TCAGGTCAGAGTGACCTGAGCTAA-3′ 0·25±0·05 (4) 0·34±0·06 (3) 4·01±0·78 (8) 2·12±0·33 (6)
EREc19,10 5′-TCAGGTCAGAGTGACCTGAGCTAAAATAA-3′ 0·10±0·01 (4) 0·19±0·00 (2) 3·70±0·84 (8) 2·01±0·45 (5)
EREc19,19 5′-TCAGGTCAGAGTGACCTGAGCTAAAATAACACATTCAG-3′ 0·11±0·02 (6) 0·64±0·14 (4) 3·79±0·31 (22) 2·23±0·35 (13)
ERE length impacts ER function
·P C KULAKOSKY
Journal of Molecular Endocrinology (2002) 29, 137–152
and others 139
via free access
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM140 P C KULAKOSKY and others · ERE length impacts ER function
into the Novagen minimal baculovirus transfer interference between samples. Similar samples were
plasmid, pBAC-1 (Novagen, Madison, WI, USA). loaded on the same gel to maximize exposure of
The final immediate upstream sequence was lower activity samples. Gels were loaded to
5 -AATTCGGCTTACATG-3 . The transfer plas- optimize detection of the weakest bands in each gel.
mid was completed by subcloning the remainder of On each gel, compared with ERE concentrations
the open reading frame (HindIII-HindIII) from near the Kd, at the lowest DNA concentrations
pCMV5-rat ER. pBAC-1-ER was co-transfected higher volumes of the reaction mixture were loaded
into IPLB-Sf21AE cells with BacVector-3000 viral to maximize activity in the free DNA fraction. At
DNA (Novagen). Recombinant virus plaques were the higher DNA concentrations, relatively high
cloned by repeated plaque purification in Tn368 amounts of radioactivity were loaded to increase
cells. Cloned virus was screened by [3H]E2 binding activity in the bound fraction band. Dried EMSA
(72 Ci/mM; NEN) and adsorption to hydroxy- gels were analyzed using a Packard Instruments
apatite (BioRad, Hercules, CA, USA) (Pavlik & InstantImager and associated software, Packard
Coulson 1976). A recombinant AcMNPV contain- Imager for Windows v2·04 (Packard, Meriden, CT,
ing the coding sequence for wild-type recombinant USA). The proportion of radioactive DNA in each
human ER was generously provided by Dr band of interest was used to calculate bound and
Nicholas J Koszewski of the University of Kentucky free fractions. In some assays, to minimize the
(Obourn et al. 1993). ER was produced in 75 cm2 potential inaccuracy in determining the small
cell culture flasks with IPLB-Sf21AE cells grown bound [32P]ERE fraction at the highest ERE
in TNMFH medium (Gibco, Grand Island, concentration, the reaction mixtures were divided
NY, USA or Mediatech) with 10% heat-treated and loaded in duplicate gel lanes. The averages of
fetal bovine serum. Nuclear extracts of ER and these duplicate lanes were calculated for those
ER were prepared from IPLB-Sf21AE insect reaction mixtures before non-linear regression.
cell-infected recombinant baculovirus as described Individual data points were fitted to a hyperbolic
previously (Klinge et al. 1998). The concentration curve (one site binding model) (GraphPad Prism
of ER was determined by hydroxyapatite assay and version 3·0 for Windows; GraphPad Software, San
is reported as dimer concentration (2 M E2/M ER). Diego, CA, USA). Statistical analyses were
performed using Student’s t-test or by one-way
ANOVA followed by Dunnett’s post-hoc test using
EMSA
GraphPad Prism.
Protein–ERE binding reactions were buffered with
20 mM Tris (pH 7·5) and included labeled ERE
Cell culture, transient transfection and reporter
oligomer, 10% glycerol, 17-estradiol-liganded ER,
assays
0·75 g/l bovine serum albumin, 0·02 g/l poly
d(I-C), 110 mM KCl, 1 mM EDTA, 1 mM CHO-K1 cells were purchased from ATCC
dithiothreitol, and 0·5 mM phenylmethylsulfonyl (Manasas, VA, USA) and maintained in Iscove’s
fluoride. Antibodies in select reactions were used to modified Dulbecco’s medium (IMDM; Gibco BRL,
identify specific bands: ER-specific monoclonal Grand Island, NY, USA) supplemented with
anti-ER antibody H222, a gift from Abbott heat-treated 10% newborn calf serum. All other
Laboratories (Chicago, IL, USA) or ER-specific cell culture reagents were purchased from Gibco
antibody (Y19) purchased from Santa Cruz BRL. For transient transfection, CHO-K1 cells
Biotechnology (Santa Cruz, CA, USA). Four were plated in 24-well plates at 2105 cells/well
replicates of each of nine concentrations (36 points) with IMDM (without phenol red) supplemented
were prepared for each Kd estimation. Each such with 10% charcoal-stripped newborn calf serum.
