Cytokine requirements for the growth and development of
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Cytokine requirements for the growth and development of
mouse NK cells in vitro
Jennifer A. Toomey,* Frances Gays,* Don Foster,† and Colin G. Brooks*
*School of Cell and Molecular Biosciences, The Medical School, Newcastle, United Kingdom; and †Department of
Cytokine Biology, ZymoGenetics Inc., Seattle, Washington
Abstract: Natural killer (NK) cells arise from mice deficient in expression of ␥c have moderate numbers of B
immature progenitors present in fetal tissues and cells and T cells but no detectable NK cells [1, 2]. ␥c Forms
adult bone marrow, but the factors responsible for part of the receptors for several cytokines, including interleu-
driving the proliferation and differentiation of kin (IL)-2, IL-4, IL-7, IL-9, IL-15 [3], the recently discovered
these progenitors are poorly understood. Mouse IL-21 [4], and possibly other as-yet unknown cytokines and
NK cells had previously been thought not to ex- signaling molecules, implying that one or more of these ␥c-
press interleukin (IL)-2R␣ chains, but we show containing receptors plays a critical role in NK cell develop-
here that immature and mature mouse NK cells ment. The ability of IL-2 to promote the growth and activation
express IL-2R␣ chain mRNA and that low levels of of mature NK cells makes IL-2 an attractive candidate. Indeed,
IL-2R␣ chains can be detected on the surface of numerous in vitro studies have shown that IL-2 can promote
immature and mature NK cells provided they are the development of NK cells from immature cells obtained from
cultured in the absence of IL-2. Despite their po- human [5, 6] and mouse [7–9] bone marrow (BM) and from
tential expression of high-affinity IL-2 receptors, human [10] and mouse [11, 12] fetal liver and thymus. Fur-
immature NK cells only proliferate if IL-2 is thermore, IL-2-deficient humans [13] and mice [14] have
present at extremely high concentrations. Surpris- markedly reduced levels of NK cells and NK cell functions,
ingly, IL-15 can also only support the growth of and IL-2R␣ [15]- and IL-2R [16]-deficient mice have greatly
immature NK cells at high, presumably nonphysi- reduced numbers of NK cells. However, IL-2 and IL-2R␣
ological concentrations. Although NK cells express deficiency causes a general disturbance of lymphocyte ho-
mRNA for the high-affinity IL-15R␣ chain, they meostasis that could indirectly affect NK cell numbers and
also express a variety of alternately spliced tran- activity. In addition, it is now known that the IL-2R chain
scripts whose protein products could potentially participates in the formation of receptors for another cytokine
disrupt signaling through IL-15 receptors. The re- IL-15. In conjunction with ␥c, IL-2R forms part of a low-
quirement for high concentrations of IL-2 and affinity receptor that binds IL-15 with an association constant
IL-15 suggests that if these cytokines play any role estimated at between 270 pM and 2.5 nM [17–20]. A high-
in the proliferative expansion of NK cells in vivo, affinity receptor, involving the participation of the IL-15R␣
they act indirectly via other cells or in cooperation chain, has also been identified, which binds IL-15 with an
with other factors. In support of the latter possibil- affinity between 12 and 200 pM [17–22]. Evidence that IL-15
ity, we report that the recently described cytokine might be involved in NK cell development in vivo was initially
IL-21 can markedly enhance the proliferation of suggested by the finding that mice lacking the transcription
immature (and mature) NK cells in the presence of factor interferon (IFN)-regulatory factor 1, which is required for
doses of IL-2 and IL-15 that by themselves have IL-15 production, had a deficiency of NK cells that could be
little growth-promoting activity. J. Leukoc. Biol. overcome, at least in vitro, by soluble IL-15 [23]. More directly,
74: 233–242; 2003. IL-15 [24]- and IL-15R␣ [25]-deficient mice were subse-
quently shown to lack readily detectable NK cells. One expla-
Key Words: rodent 䡠 cellular proliferation 䡠 differentiation nation for these findings is that IL-15 directly promotes the
growth and differentiation of NK cell progenitors via high-
affinity IL-15 receptors expressed on NK cells. Several studies
INTRODUCTION have shown that IL-15 can indeed promote the development of
NK cells from human [26] and mouse [27–29] progenitors in
Although the developmental pathway of B and T lymphocytes vitro. However, in the absence of suitable antibodies against
is now understood in considerable detail, the factors and events
that control the development of the third major population of
lymphocytes found in humans and other vertebrate species,
Correspondence: Dr. Colin G. Brooks, School of Cell and Molecular Bio-
natural killer (NK) cells, are still unclear. One of the key issues
sciences, The Medical School, Newcastle NE2 4HH, UK. E-mail:
is the nature of the growth factors and receptors that support colin.brooks@newcastle.ac.uk
the proliferative expansion of immature NK cells. Of consid- Received March 10, 2003; accepted April 2, 2003; doi: 10.1189/
erable importance in this regard has been the discovery that jlb.0303097.
Journal of Leukocyte Biology Volume 74, August 2003 233the IL-15R␣ chain, there is currently no direct evidence that typically comprised ⬎95% CD8⫹CD3⫹ cells. CTLL2 cells [31] were grown
NK cells or their progenitors express IL-15R␣ at the cell continuously in medium containing 60 pM IL-2.
Human peripheral blood mononuclear cells (PBMC) were prepared by
surface. A prediction of this hypothesis would be that the density-step separation on Histopaque (Sigma). The growth of NK cells was
growth and differentiation of immature NK cells would occur at measured by incubating aliquots of 1 ⫻ 106 whole PBMC in 24-well plates
doses of IL-15 sufficient to saturate high-affinity IL-15 recep- containing 1 ml/well medium with appropriate cytokines. Cultures were refed
tors. In the present study we report that although immature and/or subcultured twice per week for 14 days, and then the numbers of cells
mouse NK cells can indeed proliferate vigorously and differ- were determined and their composition analyzed by immunofluorescence stain-
ing as described below. Typically, ⬃80% of cells were CD56/CD16⫹CD3– .
entiate in response to soluble IL-15, they do so only at doses The growth of T cells was measured by incubating aliquots of whole PBMC in
much higher that those that would be required to saturate 24-well plates containing 1 ml/well medium with 5 g/ml Con A. Cells were
high-affinity receptors. Adult mouse NK cells also cannot then washed and replated at 2 ⫻ 105/well in medium containing appropriate
proliferate or be activated by low doses of soluble IL-15 alone, cytokines. After 7 days, cell numbers were determined, and their composition
nor surprisingly can mouse T cells. These findings raise pro- was analyzed. Typically, ⬎90% of cells were CD56/CD16– CD3⫹.
found questions concerning the exact role of IL-15 in promot-
Cell growth assay
ing NK cell development and T cell homeostasis. One possi-
bility is that efficient interaction of IL-15 with NK cells re- At the end of the culture period, the concentration of cells in cultures was
quires the participation of other cell-bound or soluble factors. determined by adding a known number of FlowCount beads (Beckman-Coulter,
Miami, FL), running the mixture through a FACScan (Becton Dickinson, San
In support of this, we report here that low doses of IL-21
Jose, CA), and determining the ratio of beads to viable cells using forward- and
enhance the responsiveness of immature and mature NK cells side-scatter characteristics. In the case of human cells, the number of NK cells
to suboptimal doses of IL-15 and IL-2. and T cells was calculated by multiplying the total number of cells by the
proportion that was NK or T cells as determined by immunofluorescence. All
cultures were set up in triplicates.
MATERIALS AND METHODS
Immunofluorescence and flow cytometry
Animals Aliquots of ⬃2 ⫻ 105 cells were incubated at room temperature with appro-
priate combinations of reagents in Hanks’ balanced saline solution (61200-
Normal and timed-mated C57BL/6 mice were obtained from Bantin and
093; Life Technologies) containing no bicarbonate and supplemented with 2%
Kingman (Hull, UK). Recombination-activating gene (RAG)2 knockout mice
FBS and 0.2% sodium azide, except for staining with Qa1 tetramers that
on a C57 background were kindly provided by Professor David Gray (Univer-
require incubation at 37°C [34]. Staining was analyzed on a FACScan using
sity of Edinburgh, UK).
forward- and side-scatter to gate on single viable cells. Compensation for
spectral overlap of dyes was set by running mixtures of unstained cells and
Culture media and reagents cells stained with each fluorochrome singly. To permit comparison between the
Cells were cultured in a 10% CO2 atmosphere at 37°C in Dulbecco’s modified levels of staining in different experiments, the same reagent stocks and
Eagle’s medium (52100-039; Life Technologies, Paisley, UK) made up in FACScan acquisition parameters were used throughout. Consistency was con-
highly purified water and supplemented with 2⫻ nonessential amino acids, firmed by the finding that the median fluorescence level of control beads
5 ⫻ 10⫺5 M 2-mercaptoethanol, and 10% fetal bovine serum (FBS; F-7524; (FluoroSpheres; Dako, Glostrup, Denmark) did not vary by more than 10%
Sigma, Poole, UK). Mouse recombinant (mr)IL-4 was obtained as the super- between experiments. Data were collected using Lysis II software (Becton
natant of ⫻6310 cells transfected with mIL-4 cDNA [30], kindly provided by Dickinson), converted to a PC format using Lifutil, analyzed using FCS Express
Professor F. Melchers (Basel Institute for Immunology, Switzerland). Unitage V2 software, and compiled in Microsoft Excel.
was determined by titration on CTLL2 cells [31]. Human (h)rIL-2 was obtained The purity and phenotype of mouse NK cells were determined using the
from Cetus (Emeryville, CA). mrIL-2, mrIL-15, and hrIL-15 were obtained following reagents: fluorescein isothiocyanate (FITC) PK136 anti-NK1.1 (BD
from Peprotech (Rocky Hill, NJ). mrIL-21 was prepared as described previ- PharMingen, San Diego, CA); FITC 18d3 anti-CD94 (kindly provided by
ously [32]. Professor D. Raulet, University of California, Berkeley); biotinylated Qa1b–
Qdm tetramers, refolded using human 2-microglobulin (National Institutes of
Cells Health Tetramer Facility, Atlanta, GA) and assembled with Red670-strepta-
vidin (InVitrogen, Carlsbad, CA); KT3 anti-CD3 (kindly provided by Professor
Adult NK cells were purified from C57BL/6 spleens as described previously E. Simpson, Imperial College, London, UK); A1 anti-Ly49A (kindly provided
[33]. Following expansion in IL-2, ⬎98% of cells were NK1.1⫹CD3–. Fetal by Professor J. Allison, University of California, Berkeley); 5E6 anti-Ly49C/I
thymocytes were prepared from the day 14 embryos of timed-mated C57BL/6 (BD PharMingen); 4D11 anti-Ly49G (kindly provided by Dr. L. Mason, Na-
mice (day of vaginal plug⫽0), cultured for 2–3 days in medium containing 10 tional Cancer Institute, Frederick, MD); 4D12 anti-Ly49C/E (kindly provided
U/ml IL-4 and 10 ng/ml phorbol 12-myristate 13-acetate (PMA; P8139; by Dr. G. Leclercq, University of Ghent, Belgium); or 10A7 anti-NKRP1
Sigma), and were then transferred to medium containing the test cytokines. (kindly provided by Prof. V. Kumar, University of Chicago, IL), followed by
Clones were obtained by limiting dilution in 96-well plates at the time of Alexa Fluor 488-conjugated goat anti-rat immunoglobulin G (IgG) or goat
transfer to IL-2. The established NK cell clones 1608b and I2/22 had been anti-mouse IgG (Molecular Probes, Eugene, OR) as appropriate. IL-2 receptors
maintained in continuous culture for ⬎1 year in medium containing 20 nM on mouse NK cells were identified by staining with biotinylated 7D4 anti-IL-
IL-2. Approximately 1 month before their use in experiments, sublines of these 2R␣ (BD PharMingen) followed by Alexa Fluor 647-streptavidin (Molecular
were set up and maintained in parallel in 200 pM IL-2. Probes) or TM1 anti-IL-2R (kindly provided by Dr. T. Tanaka, University of
Mouse CD4 and CD8 T cells were obtained by first depleting CD8 T cells Tokyo, Japan) ⫹ Alexa Fluor 488 goat anti-rat IgG. Human NK and T cells
with the monoclonal antibody (mAb) 3.168 (kindly provided by Professor F. were identified by staining with Simultest NK reagent (Becton Dickinson),
Fitch, University of Chicago, IL) or depleting CD4 T cells with the mAb which contains a cocktail of phycoerythrin (PE) anti-CD56, PE anti-CD16, and
RL172.4 (kindly provided by Professor H. R. MacDonald, Ludwig Institute, FITC anti-CD3 mAb.
Epalinges, Switzerland) and normal rabbit serum. Aliquots of 1 ⫻ 106 cells
were then cultured in 24-well plates in medium containing 2 g/ml concanava- Cytotoxicity assays
lin A (Con A; Sigma) for 1 day and washed, and aliquots of ⬃2 ⫻ 105 cells
were set up in 24-well plates containing 1 ml/well fresh medium with appro- These were performed in a standard manner by incubating serial dilutions of
priate cytokines. At the end of the culture period, the CD4 T cell population effector cells for 4 h in V-bottomed microtest plates with 5000 51Cr-labeled
typically comprised ⬎85% CD4⫹CD3⫹ cells, and the CD8 T cell population YAC-1 or blast target cells. The latter were prepared from frozen CD8-depleted
234 Journal of Leukocyte Biology Volume 74, August 2003 http://www.jleukbio.orgspleen cells of C57BL/6 mice and mice homozygous for the 2m knockout
mutation on a C57 background, kindly provided by Professor E. Jenkinson
(University Birmingham, UK). Thawed spleen cells were cultured for 2–3 days
in medium containing 2 g/ml Con A and 200 pM IL-2.
Reverse transcriptase-polymerase chain reaction
(RT-PCR)
RNA was prepared using RNAzol (CS-104, Biogenesis, Poole, UK), according
to the manufacturer’s instructions. cDNA was prepared by incubating 20 l
denatured (70°C/10 min) RNA at 150 g/ml with 500 U/ml RNasin (Promega,
Madison, WI), 0.5 mM dNTPs, 5 M oligo dT, and 2500 U/ml MMV H– RT
(Promega), according to the manufacturer’s instructions. For PCR, 20 l
reactions containing 20 U/ml Taq polymerase (Bioline, Randolf, MA) in the
manufacturer’s buffer, 2 mM dNTPs, 3 mM Mg, and cDNA corresponding to
known numbers of cells were incubated with the following primer pairs for 1
min at 95°C followed by 40 cycles of 95°C/30 s, 58°C/30 s, and 72°C/60 s:
IL-2R␣, forward ATGTGCCAGGAAGATGG, reverse CTAGATGGTTCTTCT-
GCTC; IL-2R, forward GGTTGGCGTAGGGTAAAGAC, reverse AGGGGA-
CAGGCGAGGAGAGC; IL-2R␥, forward CTCCTACTCTGCCCCTTCCA, re-
verse TCCATTTACTCCACTGTTGA; IL-15R␣ isoform 1, 5⬘-untranslated re-
gion (UTR), forward CTTGCGTCCCGTTGGGTC; IL-15R␣ isoforms 1 and 2
internal, forward TCTCCCCACAGTTCCAAAAT; IL-15R␣ isoform 2, 5⬘-UTR,
forward GAAAAGGGAGATCGCCGGCTT; IL-15R␣ isoforms 1 and 2, 3⬘-
UTR, reverse GGCACCCAGGCTCAGTAAAA. Aliquots of PCR reactions
were run on 1% agarose gels containing ethidium bromide. PCR products were
purified from gels using Qiagen (Hilden, Germany) gel extraction kits and
cloned into pCR4-TA (InVitrogen), according to the manufacturers’ instruc-
tions. Plasmids were prepared from individual colonies according to standard
methods, purified on Minelute columns (Qiagen), and sequenced using M13
forward and reverse primers.