estimate, for every ERE, was repeated three to four The cells were transfected when 80% confluent
times. Binding reactions were incubated for 1 h at with 0·25 µg reporter construct containing the
20 C. The samples from each saturation binding ERE, 0·05 µg pCMV -galactosidase (-gal), 5 ng
analysis were fractionated on four, 4% non- pCMV-ER or pCMV-ER (graciously provided
denaturing polyacrylamide gels, buffered with by Dr B S Katzenellenbogen and Dr J-A
0·5TBE, at 222 V for 3 h at 4 C. One lane was Gustafsson respectively). For experiments to deter-
skipped between samples to eliminate spillover mine the EC50 values for ER expression plasmids,
Journal of Molecular Endocrinology (2002) 29, 137–152 www.endocrinology.org
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free accessERE length impacts ER function · P C KULAKOSKY and others 141 i.e. the amount of ER or ER plasmid required to 13 bp palindrome and EREc15 has a 15 bp achieve 50% maximal luciferase activity for each palindrome. Addition of nucleotides from the 38 bp ERE reporter, cells were transfected with 0·25 µg consensus ERE, called EREc38 in previous studies ERE-reporter plasmid, 50 ng -gal plasmid, and (Anolik et al. 1996, Klinge et al. 1996, 1997, 1998, 0·5–25 ng pCMV-ER or pCMV-ER plus a 2001a, Klinge 1999a,b, Tyulmenkov et al. 2000), compensatory amount of pCMV5 so that the total which has a 19 bp palindrome and a 19 bp AT-rich amount of DNA transfected was constant. For region immediately flanking the end of the 3 ERE experiments to determine the EC50 values for the half site in the palindrome (Peale et al. 1988), gives concentration of E2 to achieve half-maximal the EREc19 series. Addition of the consensus stimulation of ERE reporter activity, cells were AT-rich region to the EREc19 resulted in transfected with 0·25 µg ERE-reporter plasmid EREc19,3, EREc19,5, EREc19,10, and (pGL3-pro-luciferase), 50 ng -gal control plasmid, EREc19,19 (where the number following the and 5 ng of pCMV-ER or pCMV-ER. Cells comma indicates the number of nucleotides added were subsequently treated with ethanol or E2 to from the 20 bp AT-rich consensus sequence in give concentrations ranging from 1 pM to 1 µM. EREc38 which is called EREc19,19 in this The transient transfections were performed using report). Transfast (Promega) as previously described Figure 1 shows one of three assays performed to (Klinge 1999b, Klinge et al. 1999, 2001a). Cells measure the interaction of ER with EREc19,10. were treated, in triplicate, 24 h later with ethanol ER binds EREc19,10 with relatively high affinity, (EtOH, vehicle), 10 nM E2 (Sigma, St Louis, MO, i.e. Kd =0·10 nM (Table 1). Figure 2 is represen- USA), 100 nM 4-hydroxytamoxifen (4-OHT) tative of four assays for ER–EREc13 binding (Research Biochemicals International, Natick, MA, which was, by contrast, a relatively low affinity USA), or both E2 and 4-OHT. Cells were interaction, i.e. Kd =1·72 nM (Table 1). Figure 3 harvested 30 h later and luciferase and -gal shows the plotted quantitative data from the gels activities assayed (Klinge 1999b, Klinge et al. 1999, shown in Figs 1 and 2. 2001a). All data for transient transfections were For all of the EREs tested, the Kd estimate for normalized by -gal to account for transfection ER–ERE interaction was lower than for ER, efficiency. Statistical analyses were performed using although the difference was not always statistically Student’s t-test or one-way ANOVA followed by significant (Table 1). The affinity of both ER and Dunnett’s post-hoc test using GraphPad Prism. ER for EREc13 was much lower than for the EC50 values were determined for non-linear EREs containing 6 or 7 bp half sites (P
142 P C KULAKOSKY and others · ERE length impacts ER function
Figure 1 Electrophoretic mobility shift assays (EMSA) for determination of ERα–EREc19,10 affinity. E2-occupied
recombinant human ERα (1·6 nM) was incubated with the indicated concentrations (bars above gel lanes) of
[32P]-labeled EREc19,10 oligomer as described in Materials and methods. The four replicates of the highest DNA
concentration were each divided in half and ERα-specific antibody H222 (H) added to two samples. The resulting
supershift of the specific ERα–ERE complex is indicated by the arrow. The remaining two divided samples were
run in duplicate gel lanes, as indicated. EMSA details are provided in Materials and methods. Gels are displayed
with a linear intensity scale with each gel’s intensity and contrast optimized independently of the other three gels.