RESULTS
Fig. 1. Growth of NK cells and T cells in IL-2 and IL-15. (A–E) Mouse
IL-15 can support the growth and activation of immature and mature NK cells, CD4 and CD8 T cells, and CTLL2 cells were
cultured for 3–5 days in various concentrations of m- or hIL-2 and -IL-15.
mouse NK cells in vitro but only at very high (F–I) The long-term mouse NK cell lines 1608b and I2/22 were maintained in
concentrations parallel in 20 nM or 0.2 nM IL-2 for 1 month and were then tested in a 3-day
assay for growth in various concentrations of hIL-2 and mIL-15. (J) Human
The day-14 fetal thymus is a rich source of NK progenitors
PMBC were cultured for 14 days in various concentrations of hIL-2 or hIL-15,
[11]. Following initial exposure to IL-4 and PMA, immature and then the growth of NK cells was calculated from the total cell numbers per
NK cells proliferate vigorously to IL-2. However, as shown in culture and the percentage of these that were CD16/CD56⫹ CD3–. (K) PBMC
Figure 1A and in confirmation of previous results [11], rapid were activated for 1 day with 5 g/ml Con A, washed, and cultured in hIL-2
growth of immature NK cells occurs only at concentrations of or mIL-15 for 7 days, and then the growth of T cells was calculated from the
total cell numbers per culture and the percentage of these that were CD16/
mIL-2 or hIL-2 ⱖ 20 nM, suggesting that IL-2 may be acting
CD56– CD3⫹. The data shown are representative of at least three experiments
as an inefficient surrogate of some other cytokine, which more with each cell type.
efficiently supports the expansion of NK precursors in vivo.
One cytokine often considered as a candidate for such a role is
IL-15. In several studies [26 –29], IL-15 has been found to NK cell lines such as 1608b and I2/22 can respond well to low
support the development of immature NK cells in vitro, but no concentrations of IL-2, especially if maintained for some time
detailed quantitation of this phenomenon has been reported in a low dose of IL-2 (Fig. 1, F–I). However, the heightened
previously. As shown in Figure 1A, although m- and hIL-15 responsiveness to IL-2 of established NK lines is not accom-
can support the rapid proliferation of immature mouse NK cells panied by an equally heightened responsiveness to IL-15. In
in vitro, like IL-2 they do so only at nanomolar concentrations contrast to the situation in the mouse, freshly prepared human
(Fig. 1A). Nanomolar concentrations of IL-15 are also required NK cells responded relatively efficiently to hIL-2, 50% maxi-
to support vigorous proliferation of adult splenic NK cells (Fig. mal proliferation occurring at doses of IL-2 (50 –100 pM),
1B) and normal mouse CD4 and CD8 T cells (Fig. 1, C and D), similar to those required for the proliferation of human T cells
despite the fact that the latter cells respond to picomolar (Fig. 1, J and K). In addition, human NK cells and T cells also
concentrations of IL-2 (50% maximal proliferation at 20 –200 responded comparatively efficiently to IL-15, although the
pM). By contrast, all four cytokines induce proliferation of the amounts of IL-15 required were noticeably higher than the
mouse T cell line CTLL2 at low concentrations, 50% maximal amounts of IL-2.
proliferation occurring with ⬃2 pM hIL-2, mIL-2, and hIL-15 To determine whether the requirement of mouse NK cells for
and with ⬃200 pM mIL-15 (Fig. 1E). Interestingly, although very high concentrations of IL-2 and IL-15 was limited to
freshly derived immature and mature NK cells proliferate only proliferation, mouse spleen cells were incubated with various
with high concentrations of IL-2 and IL-15, established mouse doses of hIL-2 or mIL-15 and were then tested for cytolytic
Toomey et al. Cytokine requirements for the development of mouse NK cells 235activity against YAC-1 targets 3 days later. Little or no cyto-
toxicity was detected with 200 pM IL-2 or IL-15, and maximal
induction of cytolytic activity required ⱖ20 nM IL-2 or IL-15
(Fig. 2).
IL-15 supports the differentiation of immature
NK cells in an identical manner to IL-2
Following primary culture of day-14 fetal thymocytes in IL-4
and PMA, subsequent exposure to high concentrations of IL-2
induces not only rapid proliferation of these cells but also their
progressive differentiation into mature NK cells [34]. Amongst
the earliest events that take place is the acquisition of the NK
cell marker NK1.1 and receptors for the nonclassical class I
molecule Qa1. As shown in Figure 3A, exposure of immature
NK cells to high doses of IL-15 resulted in essentially identical
patterns and kinetics of acquisition of NK1.1 and Qa1 recep-
tors as seen with IL-2. After 5 days culture in IL-15, a
substantial proportion of developing NK cells had acquired
low-level expression of the Ly49 molecules (most likely Ly49E)
recognized by the mAb 4D12, and by 20 days, approximately
half of the cells grown in IL-15 expressed Ly49 molecules,
some at very high levels (Fig. 3B). At this point, NK cells
developing in IL-15 showed heterogeneous expression of CD94
and of the NKRP1A and D molecules recognized by the mAb
Fig. 3. IL-15 induces the differentiation of NK cells in an identical manner to
10A7 [35]. The patterns and kinetics of expression of Ly49,
IL-2. (A) Expression of NK1.1 and Qa1 receptors on day-14 fetal thymocytes
CD94, and NKRP1 molecules were essentially identical to that had been cultured for 2 days in IL-4 and PMA and subsequently for 1 or
those seen with cells grown in IL-2. At no point did NK cells 3 days in 20 nM hIL-2 or mIL-15. (B) Expression of the Ly49 molecules
differentiating in IL-15 or IL-2 express significant quantities of recognized by the mAb 4D12, of CD94 molecules, and of the NKRP1 mole-
Ly49A, C, G, or I (data not shown). However, NK cells devel- cules recognized by the mAb 10A7 following 5 days and 20 days of culture in
20 nM IL-2 or IL-15.
oping in IL-15, such as those developing in IL-2, acquired
potent cytolytic activity: They efficiently killed YAC and other
NK-sensitive targets and showed the same limited ability to
distinguish between class I-sufficient and class I-deficient Expression of IL-2 and IL-15 receptors on
blasts as has been reported previously [36, 37] for cells grown mouse NK cells
in IL-2 (data not shown). The concentrations of IL-2 and IL-15 required to drive the
proliferation, activation, and differentiation of freshly derived,
immature and mature mouse NK cells in vitro are in vast
excess over those that would be required to saturate high-
affinity IL-2 and IL-15 receptors, raising important questions
as to whether mouse NK cells express the component chains
required to form such receptors. However, as shown in Figure
4A, not only do cultured mouse NK cells express abundant
quantities of IL-2/15R and ␥c mRNA, they also express
readily detectable levels of IL-15R␣ mRNA and IL-2R␣
mRNA transcripts. IL-15R␣ and IL-2R␣ transcripts were
present at all stages during the in vitro development of NK
cells from immature progenitors (Fig. 4B). Using primers that
bind to the 5⬘ and 3⬘ UTRs of IL-15R␣ transcripts, complex
banding patterns were obtained with RNA from NK cells and
T cells, indicating extensive, alternative splicing of IL-15R␣
Fig. 2. Induction of cytotoxic activity by IL-2 and IL-15. Triplicate cultures primary transcripts (Fig. 4A). Amongst the novel transcripts
containing 0.5 million spleen cells were incubated with 0.2 nM (Œ), 2 nM (●), found in clones of immature NK cells was one in which the use
or 20 nM (f) hIL-2 or mIL-15. Three days later, cells were washed and of a cryptic splice site in exon 4 would potentially generate a
incubated at various dilutions with YAC-1 targets. The effector:target (E:T) form of the IL-15R␣ chain (termed isoform 1A), lacking the
ratios shown are based on the initial number of spleen cells. Fresh, uncultured
spleen cells gave ⬃5% cytotoxicity at an E:T ratio of 100:1, and spleen cells first 33 amino acids of the Pro/Thr-rich membrane proximal
cultured for 3 days without any cytokine showed no detectable cytotoxicity domain (Fig. 4C). Another transcript was found that lacked the
(data not shown). whole of exon 4 and would potentially generate a protein
236 Journal of Leukocyte Biology Volume 74, August 2003 http://www.jleukbio.orgFig. 4. Expression of mRNA for IL-15 and IL-2 receptor chains in
immature and mature NK cells. (A) cDNA from equal numbers of
cells of each type was amplified using internal primers for IL-2/
IL-15R and ␥c or “full-length” primers for IL-15R␣ isoform
(Iso)1, IL-15R␣ isoform 2, and IL-2R␣. RAGko, RAG2 knockout.
(B) cDNA from equal numbers of cells at different stages of NK
development was amplified with internal primers for IL-15R␣,
IL-2R, and ␥c and with full-length primers for IL-2R␣. FTC, feral
thymocytes. (C) Diagrammatic representation of alternate splicing
of IL-15R␣ transcripts. The upper part of each diagram shows the
exonic structure of the transcripts detected in this study, and open
triangles show the position of the primers and bent arrows, the
translational start sites. The lower part of each diagram shows the
putative polypeptide with domains designated according to Giri et
al. [22]: line, leader sequence; upward diagonal shading, “Sushi
domain”; checkered shading, linker domain; downward diagonal
shading, Pro/Thr-rich domain; solid shading, transmembrane do-
main; gray shading, cytoplasmic domain. The isoform 1 sequences
have been deposited in Genbank under accession numbers
AY219715–717, and the isoform 2 sequences under accession
numbers AY221616 – 619.
(termed isoform 1B) having no Pro/Thr-rich domain. A third be answered, as no suitable antibodies are available. However,
transcript lacked exons 3 and 4 and would potentially generate although IL-2R␣ chains were not detectable on freshly derived
a protein (termed isoform 1C) whose extracellular region com- immature or mature NK cells grown in IL-2, using a sensitive-
prised only the N-terminal Sushi domain. In addition, NK cells staining technique IL-2R␣ chains could be detected on cells
(and T cells) contained transcripts of isoform 2 of the IL-15R␣ grown in IL-15, albeit at levels less than one-tenth of those for
chain (GenBank NM133836) whose presence in lymphoid cells CD4 and CD8 T cells and less than one-hundredth of those for
has not been described previously. Comparison with the re- CTLL2 cells (Fig. 5). By contrast, all these cells expressed
cently obtained genomic sequence (GenBank AL831794.6) similar quantities of IL-2/IL-15R chains. Established NK cell
indicates that this isoform arises from splicing events that lines grown in 200 pM IL-2 expressed much higher levels of
introduce an alternate first exon, which we have termed exon IL-2R␣ chains than did freshly derived NK cells, even when
–1, located ⬃250 bases upstream of exon 1. This exon lacks an the latter were grown in IL-15.
initiator ATG codon and would potentially generate a greatly To understand why NK cells grown in IL-15 but not in IL-2
foreshortened IL-15R␣ chain lacking the normal leader se- expressed detectable levels of surface IL-2R␣, a series of
quence, the Sushi domain, and linker domain (Fig. 4C). Iso- short-term reculture experiments was performed. When imma-
form 2 was also subject to extensive, alternate splicing, result- ture NK cells that had been grown in 20 nM IL-15 for 5 days
ing in the loss of one or more internal exons (Fig. 4A; se- were washed and reincubated in 20 nM IL-2, the proportion of
quences deposited in GenBank). cells showing high-surface staining for IL-2R␣ chains declined
The question of whether IL-15R␣ chains are expressed on from 26% to 7% within 3 h (Fig. 6A). No such decline
the surface of NK cells and if so, in what form cannot currently occurred when cells were incubated in medium or in 20 nM
Toomey et al. Cytokine requirements for the development of mouse NK cells 237Fig. 5. Expression of IL-2R␣ and IL-2/IL-15R chains on immature and
mature NK cells. The following cells were stained with medium (dotted lines)
and anti-IL-2R␣ or anti-IL-2/IL-15R chain mAb (solid lines), followed by the
appropriate second layer reagent as described in Materials and Methods. (A)
Immature NK cells that had been grown for 3 days in IL-4 ⫹ PMA and
subsequently for 5 days in 20 nM hIL-2. (B) The same cells as in A but grown
for 5 days in 20 nM mIL-15. (C) Purified adult splenic NK cells grown for 5
days in 20 nM IL-2. (D) The same cells grown in 20 nM IL-15. (E) The
established NK clone 1608b grown in 200 pM IL-2. (F) The established NK
clone I2/22 grown in 200 pM IL-2. (G) CD4-depleted spleen cells grown for 5 Fig. 6. IL-2 modulates the expression of IL-2R␣ chains on immature NK
days in 200 pM IL-2 (98% CD3⫹, 85% CD4⫹, 5% CD8⫹). (H) CD8-depleted cells. (A) Immature NK cells that had been grown for 3 days in IL-4 ⫹ PMA
spleen cells grown for 5 days in 200 pM IL-2 (100% CD3⫹, 0% CD4⫹, 100% and subsequently for 5 days in 20 nM mIL-15 were washed and placed in
CD8⫹). (I) CTLL2 cells grown continuously in 60 pM IL-2. medium alone or medium containing 20 nM hIL-2, 200 pM hIL-2, 20 nM
mIL-15, or 20 nM hIL-2 ⫹ 20 nM mIL-15 and were stained with medium
(dotted lines) or anti-IL-2R␣ mAb (solid lines) followed by second-layer
reagent immediately or following 3 h incubation at 37°C. The percentage of
IL-15, but a similar decline occurred when they were incu- cells expressing high levels of IL-2R␣ chains is indicated. (B) As in A, but
bated in a mixture of IL-2 and IL-15, demonstrating that the cells were precultured for 5 days in 20 nM hIL-2.
effect of IL-2 was dominant. None of these changes in
IL-2R␣ expression occurred when the incubations were
conducted at ice temperature (data not shown). This, to- IL-21 can enhance the growth of mouse NK
gether with the observation that incubation of CTLL2 cells cells, but not T cells, in the presence of limiting
with 20 nM IL-2 at 37°C did not affect staining with concentrations of IL-2 or IL-15
anti-IL-2R␣ mAb (not shown) argue strongly that the effect
of IL-2 was to down-regulate the expression of IL-2R␣ One explanation for the failure of mouse NK cells to respond
chains on the surface of NK cells rather than to merely block efficiently to IL-2 and IL-15 in vitro is that NK cell responses
the binding of mAb. A prediction of this hypothesis would to physiological concentrations of these cytokines require ad-
be that if immature NK cells grown in IL-2 were washed and
incubated in medium alone or IL-15, there would be a rapid
increase in IL-2R␣ staining. Such an increase was indeed
observed (Fig. 6B). Importantly, 200 pM IL-2 was as effec-
tive as 20 nM IL-2 in down-regulating surface IL-2R␣ chain
expression (Fig. 6, A and B), indicating that most of the
IL-2R␣ chains expressed on the surface of NK cells are
integrated into high-affinity receptor complexes that are
rapidly internalized upon binding IL-2. This raised the
possibility that low concentrations of IL-2 might enhance
Fig. 7. Lack of synergism between IL-2 and IL-15 in promoting the growth of
the growth of NK cells in the presence of IL-15. However, no immature NK cells. Following exposure to IL-4 ⫹ PMA for 2 days, immature
such synergy between IL-2 and IL-15 could be detected NK cells were incubated for 3 days in medium containing 0, 0.2, 2, or 20 nM
(Fig. 7). hIL-2 in the presence of 0, 0.2, 2, or 20 nM mIL-15.