These four gels are from one experiment of the three experiments performed to determine the Kd for
ERα–EREc19,10 interaction.
increased the Kd for ER binding (PERE length impacts ER function · P C KULAKOSKY and others 143 Figure 2 EMSA for determination of ERβ–EREc13 affinity. E2-occupied recombinant rat ERβ (7·0 nM) was incubated with [32P]-labeled EREc13 oligomer as described in Materials and methods and in Fig. 1. Y indicates the lanes into which reactions that contained ERβ-specific supershifting antibody to identify ERβ-specific bands were loaded. These four gels are from one experiment of the three experiments performed to determine the Kd for ERβ–EREc13 interaction. The arrow indicates specifically supershifted ERβ–ERE complex. Figure 4 shows a summary of the transient EREs than ER (Mosselman et al. 1996, Cowley & transfection experiments performed for ER and Parker 1999, Hall & McDonnell 1999, Jones et al. ER. Transcriptional activity was induced by E2 1999, Tyulmenkov et al. 2000, Klinge et al. 2001a). from each ERE and the estrogen antagonist As anticipated, EREc13, which bound ER and 4-OHT inhibited E2-induced transcription, demon- ER with the lowest affinity (Table 1), produced strating the specificity of transcription for ER. the lowest E2-induced transcriptional activity for 4-OHT did not stimulate reporter activity from any both ER and ER (P
144 P C KULAKOSKY and others · ERE length impacts ER function
palindrome length beyond 15 bp did not signifi-
cantly alter transcription compared with EREc15.
Compared with EREc19, extension of the consensus
AT-rich sequence by 4 or 6 bp (EREc19,3 and
EREc19,5) had no significant effect on ER- or
ER-induced transcription. Therefore the AT-rich
3 flanking region in the consensus ERE does not
impact ER-induced transcription under these assay
conditions.
To ascertain whether the differences in transcrip-
tional activity detected between ER and ER in
transiently transfected CHO-K1 cells were due to
differences in the levels of expression of ER or
ER, we evaluated the EC50 values for the
concentration of E2 required to achieve half-
maximal induction of luciferase activity for ER
and ER (Table 2). If the level of ER and ER
expression is equivalent, the EC50 values for E2
should be similar (An et al. 1999). The data in
Table 2 indicate that EC50 values for the EREs
tested was similar, indicating equivalent levels of
ER and ER expression. We note the trend for
slightly lower EC50 values for ER versus ER,
reflecting the higher affinity binding of E2 for ER
than ER (Kuiper et al. 1997). For both ER and
ER, there was a linear relationship (Pearson’s
correlation R2 =0·96 and 0·98, PERE length impacts ER function · P C KULAKOSKY and others 145 Figure 4 Effect of ERE sequence on E2-induced reporter activity with ERα and ERβ. CHO-K1 cells were co-transfected with (A) pCMV-ERα or (B) pCMV-ERβ plus the indicated pGL3-ERE-promoter reporter vector and pCMV-β-gal as described in Materials and methods. Twenty-four hours after transfection, the cells were treated with ethanol, 10 nM E2, 100 nM 4-hydroxytamoxifen (4-OHT), or 10 nM E2 plus 100 nM 4-OHT. The fold-induction of luciferase activity (luciferase/β-gal) is expressed relative to the activity detected upon addition of EtOH which was set to 1. The data shown are presented as means± S.E.M. for 4–22 independent experiments, in which each treatment was performed in triplicate. In (A and B) asterisks indicate values that are significantly different from the EtOH values (P
146 P C KULAKOSKY and others · ERE length impacts ER function
Table 2 Determination of EC50 values for E2-induced
ERE-driven reporter gene expression. The sequences of
the EREs are provided in Table 1. For experiments to
determine the EC50 values for E2 activation of luciferase
activity, i.e. the concentration of E2 required to achieve
50% maximal luciferase activity for each ERE reporter,
CHO-K1 cells were transiently transfected with 0·25 g
ERE-reporter plasmid (pGL3-pro-luciferase), 50 ng -gal
control plasmid, and 5 ng of pCMV-ER or pCMV-ER
as described in Materials and methods. EC50 values
(nM) were determined from triplicate measures of 8
different E2 concentrations by nonlinear regression with
a one-site binding equation using GraphPad Prism. R2
ranged from 0·62 to 0·98
ER ER
(EC50 in nM) (EC50 in nM)
Figure 5 Correlation of EC50 for E2 concentration and
Name ER–ERE binding affinity. CHO-K1 cells were
EREc13 2·08 1·93 co-transfected with the indicated amount of expression
EREc15 0·21 0·16 vector for ERα or ERβ plus the indicated
EREc17 0·03 0·03 pGL3-ERE-promoter reporter vector and pCMV-β-gal as
EREc19 0·16 0·33 described in Materials and methods. Twenty-four hours
EREc19,3 0·11 0·20 after transfection, the cells were treated with ethanol or
EREc19,5 0·08 0·14 0·1–25 nM E2. Cell lysates were assayed for luciferase
EREc19,10 0·09 0·12 and β-gal activities 30 h after treatment. Data for EC50
EREc19,19 0·22 0·47 (the concentration of E2 (nM) required to achieve 50%
maximum luciferase activity) and Kd from Table 2 for
both ERα and ERβ (open and solid circles, as
indicated) were plotted and tested for correlation. There
was a significant correlation (R2 =0·97 and 0·98) for
Saturation of transcriptional response to ER ERα and ERβ respectively between Kd and EC50 (E2 in
and ER nM) in transiently transfected CHO-K1 cells (PERE length impacts ER function · P C KULAKOSKY and others 147
Figure 7 Determination of effect of ERE palindrome length on EC50 values for ERα and
ERβ transactivation. (A) CHO-K1 cells were co-transfected with the indicated amount of
pCMV-ERα or pCMV-ERβ plus the indicated pGL3-ERE-promoter reporter vector and
pCMV-β-gal as described in Materials and methods. Twenty-four hours after transfection,
the cells were treated with ethanol or 10 nM E2. The fold-induction of luciferase activity
(luciferase/β-gal) is expressed relative to the activity detected upon addition of EtOH which
was set to 1. The data shown are presented as means± S.E.M. for triplicate determinations.