238 Journal of Leukocyte Biology Volume 74, August 2003 http://www.jleukbio.orgditional cell-bound or soluble factors. Several cytokines, in-
cluding IL-1, IL-3, IL-6, IL-7, IL-9, IL-10, IFN-␣/, IFN-␥,
tumor necrosis factor ␣, and transforming growth factor-, were
tested, and although several of these cytokines could inhibit
the growth of NK cells in the presence of IL-2 or IL-15, none
could enhance it. By contrast, the recently discovered cytokine
IL-21, which can promote the growth of human NK cells from
immature progenitors [32], displayed a remarkable, biphasic
effect on the growth of mouse NK cells: At high doses (2 nM),
it generally inhibited growth, whereas at low doses (approxi-
mately 20 pM), it could strongly enhance the growth of imma-
ture NK cells (Fig. 8A) and mature splenic NK cells (data not
shown), and the enhancing effect was much more pronounced
at limiting doses of IL-2 and IL-15. IL-21 by itself had no
ability to induce the growth of immature or mature NK cells.
IL-21 also enhanced the cytolytic activity of immature and
mature NK cells cultured in IL-2 but had no effect on the
acquisition of mature NK cell markers by developing NK cells
(data not shown). In particular, cells grown in the presence of
IL-21 acquired NK1.1, CD94, and the Ly49 molecules recog-
nized by the 4D12 mAb in a similar manner to that shown in
Figure 3 but did not acquire Ly49A, C, I, or G. In contrast to
its effects on NK cells, IL-21 had little effect on the growth of
CD4 or CD8 T cell blasts at any dose of IL-2 tested (Fig. 8, B
and C).
DISCUSSION
Although IL-15 can induce vigorous proliferation of immature
mouse NK cells and can induce them to differentiate into
mature, highly cytotoxic NK cells that express a range of NK
cell receptors, the data presented in this paper show that each
of these events requires IL-15 to be present in the extracellular
medium at high (nanomolar) concentrations. Similarly, al-
though IL-15 can cause rapid proliferation and activation of
mature NK cells and T cells, these events also require nano-
molar concentrations of IL-15. An important corollary from
these studies is that doses of IL-15 that would be sufficient to
saturate high-affinity IL-15 receptors are incapable of inducing Fig. 8. IL-21 can enhance the growth of NK cells in the presence of limiting
any measurable proliferation, differentiation, or activation of doses of IL-2 or IL-15. (A) Following exposure to IL-4 ⫹ PMA for 2 days,
immature NK cells were incubated for 3 days in medium containing various
immature or mature mouse NK cells or mouse T cells. The
concentrations of hIL-2 or mIL-15 together with titrated doses of mIL-21. (B)
implication of these findings is that normal mouse NK cells and CD4-depleted spleen cells were incubated for 1 day with Con A, then washed,
T cells lack functional, high-affinity IL-15 receptors capable of and cultured for 3 days in medium containing various concentrations of hIL-2
delivering activation signals. To our knowledge, the only mouse together with titrated doses of mIL-21. (C) CD8-depleted spleen cells were
cells reported to bind IL-15 with high affinity are the immor- incubated for 1 day with Con A, then washed, and cultured for 3 days in
medium containing various concentrations of hIL-2 together with titrated doses
talized T cell lines D10 and CTLL2 [17, 22], and we confirmed
of mIL-21.
in the present study that CTLL2 cells could respond relatively
efficiently to picomolar concentrations of IL-15. By contrast,
normal CD4 and CD8 blast cells could not. In the absence of chain lacking parts or all of the membrane-proximal, extracel-
mAb to IL-15R␣, it is not possible to determine directly lular domains but retaining the N-terminal Sushi domain that
whether normal NK cells and T cells express IL-15R␣ chains binds IL-15 [38]. NK cells also expressed IL-15R␣ transcripts
at the cell surface. RT-PCR followed by cloning and sequenc- that potentially encode a form of the IL-15R␣ chain, termed
ing demonstrated unambiguously that highly purified mouse isoform 2, which lacks the N-terminal 140 amino acids of
NK cells and T cells contained full-length (isoform 1) tran- isoform 1. Isoform 2 transcripts were also subject to extensive
scripts of IL-15R␣ chains. However, these procedures also alternate splicing. Thus, even if NK cells and T cells express
revealed the presence of a series of alternately spliced IL- IL-15R␣ chains on their surfaces, they may also express
15R␣ transcripts. Three of these transcripts (isoforms 1A, 1B, additional forms of the IL-15R␣ polypeptide that alter or
and 1C) potentially encode truncated forms of the IL-15R␣ interfere with signal transduction.
Toomey et al. Cytokine requirements for the development of mouse NK cells 239The situation regarding IL-2 and IL-15 dosimetry in man is down-regulated at picomolar doses of IL-2, implying that most less clear-cut. Human NK cells and T cells have been reported or all of the IL-2R␣ chains on NK cells are associated with to express high-affinity receptors for IL-15 with association high-affinity receptors. This is in line with previous studies that constants of 12–58 pM [17, 18, 20, 21] and low-affinity recep- showed that the IL-2-driven proliferation of immature and tors with association constants of 0.5–2.5 nM [17, 18, 20]. Our mature NK cells in the presence of limiting concentrations of studies showed that human NK cells and T cells responded to IL-2 could be inhibited by mAb to the IL-2R␣ chain [11]. IL-15 with 50% maximal responses at 0.2–2 nM, in good The concentrations of IL-2 and IL-15 required for efficient agreement with other reports [17–21]. These doses are much proliferation and differentiation of immature NK cells in vitro lower than those required to support the proliferation of mouse are much higher than those likely to be generated in vivo. This NK cells and T cells but exceed those that would be needed to is especially the case for IL-15, whose efficiency of production occupy most high-affinity IL-15 receptors. By contrast, the is severely constrained by a series of post-transcriptional reg- doses of IL-2, which were required for 50% maximal prolifer- ulatory events that include multiple upstream AUG codons, ation of human NK and T cells (50 –100 pM), corresponded alternate splicing, and inefficient translocation and processing closely to the measured association constants of high-affinity in the endoplasmic reticulum [49 –51]. How can these obser- IL-2 receptors on NK cells [18] and T cells [20, 21]. Further- vations be reconciled with the finding that IL-15⫺/⫺ and IL- more, the proliferation of not only T cells but also NK cells to 15R␣⫺/⫺ mice are grossly deficient in NK cells? First, it low doses of IL-2 can be inhibited by antibodies to the IL-2R␣ should be noted that there is in fact no evidence that IL-15 chain [18, 39]. However, the ability of fresh human NK cells to directly promotes the growth and differentiation of immature proliferate to low doses of IL-2 is entirely accounted for by the NK cells in vivo. The recent finding that the introduction of a existence of a small (2–5%) subpopulation of NK cells which bcl2 transgene into IL-2/15R knockout mice causes the res- expresses high levels of the IL-2R␣ chain [40, 41]. This toration of normal numbers of NK cells and that these NK cells subpopulation of NK cells is phenotypically and functionally have normal expression of Ly49 molecules but lack cytolytic distinct from the major population of NK cells, being activity [52] strongly suggests that neither IL-15 nor IL-2 is CD56hiCD16–, having relatively low cytotoxic activity, and required for the proliferative expansion of immature NK cells accounting for nearly all cytokine secretion [40 – 42]. It also and that the principal roles of IL-15 and/or IL-2 are to promote contains all of the cells that respond to IL-15 [18]. The failure the survival of an early NK progenitor and the development or of fresh mouse NK cells to proliferate to low doses of IL-2 (and maintenance of cytotoxic activity in NK cells. Recent studies IL-15) implies that no corresponding subset of NK cells exists have also revealed that although IL-15R␣ chains are required in this species. Early reports that mouse NK cells could for homeostatic proliferation of CD8 T cells, there is no re- respond to low doses of IL-2 (e.g., refs. [43, 44]) can now be quirement for these to be expressed on the CD8 T cells dismissed as artifacts caused by impurities in the IL-2 prep- themselves [53]. Second, IL-15 may not act as a soluble arations used and in the cell populations studied, exacerbated mediator. Provocative studies by Waldmann and colleagues by the propensity of IL-2-activated mouse T cells to express [54] indicate that minute quantities of IL-15 transported from asialoGM1 [45], NK1.1 [46], and lytic activity against YAC intracellular stores by the IL-15R␣ chain can be expressed at cells [47]. cell surfaces and stimulate “in trans” the proliferation of cells However, the frequent presumption that mouse NK cells do bearing IL-2/15R/␥c receptors. An implicit conclusion from not express IL-2R␣ chains is also incorrect. As shown here, these studies is that IL-15R␣ chains would not need to be homogeneously pure populations of mouse NK cells clearly expressed on immature NK cells for these cells to respond express IL-2R␣ mRNA, and long-term lines of mouse NK cells efficiently to IL-15. Low concentrations of IL-2 may also be expressed easily detectable levels of IL-2R␣ chains on the cell able to efficiently stimulate IL-2R␣-negative cells in trans surface. Freshly derived immature and mature NK cells cul- [55]. Third, IL-15 may act indirectly by inducing the produc- tured in IL-2 showed no detectable surface expression of tion of soluble or cell-bound stimulatory factors from “stromal” IL-2R␣ chains, but when cultured in IL-15 or even in medium cells present at the sites of NK cell development. Lastly, IL-15 alone, but not when cultured in a mixture of IL-2 and IL-15, at physiological concentrations may, on its own, be incapable low levels of surface IL-2R␣ chains were clearly present and in of triggering NK cells. In view of the finding that mouse NK contrast to the situation in man, were expressed on most or all cells can clearly express IL-2R␣ chains, one possibility would NK cells. Collectively, these results indicate that the lack of be that IL-15 and IL-2 act synergistically. However, although detectable IL-2R␣ chains on the surface of NK cells grown in IL-15 and IL-2 can act synergistically to initiate the growth of IL-2 is a result of the continuous down-regulation of IL-2R␣ human NK cells [56], in the present study, we could find no chains by exogenous IL-2. The speed with which IL-2R␣ evidence of a synergistic interaction between IL-2 and IL-15 chains appeared when NK cells were cultured in IL-2-free for the growth of mouse NK cells. By contrast, another ␥c medium (close to maximal expression within 3 h) suggests that cytokine, IL-21, markedly enhanced the growth of NK cells in their expression is controlled at least in part at a post-tran- the presence of low concentrations of IL-15 or IL-2. This effect scriptional level, a view supported by a recent study of the was seen only with low concentrations of IL-21; high concen- long-term human NK cell line YT, where it was found that high trations of IL-21 profoundly inhibited the growth of NK cells, concentrations of IL-2 and IL-15 could promote the synthesis in agreement with a recent report [57]. The effects of IL-21 of intracellular IL-2R␣ chains, but surface expression was only were specific for NK cells in that IL-21 failed to enhance the detected when cells were cultured in IL-15 [48]. Surprisingly, growth of T cell blasts at any dose tested and also, only we found that surface IL-2R␣ expression could be efficiently minimally inhibited the growth of T cells at high doses. This 240 Journal of Leukocyte Biology Volume 74, August 2003 http://www.jleukbio.org
contrasts with reports that IL-21 enhances the growth of fresh typic and functional characterization of long-lived NK cell lines of differ-
ent maturational status obtained from mouse fetal liver. J. Immunol. 158,
mouse T cells when added together with anti-CD3 mAb or
112–119.
allogeneic cells [32, 57], suggesting that IL-21 exerts its pri- 13. DiSanto, J. P., Keever, C. A., Small, T. N., Nicols, G. L., O’Reilly, R. J.,
mary effect on T cells when present at the time of activation. Flomenberg, N. (1990) Absence of interleukin 2 production in a severe
The ability of IL-21 to enhance the growth of immature mouse combined immunodeficiency disease syndrome with T cells. J. Exp. Med.
171, 1697–1704.
NK cells is in line with similar observations in man [32]. 14. Kundig, T. M., Schorle, H., Bachmann, M. F., Hengartner, H., Zinkerna-
However, recent studies have shown that NK cells develop gel, R. M., Horak, I. (1993) Immune responses in interleukin-2-deficient
normally in mice lacking the only known receptor for IL-21 mice. Science 262, 1059 –1061.
15. Tsunobuchi, H., Nishimura, H., Goshima, F., Daikoku, T., Nishiyama, Y.,
[57], indicating that IL-21 is not essential for NK cell devel- Yoshikai, Y. (2000) Memory-type CD8⫹ T cells protect IL-2 receptor
opment. Taken together, the results reported here and else- alpha-deficient mice from systemic infection with herpes simplex virus
where suggest that systemic concentrations of IL-21 emanating type 2. J. Immunol. 165, 4552– 4560.
from sites of T cell activation may enhance the production of 16. Suzuki, H., Duncan, G. S., Takimoto, H., Mak, T. W. (1997) Abnormal
development of intestinal intraepithelial lymphocytes and peripheral nat-
NK cells from immature progenitors in the BM and stimulate ural killer cells in mice lacking the IL-2 receptor beta chain. J. Exp. Med.
the proliferation of mature NK cells at distal sites, whereas at 185, 499 –505.
sites of inflammation where the concentrations of IL-21 are 17. Giri, J. G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K.,
Kumaki, S., Namen, A., Park, L. S., Cosman, D., Anderson, D. (1994)
higher, the further proliferation of infiltrating NK cells would Utilization of the beta and gamma chains of the IL-2 receptor by the novel
be blocked. cytokine IL-15. EMBO J. 13, 2822–2830.
18. Carson, W. E., Giri, J. G., Lindemann, M. J., Linett, M. L., Ahdieh, M.,
Paxton, R., Anderson, D., Eisenmann, J., Grabstein, K., Caligiuri, M. A.
(1994) Interleukin (IL) 15 is a novel cytokine that activates human natural
ACKNOWLEDGMENTS killer cells via components of the IL-2 receptor. J. Exp. Med. 180,
1395–1403.
19. Anderson, D. M., Kumaki, S., Ahdieh, M., Bertles, J., Tometsko, M.,
This work was supported by grants from the Biotechnology and Loomis, A., Giri, J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., et al.
Biological Sciences Research Council, UK. We gratefully ac- (1995) Functional characterization of the human interleukin-15 receptor
knowledge the kindness of the many colleagues who generously alpha chain and close linkage of IL15RA and IL2RA genes. J. Biol. Chem.
270, 29862–29869.
provided us with reagents used in this work. 20. de Jong, J. L., Farner, N. L., Widmer, M. B., Giri, J. G., Sondel, P. M.