(B) Data for EC50 (ng of ER expression vector required to achieve 50% maximum
luciferase activity) and Kd from Table 2 for both ERα and ERβ were plotted and tested for
correlation. There was a significant correlation (R2 =0·90) between ERα Kd and EC50 (ng
ERα expression vector) for EREc13, EREc15, EREc17, and EREc19 in transiently
transfected CHO-K1 cells (P148 P C KULAKOSKY and others · ERE length impacts ER function
Table 3 EC50 values for ER or ER expression of transcription from different estrogen target
plasmid concentration in transiently transfected cells. genes. Now, with the discovery of ER (Kuiper
The sequences of the EREs are provided in Table 1.
CHO-K1 cells were transfected with 0·25 g et al. 1996), non-ERE targets of ER transactivation
ERE-reporter plasmid (pGL3pro-luciferase), 50 ng -gal e.g. AP-1 and Sp1 sites (reviewed by Klinge 2001),
control plasmid, and 0·5–25 ng of pCMV-ER or the identification of new estrogen target tissues
pCMV-ER as described in Materials and methods.
Cells were treated with 10 nM E2. Details of the (Ciana et al. 2001), and the rapidly increasing
transient transfection and assays for luciferase and number of known co-activators and co-repressors
-gal activities are described in Materials and methods. (Klinge 2000), that assumption requires systematic
EC50 values (ng) were determined by nonlinear
regression with a one-site binding equation using evaluation. New models for controlling estrogen-
GraphPad Prism using 8 different concentrations of ER regulated genes must include competition of ER
expression vector and ER for the same EREs in tissues expressing
ER ER both proteins, such as normal and neoplastic
(EC50 in ng) (EC50 in ng) human breast (Iwao et al. 2000), ovary (Hiroi et al.
1999), and prostate (Hess et al. 1997, Bonkhoff et al.
Name 1999, Hiroi et al. 1999, Lau et al. 2000, Pelletier
EREc13 1·4 2·48 et al. 2000).
EREc15 0·478 1·71
EREc17 0·024 1·84
Enhancer and promoter regions of ER-regulated
EREc19 0·031 2·43 genes are large and the ER binding site is larger
EREc19,3 0·024 2·23 than the minimal 13 bp ERE palindrome as
EREc19,5 0·063 1·44 defined by Klein-Hitpass et al. (1988). It is
EREc19,10 0·017 2·32 important to determine the contribution of
EREc19,19 0·492 1·24
nucleotides within the ERE that influence ER
binding affinity and transcriptional response. Here
we report the first set of determinations of relative
between Kd and EC50 for ER. However, there binding affinities of ER versus ER for the same
was a significant correlation (R2 =0·90, PERE length impacts ER function · P C KULAKOSKY and others 149
and methods) compared with a phosphor-based palindromic ERE oligomers from 8 nM to 200 nM
detector. when the last nucleotides in the EREc15 were
Most studies quantitating ER–ERE binding symmetrically exchanged, i.e. from 5 -AGGTCAC
affinity have used short synthetic oligomers AGTGACCT-3 to 5 -TGGTCACAGTGACCA-
(Murdoch et al. 1990, Augereau et al. 1994, Arnold 3 (Boyer et al. 2000). Similar symmetrical purine-
et al. 1996, Anderson et al. 1998, Driscoll et al. 1998, to-pyrimidine/pyrimidine-to-purine nucleotide ex-
Boyer et al. 2000). Here we used longer restriction changes within the 13 bp ERE palindrome resulted
fragments in which the ERE is embedded within in comparable decreases in binding affinity (Boyer
plasmid DNA, a situation that more closely et al. 2000). Together, these data indicate that each
approximates the context of an ERE within a gene base pair within the 15 bp ERE palindrome
promoter, but eliminates the confounding effect of contributes to ER binding affinity (reviewed by
binding sites for other transcription factors, Klinge 2001).
therefore giving a neutral background. In previous Previously, we compared ER binding affinity and
studies, we determined that the Kd for ER transcriptional activity from the non-palindromic
interaction with non-specific plasmid DNA is in EREs from the promoters of the pS2, progesterone
excess of 450 nM (Klinge et al. 1992). More receptor, and c-fos genes, EREc19,19, and direct
recently, we showed that addition of poly(dI-dC) and indirect repeats of the ERE half-site (Klinge
did not affect the affinity of ER–ERE binding, but et al. 2001a, Tyulmenkov & Klinge 2001b). We
slightly decreased ER–ERE binding affinity reported that the affinity of ER–ERE binding
(Tyulmenkov & Klinge 2001a). Theoretically, our correlated with transcriptional activity. Here we
use of long ERE oligomeres has the disadvantage of report the first comparison of ER and ER
biasing the high affinity binding measurement with affinity and transcriptional activity from the same
the ‘sea’ of low affinity sites; however, the Kd for palindromic EREs. Differences in E2-induced
ER binding to EREc19,19 determined here is transcription were not proportional to the differ-
very similar to that reported for ER binding to ence in ER binding affinity between the 13 and
this same ERE as a 38 bp oligomer (Driscoll et al. 15 bp ERE palindromes. The small changes in
1998). Further, any effect of low affinity, non- reporter induction caused by relatively large
specific ER-DNA binding is constant, given the differences in ER binding affinities indicate that ER
identical plasmid DNA sequence flanking the binding affinities have relatively little effect on
EREs. Our assay has a distinct advantage over transcriptional response. This might be expected if
approximations using short annealed oligonucleo- the assays were performed under conditions in
tides which have problems including simple length which the reporter plasmids were saturated with
and end effects on ER binding affinity. ER since, by analogy to enzyme kinetics, a large
The observation that addition of one nucleotide change in Kd would cause a relatively small change
in each arm of the minimal EREc13 to form in Vmax. Nonetheless, there was a significant
EREc15 increased ER binding affinity is in correlation between ER binding affinity and
concordance with crystal structure studies showing transcription. In contrast, ER binding affinity did
that bacterially expressed ER DNA binding not correlate with reporter activity in transiently
domain (DBD) contacts bases outside the minimal transfected cells.
13 bp ERE palindrome in the 19 bp Xenopus A comparison of the amount of ER expression
vitellogenin A2 ERE (Schwabe et al. 1990, 1993). plasmid required to achieve 50% of the maximal
DNase I footprinting showed that ER protected luciferase activity (EC50) for each ERE revealed a
22 bp of DNA centering on the ERE palindrome in significant correlation between the affinity of
ERE19,19 (Driscoll et al. 1996). Similar DNase I ER–ERE binding and the EC50, confirming the
footprinting patterns for ER interaction with the relationship between affinity and the simpler
EREs in the promoters of the Xenopus vitellogenin transcriptional activation assays. Again there was
A2 and B1, pS2, and oxytocin genes have been no correlation between Kd for ER–ERE binding
reported (Wood et al. 1998, 2001). Interestingly, and EC50. These differences between ER and
measurement of ER–ERE interaction by fluor- ER in the transiently transfected cells are not due
escence anisotropy showed a reduction in affinity to differences in the levels of receptor expression
ER interaction with short (approx. 35 bp) 15 bp since EC50 values for E2 concentration for ER
www.endocrinology.org Journal of Molecular Endocrinology (2002) 29, 137–152
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free access150 P C KULAKOSKY and others · ERE length impacts ER function
and ER for each ERE are similar. Another Acknowledgements
possible explanation for the lack of correlation with
ER is that we used rat ER versus human ER We thank Drs Eva Enmark, Eckardt Treuter, and
both for the transient transfection experiments and Jan-Ake Gustafsson for providing ER plasmids.
Kd determinations. While other investigators have We thank Dr K Cameron Falkner for his help with
reported no differences in the transcriptional construction of the ER transfer plasmid and Dr
activity of long or short forms of human ER (Hall Valentyn V Tyulmenkov for his assistance in
& McDonnell 1999, Delaunay et al. 2000), and the statistical evaluation of the data. This work was
rat ER is highly conserved relative to the human supported by NIH R01 DK 53220 and a
ER (Kuiper et al. 1996, Moore et al. 1998), to the University of Louisville School of Medicine
best of our knowledge there is no direct comparison Research Grant to C M K. M A M and S C J were
of the transcriptional activity of human versus rat supported by NIH Grant T35 BM08561.