(1996) Interaction of IL-15 with the shared IL-2 receptor beta and gamma
c subunits. The IL-15/beta/gamma c receptor-ligand complex is less stable
than the IL-2/beta/gamma c receptor-ligand complex. J. Immunol. 156,
REFERENCES 1339 –1348.
21. Grabstein, K. H., Eisenman, J., Shanebeck, K., Rauch, C., Srinivasan, S.,
1. DiSanto, J. P., Muller, W., Guy-Grand, D., Fischer, A., Rajewsky, K. Fung, V., Beers, C., Richardson, J., Schoenborn, M. A., Ahdieh, M., et al.
(1995) Lymphoid development in mice with a targeted deletion of the (1994) Cloning of a T cell growth factor that interacts with the beta chain
interleukin 2 receptor gamma chain. Proc. Natl. Acad. Sci. USA 92, of the interleukin-2 receptor. Science 264, 965–968.
377–381. 22. Giri, J. G., Kumaki, S., Ahdieh, M., Friend, D. J., Loomis, A., Shanebeck,
2. Cao, X., Shores, E. W., Hu-Li, J., Anver, M. R., Kelsall, B. L., Russell, K., DuBose, R., Cosman, D., Park, L. S., Anderson, D. M. (1995) Identi-
S. M., Drago, J., Noguchi, M., Grinberg, A., Bloom, E. T., et al. (1995) fication and cloning of a novel IL-15 binding protein that is structurally
Defective lymphoid development in mice lacking expression of the com- related to the alpha chain of the IL-2 receptor. EMBO J. 14, 3654 –3663.
mon cytokine receptor gamma chain. Immunity 2, 223–238. 23. Ogasawara, K., Hida, S., Azimi, N., Tagaya, Y., Sato, T., Yokochi-Fukuda,
3. Sugamura, K., Asao, H., Kondo, M., Tanaka, N., Ishii, N., Ohbo, K., T., Waldmann, T. A., Taniguchi, T., Taki, S. (1998) Requirement for
Nakamura, M., Takeshita, T. (1996) The interleukin-2 receptor gamma IRF-1 in the microenvironment supporting development of natural killer
chain: its role in the multiple cytokine receptor complexes and T cell cells. Nature 391, 700 –703.
development in XSCID. Annu. Rev. Immunol. 14, 179 –205. 24. Kennedy, M. K., Glaccum, M., Brown, S. N., Butz, E. A., Viney, J. L.,
4. Asao, H., Okuyama, C., Kumaki, S., Ishii, N., Tsuchiya, S., Foster, D., Embers, M., Matsuki, N., Charrier, K., Sedger, L., Willis, C. R., Brasel, K.,
Sugamura, K. (2001) Cutting edge: the common gamma-chain is an Morrissey, P. J., Stocking, K., Schuh, J. C., Joyce, S., Peschon, J. J. (2000)
indispensable subunit of the IL-21 receptor complex. J. Immunol. 167, Reversible defects in natural killer and memory CD8 T cell lineages in
1–5. interleukin 15-deficient mice. J. Exp. Med. 191, 771–780.
5. Miller, J. S., Verfaillie, C., McGlave, P. (1992) The generation of human 25. Lodolce, J. P., Boone, D. L., Chai, S., Swain, R. E., Dassopoulos, T.,
natural killer cells from CD34⫹/DR- primitive progenitors in long-term Trettin, S., Ma, A. (1998) IL-15 receptor maintains lymphoid homeostasis
bone marrow culture. Blood 80, 2182–2187. by supporting lymphocyte homing and proliferation. Immunity 9, 669 –
6. Shibuya, A., Nagayoshi, K., Nakamura, K., Nakauchi, H. (1995) Lympho- 676.
kine requirement for the generation of natural killer cells from CD34⫹ 26. Mrozek, E., Anderson, P., Caligiuri, M. A. (1996) Role of interleukin-15
hematopoietic progenitor cells. Blood 85, 3538 –3546.
in the development of human CD56⫹ natural killer cells from CD34⫹
7. Koo, G. C., Manyak, C. L. (1986) Generation of cytotoxic cells from murine
hematopoietic progenitor cells. Blood 87, 2632–2640.
bone marrow by human recombinant IL 2. J. Immunol. 137, 1751–1756.
27. Leclercq, G., Debacker, V., de Smedt, M., Plum, J. (1996) Differential
8. Delfino, D. V., Patrene, K. D., Lu, J., Deleo, A., Deleo, R., Herberman,
R. B., Boggs, S. S. (1996) Natural killer cell precursors in the CD44neg/ effects of interleukin-15 and interleukin-2 on differentiation of bipotential
dim T-cell receptor population of mouse bone marrow. Blood 87, 2394 – T/natural killer progenitor cells. J. Exp. Med. 184, 325–336.
2400. 28. Williams, N. S., Moore, T. A., Schatzle, J. D., Puzanov, I. J., Sivakumar,
9. Rosmaraki, E. E., Douagi, I., Roth, C., Colucci, F., Cumano, A., Di Santo, P. V., Zlotnik, A., Bennett, M., Kumar, V. (1997) Generation of lytic
J. P. (2001) Identification of committed NK cell progenitors in adult natural killer 1.1⫹, Ly-49 – cells from multipotential murine bone marrow
murine bone marrow. Eur. J. Immunol. 31, 1900 –1909. progenitors in a stroma-free culture: definition of cytokine requirements
10. Spits, H., Lanier, L. L., Phillips, J. H. (1995) Development of human T and and developmental intermediates. J. Exp. Med. 186, 1609 –1614.
natural killer cells. Blood 85, 2654 –2670. 29. Roth, C., Carlyle, J. R., Takizawa, H., Raulet, D. H. (2000) Clonal
11. Brooks, C. G., Georgiou, A., Jordan, R. K. (1993) The majority of imma- acquisition of inhibitory Ly49 receptors on developing NK cells is suc-
ture fetal thymocytes can be induced to proliferate to IL-2 and differen- cessively restricted and regulated by stromal class I MHC. Immunity 13,
tiate into cells indistinguishable from mature natural killer cells. J. Im- 143–153.
munol. 151, 6645– 6656. 30. Karasuyama, H., Melchers, F. (1988) Establishment of mouse cell lines
12. Manoussaka, M., Georgiou, A., Rossiter, B., Shrestha, S., Toomey, J. A., which constitutively secrete large quantities of interleukin 2, 3, 4 or 5,
Sivakumar, P. V., Bennett, M., Kumar, V., Brooks, C. G. (1997) Pheno- using modified cDNA expression vectors. Eur. J. Immunol. 18, 97–104.
Toomey et al. Cytokine requirements for the development of mouse NK cells 24131. Gillis, S., Ferm, M. M., Ou, W., Smith, K. A. (1978) T cell growth factor: 44. Grimm, E. A., Robb, R. J., Roth, J. A., Neckers, L. M., Lachman, L. B.,
parameters of production and a quantitative microassay for activity. J. Im- Wilson, D. J., Rosenberg, S. A. (1983) Lymphokine-activated killer cell
munol. 120, 2027–2032. phenomenon. III. Evidence that IL-2 is sufficient for direct activation of
32. Parrish-Novak, J., Dillon, S. R., Nelson, A., Hammond, A., Sprecher, C., peripheral blood lymphocytes into lymphokine-activated killer cells. J.
Gross, J. A., Johnston, J., Madden, K., Xu, W., West, J., Schrader, S., Exp. Med. 158, 1356 –1361.