ER. Comparison of the amino acid (aa) sequence
of human ER versus rat ER revealed 58 aa
References
differences of which eight differences are non-
conserved (data not shown). The non-conserved aa An J, Ribeiro RC, Webb P, Gustafsson JA, Kushner PJ, Baxter JD
differences are located in the N-terminus, i.e. aa 65, & Leitman DC 1999 Estradiol repression of tumor necrosis
94, 98, and 132; and the ligand binding domaine factor-alpha transcription requires estrogen receptor activation
function-2 and is enhanced by coactivators. PNAS 96
(LBD): i.e. aa 236, 239, 261, and 280, but not in 15161–15166.
AF-2. None of the changes appear to impact sites Anderson I, Bartley CR, Lerch RA, Gray WG, Friesen PD & Gorski
of phosphorylation (Tremblay et al. 1999) or J 1998 Estrogen receptor alpha requires no accessory factors for
high-affinity binding to a consensus response element. Biochemistry
glycosylation (Cheng & Hart 2001). The ramifica- 37 17287–17298.
tions of these aa changes beween human and rat Anolik JH, Klinge CM, Bambara RA & Hilf R 1993 Differential
ER have not been evaluated. impact of flanking sequences on estradiol- versus
4-hydroxytamoxifen-liganded estrogen receptor binding to
There appears to be some selective pressure that estrogen responsive element DNA. Journal of Steroid Biochemistry and
maintains the AT-richness of the 3 flanking Molecular Biology 46 713–730.
sequence of the ERE palindrome in genes highly Anolik JH, Klinge CM, Hilf R & Bambara RA 1995 Cooperative
binding of estrogen receptor to DNA depends on spacing of
induced by E2, e.g. the vitellogenins, chicken binding sites, flanking sequence, and ligand. Biochemistry 34
ovalbumin, and mouse lactoferrin (Anolik et al. 2511–2520.
1993). However, addition of an AT-rich region Anolik JH, Klinge CM, Brolly CL, Bambara RA & Hilf R 1996
Stability of the ligand of estrogen response element-bound
from the consensus ERE (Peale et al. 1988) estrogen receptor depends on flanking sequences and cellular
immediately flanking the 19 bp ERE palindrome factors. Journal of Steroid Biochemistry and Molecular Biology 59
(EREc19 versus ERE19,10) had little effect on 413–429.
Arnold SF, Klotz DM, Collins BM, Vonier PM, Guillette LJ Jr &
either ER or ER binding affinity or transcrip- McLachlan JA 1996 Synergistic activation of estrogen receptor
tion. Our experimental system might not detect a with combinations of environmental chemicals. Science 272
function for this flanking sequence as a conse- 1489–1492.
Augereau P, Miralles F, Cavailles V, Gaudelet C, Parker M &
quence of working with a consensus sequence Rochefort H 1994 Characterization of the proximal
rather than natural promoter regions. Further- estrogen-responsive element of human cathepsin D gene. Molecular
more, chromatin structure may impact the function Endocrinology 8 693–703.
Ayres MD, Howard SC, Kuzio J, Lopez-Ferber M & Possee RD
of the flanking sequence in vivo. 1994 The complete DNA sequence of Autographa californica nuclear
Another reason that transcriptional activation polyhedrosis virus. Virology 202 586–605.
might peak with a 15 bp ERE palindrome with no Bonkhoff H, Fixemer T, Hunsicker I & Remberger K 1999 Estrogen
receptor expression in prostate cancer and premalignant prostatic
apparent function for the extended palindrome and lesions. American Journal of Pathology 155 641–647.
conserved flanking sequence is that these functions Boyer M, Poujol N, Margeat E & Royer CA 2000 Quantitative
may not be active in CHO cells. Similarly, the lack characterization of the interaction between purified human
estrogen receptor alpha and DNA using fluorescence anisotropy.
of correlation between ER–ERE affinity and Nucleic Acids Research 28 2494–2502.
ER-induced transcriptional response does not Cheng X & Hart GW 2001 Alternative O-glycosylation/
necessarily indicate that transcription is indepen- O-phosphorylation of serine-16 in murine estrogen receptor beta:
dent of binding affinity, but more probably post-translational regulation of turnover and transactivation
activity. Journal of Biological Chemistry 276 10570–10575.
indicates that other factors are obscuring this Ciana P, Di Luccio G, Belcredito S, Pollio G, Vegeto E, Tatangelo
relationship. L, Tiveron C & Maggi A 2001 Engineering of a mouse for the in
Journal of Molecular Endocrinology (2002) 29, 137–152 www.endocrinology.org
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free accessERE length impacts ER function · P C KULAKOSKY and others 151
vivo profiling of estrogen receptor activity. Molecular Endocrinology 15 4-hydroxytamoxifen ligand, but not estradiol, and indicate
1104–1113. ligand-specific differences in the recognition of estrogen response
Cowley SM & Parker MG 1999 A comparison of transcriptional element DNA in vitro. Steroids 61 278–289.
activation by ER alpha and ER beta. Journal of Steroid Biochemistry Klinge CM, Bodenner DL, Desai D, Niles RM & Traish AM 1997a
and Molecular Biology 69 165–175. Binding of type II nuclear receptors and estrogen receptor to full
Delaunay F, Pettersson K, Tujague M & Gustafsson JA 2000 and half-site estrogen response elements in vitro. Nucleic Acids
Functional differences between the amino-terminal domains of Research 25 1903–1912.
estrogen receptors alpha and beta. Molecular Pharmacology 58 Klinge CM, Silver BF, Driscoll MD, Sathya G, Bambara RA & Hilf
584–590. R 1997b COUP-TF interacts with estrogen receptor, binds to
Driscoll MD, Klinge CM, Hilf R & Bambara RA 1996 Footprint estrogen response elements and half-sites, and modulates
analysis of estrogen receptor binding to adjacent estrogen response estrogen-induced gene expression. Journal of Biological Chemistry 272
elements. Journal of Steroid Biochemistry and Molecular Biology 58 31465–31474.
45–61. Klinge CM, Studinski-Jones AL, Kulakosky PC, Bambara RA & Hilf
Driscoll MD, Sathya G, Muyan M, Klinge CM, Hilf R & Bambara R 1998 Comparison of tamoxifen ligands on estrogen receptor
RA 1998 Sequence requirements for estrogen receptor binding to interaction with estrogen response elements. Molecular and Cellular
estrogen response elements. Journal of Biological Chemistry 273 Endocrinology 143 79–90.
29321–29330. Klinge CM, Bowers JL, Kulakosky PC, Kamboj KK & Swanson HI
Hall JM & McDonnell DP 1999 The estrogen receptor beta-isoform 1999 The aryl hydrocarbon receptor (AHR)/AHR nuclear
(ERbeta) of the human estrogen receptor modulates ERalpha translocator (ARNT) heterodimer interacts with naturally
transcriptional activity and is a key regulator of the cellular occurring estrogen response elements. Molecular and Cellular
response to estrogens and antiestrogens. Endocrinology 140 Endocrinology 157 105–119.
5566–5578.
Klinge CM, Jernigan SC, Smith SL, Tyulmenkov VV & Kulakosky
Hess RA, Gist DH, Bunick D, Lubahn DB, Farrell A, Bahr J, Cooke PC 2001 Estrogen response element sequence impacts the
PS & Greene GL 1997 Estrogen receptor (alpha and beta) conformation and transcriptional activity of estrogen receptor .
expression in the excurrent ducts of the adult male rat Molecular and Cellular Endocrinology 174 151–166.
reproductive tract. Journal of Andrology 18 602–611.
Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S & Gustafsson
Hiroi H, Inoue S, Watanabe T, Goto W, Orimo A, Momoeda M, J-A 1996 Cloning of a novel estrogen receptor expressed in rat
Tsutsumi O, Taketani Y & Muramatsu M 1999 Differential prostate and ovary. PNAS 93 5925–5930.
immunolocalization of estrogen receptor alpha and beta in rat
ovary and uterus. Journal of Molecular Endocrinology 22 37–44. Kuiper GG, Carlsson B, Grandien J, Enmark E, Haggblad J, Nilsson
S & Gustafsson J-A 1997 Comparison of the ligand binding
Iwao K, Miyoshi Y, Egawa C, Ikeda N & Noguchi S 2000
specificity and transcript tissue distribution of estrogen receptors
Quantitative analysis of estrogen receptor-beta mRNA and its
and . Endocrinology 138 863–870.
variants in human breast cancers. International Journal of Cancer 88
733–736. Lau KM, LaSpina M, Long J & Ho SM 2000 Expression of
Jones PS, Parrott E & White IN 1999 Activation of transcription by estrogen receptor (ER)-alpha and ER-beta in normal and
estrogen receptor alpha and beta is cell type- and malignant prostatic epithelial cells: regulation by methylation
promoter-dependent. Journal of Biological Chemistry 274 and involvement in growth regulation. Cancer Research 60
32008–32014. 3175–3182.
Klein-Hitpass L, Schorpp M, Wagner U & Ryffel GU 1986 An McInerney EM, Ince BA, Shapiro DJ & Katzenellenbogen BS 1996
estrogen-responsive element derived from the 5 flanking region of A transcriptionally active estrogen receptor mutant is a novel type
the Xenopus vitellogenin A2 gene functions in transfected human of dominant negative inhibitor of estrogen action. Molecular
cells. Cell 46 1053–1061. Endocrinology 10 1519–1526.
Klein-Hitpass L, Ryffel GU, Heitlinger E & Cato AC 1988 A 13 bp Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA,
palindrome is a functional estrogen responsive element and Horne EL, Su JL, Kliewer SA, Lehmann JM & Willson TM 1998
interacts specifically with estrogen receptor. Nucleic Acids Research Cloning and characterization of human estrogen receptor beta
16 647–663. isoforms. Biochemical and Biophysical Research Communications 247
Klein-Hitpass L, Tsai SY, Greene GL, Clark JH, Tsai MJ & 75–78.