Burkhead, S., Heipel, M., Brandt, C., Kuijper, J. L., Kramer, J., Conklin, 45. Brooks, C. G., Urdal, D. L., Henney, C. S. (1983) Lymphokine-driven
D., Presnell, S. R., Berry, J., Shiota, F., Bort, S., Hambly, K., Mudri, S., “differentiation” of cytotoxic T-cell clones into cells with NK-like speci-
Clegg, C., Moore, M., Grant, F. J., Lofton-Day, C., Gilbert, T., Rayond, F., ficity: correlations with display of membrane macromolecules. Immunol.
Ching, A., Yao, L., Smith, D., Webster, P., Whitmore, T., Maurer, M., Rev. 72, 43–72.
Kaushansky, K., Holly, R. D., Foster, D. (2000) Interleukin 21 and its 46. Brooks, C. G., Burton, R. C., Pollack, S. B., Henney, C. S. (1983) The
receptor are involved in NK cell expansion and regulation of lymphocyte presence of NK alloantigens on cloned cytotoxic T lymphocytes. J. Im-
function. Nature 408, 57– 63. munol. 131, 1391–1395.
33. Brooks, C. G., Spits, H. (2000) NK cells and LAK cells. In Haemopoietic 47. Brooks, C. G. (1983) Reversible induction of natural killer cell activity in
and Lymphoid Cell Culture (M. J. Dallman, J. R. Lamb, eds.), Cambridge, cloned murine cytotoxic T lymphocytes. Nature 305, 155–158.
Cambridge University Press, 147. 48. Alileche, A., Goldman, C. K., Waldmann, T. A. (2001) Differential effects
34. Fraser, K. P., Gays, F., Robinson, J. H., van Beneden, K., Leclercq, G., of IL-2 and IL-15 on expression of IL-2 receptor alpha. Biochem. Biophys.
Vance, R. E., Raulet, D. H., Brooks, C. G. (2002) NK cells developing in Res. Commun. 285, 1302–1308.
vitro from fetal mouse progenitors express at least one member of the Ly49 49. Bamford, R. N., Battiata, A. P., Burton, J. D., Sharma, H., Waldmann,
family that is acquired in a time-dependent and stochastic manner inde- T. A. (1996) Interleukin (IL) 15/IL-T production by the adult T-cell
pendently of CD94 and NKG2. Eur. J. Immunol. 32, 868 – 878. leukemia cell line HuT-102 is associated with a human T-cell lympho-
35. Ryan, J. C., Naper, C., Hayashi, S., Daws, M. R. (2001) Physiologic trophic virus type I region /IL-15 fusion message that lacks many up-
functions of activating natural killer (NK) complex-encoded receptors on stream AUGs that normally attenuates IL-15 mRNA translation. Proc.
NK cells. Immunol. Rev. 181, 126 –137. Natl. Acad. Sci. USA 93, 2897–2902.
36. Toomey, J. A., Shrestha, S., de la Rue, S. A., Gays, F., Robinson, J. H., 50. Bamford, R. N., DeFilippis, A. P., Azimi, N., Kurys, G., Waldmann, T. A.
(1998) The 5⬘ untranslated region, signal peptide, and the coding se-
Chrzanowska-Lightowlers, Z. M., Brooks, C. G. (1998) MHC class I
quence of the carboxyl terminus of IL-15 participate in its multifaceted
expression protects target cells from lysis by Ly49-deficient fetal NK cells.
translational control. J. Immunol. 160, 4418 – 4426.
Eur. J. Immunol. 28, 47–56.
51. Kurys, G., Tagaya, Y., Bamford, R., Hanover, J. A., Waldmann, T. A.
37. Toomey, J. A., Salcedo, M., Cotterill, L. A., Millrain, M. M., Chrzanowska-
(2000) The long signal peptide isoform and its alternative processing
Lightowlers, Z., Lawry, J., Fraser, K., Gays, F., Robinson, J. H., Shrestha,
direct the intracellular trafficking of interleukin-15. J. Biol. Chem. 275,
S., Dyson, P. J., Brooks, C. G. (1999) Stochastic acquisition of Qa1
30653–30659.
receptors during the development of fetal NK cells in vitro accounts in part 52. Minagawa, M., Watanabe, H., Miyaji, C., Tomiyama, K., Shimura, H., Ito,
but not in whole for the ability of these cells to distinguish between class A., Ito, M., Domen, J., Weissman, I. L., Kawai, K. (2002) Enforced
I-sufficient and class I- deficient targets. J. Immunol. 163, 3176 –3184. expression of Bcl-2 restores the number of NK cells, but does not rescue
38. Wei, X., Orchardson, M., Gracie, J. A., Leung, B. P., Gao, B., Guan, H., the impaired development of NKT cells or intraepithelial lymphocytes, in
Niedbala, W., Paterson, G. K., McInnes, I. B., Liew, F. Y. (2001) The IL-2/IL-15 receptor beta-chain-deficient mice. J. Immunol. 169, 4153–
Sushi domain of soluble IL-15 receptor alpha is essential for binding 4160.
IL-15 and inhibiting inflammatory and allogenic responses in vitro and in 53. Lodolce, J. P., Burkett, P. R., Boone, D. L., Chien, M., Ma, A. (2001) T
vivo. J. Immunol. 167, 277–282. cell-independent interleukin 15Ralpha signals are required for bystander
39. London, L., Perussia, B., Trinchieri, G. (1986) Induction of proliferation in proliferation. J. Exp. Med. 194, 1187–1194.
vitro of resting human natural killer cells: IL 2 induces into cell cycle most 54. Dubois, S., Mariner, J., Waldmann, T. A., Tagaya, Y. (2002) IL-15Ralpha
peripheral blood NK cells, but only a minor subset of low density T cells. recycles and presents IL-15 in trans to neighboring cells. Immunity 17,
J. Immunol. 137, 3845–3854. 537–547.
40. Caligiuri, M. A., Zmuidzinas, A., Manley, T. J., Levine, H., Smith, K. A., 55. Eicher, D. M., Waldmann, T. A. (1998) IL-2R alpha on one cell can
Ritz, J. (1990) Functional consequences of interleukin 2 receptor expres- present IL-2 to IL-2R beta/gamma(c) on another cell to augment IL-2
sion on resting human lymphocytes. Identification of a novel natural killer signaling. J. Immunol. 161, 5430 –5437.
cell subset with high affinity receptors. J. Exp. Med. 171, 1509 –1526. 56. Warren, H. S., Kinnear, B. F., Kastelein, R. L., Lanier, L. L. (1996)
41. Nagler, A., Lanier, L. L., Phillips, J. H. (1990) Constitutive expression of Analysis of the costimulatory role of IL-2 and IL-15 in initiating prolif-
high affinity interleukin 2 receptors on human CD16-natural killer cells in eration of resting (CD56dim) human NK cells. J. Immunol. 156, 3254 –
vivo. J. Exp. Med. 171, 1527–1533. 3259.
42. Cooper, M. A., Fehniger, T. A., Turner, S. C., Chen, K. S., Ghaheri, B. A., 57. Kasaian, M. T., Whitters, M. J., Carter, L. L., Lowe, L. D., Jussif, J. M.,
Ghayur, T., Carson, W. E., Caligiuri, M. A. (2001) Human natural killer Deng, B., Johnson, K. A., Witek, J. S., Senices, M., Konz, R. F., Wurster,
cells: a unique innate immunoregulatory role for the CD56(bright) subset. A. L., Donaldson, D. D., Collins, M., Young, D. A., Grusby, M. J. (2002)
Blood 97, 3146 –3151. IL-21 limits NK cell responses and promotes antigen-specific T cell
43. Henney, C. S., Kuribayashi, K., Kern, D. E., Gillis, S. (1981) Interleukin-2 activation: a mediator of the transition from innate to adaptive immunity.
augments natural killer cell activity. Nature 291, 335–338. Immunity 16, 559 –569.
242 Journal of Leukocyte Biology Volume 74, August 2003 http://www.jleukbio.orgYou can also read