O’Malley BW 1989 Specific binding of estrogen receptor to the Mosselman S, Polman J & Dijkrms R 1996 ERb: identification and
estrogen response element. Molecular and Cellular Biology 9 43–49. characterization of a novel human estrogen receptor. FEBS Letters
Klinge CM 1999a Estrogen receptor binding to estrogen response 392 49–53.
elements slows ligand dissociation and synergistically activates Murdoch FE, Meier DA, Furlow JD, Grunwald KA & Gorski J
reporter gene expression. Molecular and Cellular Endocrinology 150 1990 Estrogen receptor binding to a DNA response element
99–111. in vitro is not dependent upon estradiol. Biochemistry 29
Klinge CM 1999b Role of estrogen receptor ligand and estrogen 8377–8385.
response element sequence on interaction with chicken ovalbumin Nardulli AM, Greene GL & Shapiro DJ 1993 Human estrogen
upstream promoter transcription factor (COUP-TF). Journal of receptor bound to an estrogen response element bends DNA.
Steroid Biochemistry and Molecular Biology 71 1–19. Molecular Endocrinology 7 331–340.
Klinge CM 2000 Estrogen receptor interaction with co-activators Nardulli AM, Grobner C & Cotter D 1995 Estrogen
and co-repressors. Steroids 65 227–251. receptor-induced DNA bending: Orientation of the bend and
Klinge CM 2001 Estrogen receptor interaction with estrogen replacement of an estrogen response element with an intrinsic
response elements. Nucleic Acids Research 29 2905–2919. DNA bending sequence. Molecular Endocrinology 9 1064–1076.
Klinge CM, Peale FV Jr, Hilf R, Bambara RA & Zain S 1992 Obourn JD, Koszewski NJ & Notides AC 1993 Hormone- and
Cooperative estrogen receptor interaction with consensus or DNA-binding mechanisms of the recombinant human estrogen
variant estrogen responsive elements in vitro. Cancer Research 52 receptor. Biochemistry 32 6229–6236.
1073–1081. Pavlik EJ & Coulson PB 1976 Hydroxylapatite ‘batch’ assay for
Klinge CM, Traish AM, Driscoll MD, Hilf R & Bambara RA 1996 estrogen receptor: increased sensitivity over present receptor
Site-directed estrogen receptor antibodies stabilize assays. Journal of Steroid Biochemistry 7 357–368.
www.endocrinology.org Journal of Molecular Endocrinology (2002) 29, 137–152
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free access152 P C KULAKOSKY and others · ERE length impacts ER function
Peale FV, Ludwig LB, Zain S, Hilf R & Bambara RA 1988 binding in the presence of nonspecific DNA. Archives of Biochemistry
Properties of a high-affinity DNA binding site for estrogen and Biophysics 390 253–264.
receptor. PNAS 85 1038–1042. Tyulmenkov VV& Klinge CM 2001b A mathematical approach to
Pelletier G, Labrie C & Labrie F 2000 Localization of oestrogen predict the affinity of estrogen receptors alpha and beta binding to
receptor alpha, oestrogen receptor beta and androgen receptors DNA. Molecular and Cellular Endocrinology 182 109–119.
in the rat reproductive organs. Journal of Endocrinology 165 Tyulmenkov VT, Jernigan SC & Klinge CM 2000 Comparison of
359–370. transcriptional synergy of estrogen receptors alpha and beta from
Schwabe JWR, Neuhaus D & Rhodes D 1990 Solution structure of multiple tandem estrogen response elements. Molecular and Cellular
the DNA-binding domain of the oestrogen receptor. Nature 348 Endocrinology 165 151–161.
458–461. Wood JR, Greene GL & Nardulli AM 1998 Estrogen response
Schwabe JWR, Chapman L, Finch JT & Rhodes D 1993 The elements function as allosteric modulators of estrogen receptor
crystal structure of the estrogen receptor DNA-binding domain conformation. Molecular and Cellular Biology 18 1927–1934.
bound to DNA: How receptors discriminate between their Wood JR, Likhite VS, Loven MA & Nardulli AM 2001 Allosteric
response elements. Cell 75 567–578. modulation of estrogen receptor conformation by different
Tremblay A, Tremblay GB, Labrie F & Giguere V 1999 estrogen response elements. Molecular Endocrinology 15
Ligand-independent recruitment of SRC-1 to estrogen receptor 1114–1126.
beta through phosphorylation of activation function AF-1.
Molecular Cell 3 513–519.
Tyulmenkov VV & Klinge CM 2001a Estrogen receptors alpha and Received 2 January 2002
beta exhibit different estradiol and estrogen response element Accepted 25 March 2002
Journal of Molecular Endocrinology (2002) 29, 137–152 www.endocrinology.org
Downloaded from Bioscientifica.com at 01/19/2021 01:30:17AM
via free accessYou can also read
